16S rRNA gene pyrosequencing of reference and clinical samples and investigation of the temperature stability of microbiome profiles.

Nela Zavaljevski,Luis J Martinez,Jason M Blaylock,Richard G Jarman,Xiaoxu Lin,Robert A Kuschner,Stephen J Thomas,Ravi Vijaya Satya,Valmik Desai,Yu Yang,Jun Hang

doi:10.1186/2049-2618-2-31

Abstract

BackgroundSample storage conditions, extraction methods, PCR primers, and parameters are major factors that affect metagenomics analysis based on microbial 16S rRNA gene sequencing. Most published studies were limited to the comparison of only one or two types of these factors. Systematic multi-factor explorations are needed to evaluate the conditions that may impact validity of a microbiome analysis. This study was aimed to improve methodological options to facilitate the best technical approaches in the design of a microbiome study. Three readily available mock bacterial community materials and two commercial extraction techniques, Qiagen DNeasy and MO BIO PowerSoil DNA purification methods, were used to assess procedures for 16S ribosomal DNA amplification and pyrosequencing-based analysis. Primers were chosen for 16S rDNA quantitative PCR and amplification of region V3 to V1. Swabs spiked with mock bacterial community cells and clinical oropharyngeal swabs were incubated at respective temperatures of -80°C, -20°C, 4°C, and 37°C for 4 weeks, then extracted with the two methods, and subjected to pyrosequencing and taxonomic and statistical analyses to investigate microbiome profile stability.ResultsThe bacterial compositions for the mock community DNA samples determined in this study were consistent with the projected levels and agreed with the literature. The quantitation accuracy of abundances for several genera was improved with changes made to the standard Human Microbiome Project (HMP) procedure. The data for the samples purified with DNeasy and PowerSoil methods were statistically distinct; however, both results were reproducible and in good agreement with each other. The temperature effect on storage stability was investigated by using mock community cells and showed that the microbial community profiles were altered with the increase in incubation temperature. However, this phenomenon was not detected when clinical oropharyngeal swabs were used in the experiment.ConclusionsMock community materials originated from the HMP study are valuable controls in developing 16S metagenomics analysis procedures. Long-term exposure to a high temperature may introduce variation into analysis for oropharyngeal swabs, suggestive of storage at 4°C or lower. The observed variations due to sample storage temperature are in a similar range as the intrapersonal variability among different clinical oropharyngeal swab samples.

Highlights

Sample storage conditions, extraction methods, PCR primers, and parameters are major factors that affect metagenomics analysis based on microbial 16S ribosomal RNA (rRNA) gene sequencing
For metagenomics studies based on 16S ribosomal RNA gene sequencing, reliable procedures for sample collection, nucleic acid extraction, PCR amplification, amplicon sequencing, and data analysis are critical for the accuracy and resolution of quantitative and comparative study on microbial communities [18,21,22]
Instead of using 16S primers 27F1 (AGAGTTTGATCCTGGCTCAG) and 534R (ATTACCGCGGCTGCTGG) in the Human Microbiome Project (HMP) procedure [35], we utilized the enormous 16S 16S ribosomal RNA gene (rDNA) sequence data rapidly accumulated in recent years to search for primers which provide the best match to most identified bacteria

Summary

Introduction

Extraction methods, PCR primers, and parameters are major factors that affect metagenomics analysis based on microbial 16S rRNA gene sequencing. For metagenomics studies based on 16S ribosomal RNA gene (rDNA) sequencing, reliable procedures for sample collection, nucleic acid extraction, PCR amplification, amplicon sequencing, and data analysis are critical for the accuracy and resolution of quantitative and comparative study on microbial communities [18,21,22]. We used the mock bacterial community genomic DNA samples and the mock bacterial community cells, both of which originated from the HMP [5,27,28], to test laboratory and data analysis procedures that will be applied to a population study of human respiratory microbiomes This pilot study was developed to evaluate technical options which have not been investigated. Swabs spiked with the mock community bacterial cells and the clinical throat swabs from healthy human subjects were stored at four different temperatures for 4 weeks and sequenced to assess the durability of the microbiome profile over time and at various storage temperatures

Objectives

Methods

Results

Conclusion