A Comprehensive Study of the Relationship between the Production of β-Lactamase Enzymes and Iron/Siderophore Uptake Regulatory Genes in Clinical Isolates of Acinetobacter baumannii.

Mahyar Porbaran,Hamed Tahmasebi,Mohammadreza Arabestani,Joseph Falkinham

doi:10.1155/2021/5565537

Abstract

BackgroundThe iron/siderophore uptake system (IUS) involved in the Acinetobacter baumannii pathogenicity. However, IUS's role in antibiotic resistance and the production of β-lactamase enzymes of A. baumannii are unclear. This study aimed to investigate the relationship between the production of β-lactamase enzymes and IUS regulatory genes in clinical isolates of A. baumannii. Methods. A. baumannii isolates were collected from clinical isolates using biochemical tests. The antibiotic resistance patterns and β-lactamase-producing strains were identified using the disk diffusion method (DDM). Also, IUS genes were detected by the polymerase chain reaction (PCR) method. Results Seventy-two (72) A. baumannii isolates were collected from a different clinical specimen. Gentamicin-resistant strains (43%) had the highest frequency, and aztreonam-resistant strains (12.5%) had the lowest frequency. Also, the distribution of AmpC and MBL producing isolates were 27.7% and 35%, respectively. Moreover, the frequencies of basD, bauA, pld, paaE, entA, feoB, hemO, and tonB genes were as follows: 12.5%, 15.2%, 11.1%, 15.2%, 19.4%, 16.6%, 23.6%, and 6.9%. Further, a strong correlation was observed between the abundance of β-lactamase-producing strains and IUS genes. Conclusions Based on our knowledge from this study, the association between β-lactamase production and IUS genes in A. baumannii plays an essential role in the emergence of drug-resistant strains.

Highlights

Acinetobacter baumannii (A. baumannii) has become an increasingly important human pathogen connected with infections acquired in hospitals [1]
We found that AmpC/MBL producing among A. baumannii isolates is significantly correlated with increased biofilm formation (p < 0.001)
They suggested that iron/siderophore uptake system (IUS) played an essential role in the prevalence of antibiotic resistance in clinical isolates of A. baumannii [28]

Summary

Introduction

Acinetobacter baumannii (A. baumannii) has become an increasingly important human pathogen connected with infections acquired in hospitals [1]. In A. baumannii, virulence factors and biofilm formation play a crucial role in disease progression in an infected host [10,11,12]. Another virulence factor studied in detail is. In response to low iron, A. baumannii produces the siderophore acinetobactin to acquire this essential micronutrient. Since iron is essential for pathogenic bacteria to cause a successful infection, siderophore-mediated iron acquisition systems have been exploited as potential therapeutic targets [13]. Agarose gel at a constant of 80 V for 60 min [3]

Results

F: TTGTGGTGCCTCTGCAATCGGT

Findings

Discussions