202 EXPRESSION OF APOLIPOPROTEIN B mRNA IN THE PORCINE OVIDUCT

Abstract

Apolipoprotein B (APOB) has been described as the primary apolipoprotein component of low-density lipoproteins (LDL) and is absolutely required for its formation. However, other functions related with the male reproductive process may be attributed to this protein. In mouse, expression of the Apob gene has been described in the testis and epididymis. Moreover, male mice heterozygous for a targeted mutation of the Apob gene exhibit severely compromised fertility. However, the relation between this protein and the fertilization process remain to be investigated. The objective of this study was to determine whether APOB mRNA is expressed in the porcine oviduct and to analyse its expression during the different phases of the oestrus cycle. Oviducts were obtained from sows slaughtered at a local abattoir and were classified based on follicular morphology: prepuber (containing only follicles 1 to 2 mm in diameter), preovulatory (containing 6 to 12 follicles 8 to 12 mm in diameter), post-ovulatory (containing 6 to 12 hemorrhagic corpora), and luteal phase (containing 6 to 12 corpora lutea). Total RNA was extracted from scraps of isthmus-ampullar junction mucosa using RNAqueous® kit (Ambion, Austin, TX, USA) according to the manufacturer’s instructions, and cDNA was synthesised with an oligo (dT) as primer. This cDNA was used as template in RT-PCR amplifications and qPCR using specific primers designed based on GenBank sequence for Sus scrofa APOB (L11235; Fw: caacaactcaaggcccagat, Rv: ctgaattttgccgttgattc for RT-PCR and Fw: tggccagagctgtccaaggga and Rv: ccactggagctctcagcct for qPCR). The amplification by RT-PCR resulted in a 567-bp amplicon. The sequencing of this PCR product has shown a high similarity with APOB sequences of different mammalian species. On the other hand, analysis by quantitative PCR did not reveal any differences in the expression of APOB between the samples of various stages of the oestrus cycle. In conclusion, the APOB mRNA is present in the porcine oviduct and its level of expression is similar in different phases of the cycle. The role played by this protein in the oviduct remains to be clarified. This study was supported by MICINN (AGL2009-12512-C02-01-02).