Abstract

The breakpoints of the deletion responsible for the Hbb(th-1) mouse model of beta-thalassemia have been isolated. A 3709 (+/- 2)-base pair (bp) region, including the entire beta major globin gene and 2 kilobases of 5' flanking region, is deleted. A novel 66 (+/- 2)-bp sequence, ending in a stretch of 25 dA:dT base pairs, was found to bridge the deletion. A region of the normal murine genome, containing the first 43 bp of the deletion-associated insert (DAI), but lacking the 25-bp dA:dT sequence, was isolated. All normal mice tested contain this DAI-like element and several inbred strains contain an additional DAI-like element. The sequence spanning the Hbb(th-1) deletion may be a reverse transcript of this region.

Highlights

  • From the $Laboratory of Molecular Hematology, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, Maryland 20892, the §Chemistry and Life Sciences Group, Research Triangle Institute, Research Triangle Park, North Carolina 27709, and the llBiology Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831

  • In the homozygous state these animals have a microcytic, hypochromic anemia with a profoundreticulocytosis. Their peripheral smears areremarkably similar to those seen in human @-thalassemia (Skow et al, 1983)

  • Chromatographisceparation of denatured globin chains reveals that the fl major globin chain, which normally represents 80% of the total adult @-globinin this (Hbb(d)) variety of mouse (Russell and McFarland, 1974), is absent

Read more

Summary

MATERIALS AND METHODS

Restriction Fragment Probes-Probes for areas related to the murine 0major globin gene were prepared as restriction enzyme digests of the 7.4-kb EcoRI fragment described by Konkel et al (1978). Restriction enzyme fragment probes were labeled by nick translation (Rigby et al, 1977) using [a-”P]dATPas substrate. Southern Blotting-DNA was extracted from the livers of the various mouse lines by the method of Gross-Bellard et al (1973). Restriction enzyme digests of genomicDNAwere transferred to nitrocellulose (Schleicher & Schuell, BA 85) after agarose gel electrophoresis in the manner described by Southern (1975). Restriction digests of recombinant phage DNA were transferred simultaneously to two sheets of nitrocellulose by sandwiching the gel between the two sheets after soaking both the gel and the nitrocellulose in 20 X SSC (SSC = 0.15 M NaC1, 0.015 M sodium citrate). Blots were baked under vacuum a t 80 “C for 2 h and stored dessicated until use They were prehybridized for 4-18 h in 6X SSC, 5 X Denhardt (1966) solution, 0.5% sodium dodecyl sulfate(SDS).

Barn HI
Molecular Defect in Murine Thalassemia
No sequences similar to it have been described in the vicinity
Molecuinlar DefecTt haMlaussreinmeia
Association of the heranucleotide GGTTTC with deletions
GAGTTTCCAG CATGATGTAAGAGGCATATT
Full Text
Published version (Free)

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call