Abstract
The S10b (SUG2) ATPase cDNA has been cloned by reverse transcription-polymerase chain reaction/rapid amplification of cDNA ends from mRNA of intersegmental muscles of the tobacco horn moth (Manduca sexta). The S10b ATPase is a component of the 26 S proteasome, and its concentration and that of its mRNA increase dramatically during development in a manner similar to other ATPases of the 19 S regulator of the 26 S proteasome. The S10b and S6' (TBP1) ATPases are also present in a complex of approximately 220 kDa in intersegmental muscles. The 220-kDa complex markedly activates (2-10-fold) the 26 S proteasome, even when bound to anti-S10b antibodies immobilized on Sepharose, and increases in concentration approximately 5-fold like the 26 S proteasome in the intersegmental muscles in preparation for the programmed death of the muscle cells. A similar activator complex is present in human brain and placenta. Free activator complexes cross-activate: the Manduca complex activates rat skeletal muscle 26 S proteasomes, and the placental complex activates Manduca 26 S proteasomes. The placental activator complex contains S10b and S6', but not p27. This 220-kDa activator complex has been evolutionarily conserved between species from insect to man and may have a fundamental role in proteasome regulation.
Highlights
The S10b (SUG2) ATPase cDNA has been cloned by reverse transcription-polymerase chain reaction/rapid amplification of cDNA ends from mRNA of intersegmental muscles of the tobacco horn moth (Manduca sexta)
The S10b ATPase is a component of the 26 S proteasome as shown by glycerol gradient centrifugation (Fig. 2); this analysis demonstrates that the increase in the tissue content of the S10b ATPase is mainly associated with the 26 S proteasome
The developmental changes in 26 S proteasomes occur only in the abdominal intersegmental muscles, which are destined to die, and not in flight muscles, which are needed in the emerging adult moths for locomotion [8, 26]
Summary
Insect Culture and Staging—The insects were raised, the stages of pre-ecdysial development recognized, and muscles collected as described previously [8]. RNA (1 g) obtained from stage 7 Manduca ISM [19] was reverse-transcribed (37 °C, 2 h) in the following 20-l reaction: 100 units of SuperScript II reverse transcriptase (Life Technologies, Inc., Paisley, UK), 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM dithiothreitol, 0.125 mM dNTPs, 20 units of RNase inhibitor (Amersham Pharmacia Biotech, St. Albans, UK), and 0.5 g of T17 adapter primer (GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTT). The full-length coding sequence of the Manduca homologue of S10b was amplified (annealing temperature of 55 °C, 35 cycles) with 2.5 units of the proofreading Pfu DNA polymerase (Stratagene), 500 M dNTPs, and 25 pmol of primers ATGCCTGCCGGACCTTCC and AAATCTATGAAGTAATTACAGAT using reverse-transcribed RNA obtained from stage 7 ISM; a 1200-base pair product was cloned into the EcoRV site of pSKϪand named pSK.S10b.cds. Glycerol Gradient Centrifugation—Soluble ISM extract (5 mg of protein) was loaded onto 14-ml 10 – 40% (v/v) glycerol gradients containing the same Tris-HCl, ATP, and MgCl2 concentrations as in homogenization buffer. After repeated washing with homogenization buffer, activator complexes were eluted from the immunoaffinity matrices for Western analyses with 1 M glycine (pH 2.5), and residual bound material was released by boiling in urea/SDS loading buffer [21]
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
