1228P - The mutant neoantigen specific T cell is a personalized immunotherapy in refractory solid tumour

Abstract

BackgroundImmune checkpoint inhibitors are an important therapy. However, their essence is nonspecific and efficiency of single usage is not satisfactory. The mutant neoantigen specific T (Nas-T) cell, as an adoptive cell treatment, is a specific immunotherapy for each individual. Our previous research has proved that the combined immunotherapy of mutant Nas-T cell and PD1 antibody is more effective than PD1 alone in prolonging PFS (World Conference on Lung Cancer 2018). We aim to evaluate the characteristics of the immune repertoire (IR) as a predictive biomarker for immunotherapy and to construct personalized and specific TCR-T. Methods14 patients with advanced solid tumors who failed after multiline treatments were recruited. They were divided into durable clinical benefit (complete response, partial response or stable disease for more than 3 months) and non-durable clinical benefit (DCB and NCB) based on PFS. Peripheral blood was collected at baseline and each cycle. IR-seq of the CDR3 regions of human TCRβ chains was used to interrogate the TCRs frequency. We used single neoantigen to stimulate the infused T cells and performed RNAseq for the sorted CD137(+) cells to obtain the full-length TCR α and β chain. Lastly, we constructed TCR-T cells via transfecting the TCR α/β pair into the T cells of patients and co-cultured with neoantigen to analyze the functionality of TCRs. ResultsAfter neoantigen pulsing, the clonality of infused T cells pool significantly increased (P=0.0001), suggesting some tumor-specific T-cells were expanded and enriched after neoantigen pulsing. Compared to baseline, T-cell repertoire of NCB and DCB after 1st cycle displayed significant changes: Shannon 1.19 vs 0.97 (P=0.002); clonality 0.68 vs 1.19 (P=0.001). Elevated clonality may indicate expanded tumor-specific T-cells which could recognize mutant neoantigen specifically. Besides, based on the in vitro TCR-T experiments, the constructed TCR-T cells can specifically recognize the mutant neoantigen and lyse the target cells expressing the corresponding neoantigen.Table1228PTableNeoantigen SequenceHLA-I typingTCR VαTCR VβGene nameSequence*All V Hits With Score#Clonal Sequence#All V Hits With Score#Clonal Sequence#MTAP/SPINK1 Fused GeneVLLPRHMKVA0201TRAV35 (574.6)TGTGCTGGGTATGGCTCTAGCAA CACAGGCAAACTAATCTTTTRBV19 (646.8)TGTGCCAGTCGGACAGGGGGA TCACCCCTCCACTTTFERNYVSNVSKFA2301TRAV29DV5 (667.6)TGTGCAGCTTCAACTGGGGCAAA CAACCTCTTCTTTTRBV7-2 (626.7)TGTGCCAGCACCTCTGCCCCC TCCTACGAGCAGTACTTCSPINK1FLLSALALLB4403TRAV20 (589.1)TGTGCTGTTCCCCTGGGAACAGG CTTTCAGAAACTTGTATTT (response to neoantigen)TRBV21-1 (557.8)TGTGCCAGCAGCAAAGACCCT AGCGGGAATCAAGAGACCCAGTACTTCCLCN6ALIGAAASLB6701TRAV19 (612.4)TGTGCTCTTCTGAATTATGGTGGTGC TACAAACAAGCTCATCTTTTRBV6-5 (675.4)TGTGCCAGCAGTGGGACAGCCAATGA GCAGTTCTTC (response to neoantigen)MTAPAESFMFRTWC0401TRAV38-2DV8 (658.4)TGTGCTTATTGGGAGCTTGTCTCTGGGG CTGGGAGTTACCAACTCACTTTCTRBV5-1 (637.6)TGCGCCAGCAGCTTGACTAGCGGGGGG TTCTACGAGCAGTACTTCTAP1RLSLFLALVC0702TRAV16 (622.2)TGTGCTCCCTGGGCCCTAGGAGGAGG TGCTGACGGACTCACCTTTTRBV30 (403.4)TGTGCCTGGAGTGTAACAGGGGGC AAAGCAGATACGCAGTATTTTMAN2C1FLQGRNFFL ConclusionsThe mutant Nas-T cell is a personalized immunotherapy. IR is a potential predictive biomarker. Legal entity responsible for the studyShunchang Jiao. FundingHas not received any funding. DisclosureAll authors have declared no conflicts of interest.