Two-pore Channel 2 Research Articles

Structural basis for inhibition of the lysosomal two-pore channel TPC2 by a small molecule antagonist

Two pore channels are lysosomal cation channels with crucial roles in tumor angiogenesis and viral release from endosomes. Inhibition of the two-pore channel 2 (TPC2) has emerged as potential therapeutic strategy for the treatment of cancers and viral infections, including Ebola and COVID-19. Here, we demonstrate that antagonist SG-094, a synthetic analog of the Chinese alkaloid medicine tetrandrine with increased potency and reduced toxicity, induces asymmetrical structural changes leading to a single binding pocket at only one intersubunit interface within the asymmetrical dimer. Supported by functional characterization of mutants by Ca2+ imaging and patch clamp experiments, we identify key residues in S1and S4 involved in compound binding to the voltage sensing domain II. SG-094 arrests IIS4 in a downward shifted state which prevents pore opening via the IIS4/S5 linker, hence resembling gating modifiers of canonical VGICs. These findings may guide the rational development of new therapeutics antagonizing TPC2 activity.

Abstract 7478: Unveiling the role of two-pore channel 2 (TPC2) in cancer immunity from monocyte differentiation to cytokine production

Abstract Background: The study of TPC2 is of great interest in the field of cancer and immune diseases, as it plays a crucial role in various cellular processes, and there is substantial evidence that TPC2 sustains several cancer hallmarks (angiogenesis, autophagy, and metastasis). The expression and role of TPC2 and its relevance to cancer in the innate immune system remain unknown. Methods: U937 TPCN2 knockdown (KD) cells were developed by nucleofection-based transfection of CRISPR-Cas9 gene editing tools. sgRNA (single guide RNA): CGUGCUGGUGAGUGAGGAUG was designed to target the fourth exon of the TPCN2 gene (Transcript ID: ENST00000294309). The model was used in tandem with pharmacological modulators of TPC2 channel activity to underpin its function in monocyte differentiation, macrophage development, and IL-8 production. Molecular biology techniques, including Sanger sequencing, qPCR, ELISA, and WB, were utilized. Proteins of murine TPC2 WT and TPC2 KO cells were extracted and sent to the Discovery Proteomics Facility of the Target Discovery Institute for label-free quantification and proteomics analysis using mass spectrometry. Results: We developed TPC2-deficient human monocytes (U937 cells) with a 75% reduction in TPCN2 expression levels, and we demonstrated that TPCN2 genetically modified U937 monocytes were resistant to monocyte differentiation after treatment with increasing concentrations of PMA ranging from 100 ng/mL to 400 ng/mL. TPC2-deficient U937 monocytes were not differentiated into Mϕ. TPC2 acts as a major regulator of monocyte differentiation by modulating PKC-alpha via calpain. In addition, the levels of IL-8 were significantly reduced after treating U937 cells with Ned 19 (an NAADP antagonist) or TPC2 KD. Keratinocyte-derived chemokine (KC) and Macrophage inflammatory protein-2 (MIP-2) are the murine IL-8 homologues. Notably, the levels of MIP-2, but not KC, were significantly reduced in the TPC2 KO murine cells compared to the WT controls. Thus, TPC2 appears to be involved in IL-8 secretion in both humans and mice. In contrast to KC at the protein level, the KC expression level was significantly reduced in TPC2-deficient murine cells. TPC2 in EE/RE is involved in lipopolysaccharide (LPS)-mediated IL-8 production in U937 cells. TPC2 modulates immune targets involving CD38, PKC-alpha, and AKT.We found that 28 different proteins that play roles in cancer immunity showed significant changes in expression in TPC2-deficient murine cells (three overexpressed proteins and 25 down-expressed proteins), compared to WT. Conclusion: Our data provide the first preclinical proof of concept for TPC2 as a potential target for blocking macrophage development and modulating CD38/IL8 levels as therapeutic strategies for cancer patients, raising questions regarding the clinical utility of TPC2 as a biomarker or immunotherapy target to modulate immune responses. Citation Format: Abeer Alharbi, John Parrington. Unveiling the role of two-pore channel 2 (TPC2) in cancer immunity from monocyte differentiation to cytokine production [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 7478.

Crosstalk between TPC2 and IP3R regulates Ca2+ signals

Calcium (Ca2+) plays a pivotal role in cellular signal transmission by triggering downstream signaling in response to an increase in the cytosolic Ca2+ concentration. Intracellular organelles serve as Ca2+ stores that induce differently shaped Ca2+ signals. We discuss a study by Yuan et al. that investigated the interplay between the lysosomal two-pore channel 2 (TPC2) and endoplasmic reticulum (ER)-localized inositol 1,4,5-trisphosphate receptors (IP3Rs).

Endolysosomal two-pore channel 2 plays opposing roles in primary and metastatic malignant melanoma cells.

The ion channel two-pore channel 2 (TPC2), localised on the membranes of acidic organelles such as endo-lysosomes and melanosomes, has been shown to play a role in pathologies including cancer, and it is differently expressed in primary versus metastatic melanoma cells. Whether TPC2 plays a pro- or anti-oncogenic role in different tumour conditions is a relevant open question which we have explored in melanoma at different stages of tumour progression. The behaviour of primary melanoma cell line B16F0 and its metastatic subline B16F10 were compared in response to TPC2 modulation by silencing (by small interfering RNA), knock-out (by CRISPR/Cas9) and overexpression (by mCherry-TPC2 transfected plasmid). TPC2 silencing increased cell migration, epithelial-to-mesenchymal transitionand autophagy in the metastatic samples, but abated them in the silenced primary ones. Interestingly, while TPC2 inactivation failed to affect markers of proliferation in both samples, it strongly enhanced the migratory behaviour of the metastatic cells, again suggesting that in the more aggressive phenotype TPC2 plays a specific antimetastatic role. In line with this, overexpression of TPC2 in B16F10 cells resulted in phenotype rescue, that is, a decrease in migratory ability, thus collectively resuming traits of the B16F0 primary cell line. Our research shows a novel role of TPC2 in melanoma cells that is intriguingly different in initial versus late stages of cancer progression.

Two-pore channel-2 and inositol trisphosphate receptors coordinate Ca2+ signals between lysosomes and the endoplasmic reticulum

Lysosomes and the endoplasmic reticulum (ER) are Ca2+ stores mobilized by the second messengers NAADP and IP3, respectively. Here, we establish Ca2+ signals between the two sources as fundamental building blocks that couple local release to global changes in Ca2+. Cell-wide Ca2+ signals evoked by activation of endogenous NAADP-sensitive channels on lysosomes comprise both local and global components and exhibit a major dependence on ER Ca2+ despite their lysosomal origin. Knockout of ER IP3 receptor channels delays these signals, whereas expression of lysosomal TPC2 channels accelerates them. High-resolution Ca2+ imaging reveals elementary events upon TPC2 opening and signals coupled to IP3 receptors. Biasing TPC2 activation to a Ca2+-permeable state sensitizes local Ca2+ signals to IP3. This increases the potency of a physiological agonist to evoke global Ca2+ signals and activate a downstream target. Our data provide a conceptual framework to understand how Ca2+ release from physically separated stores is coordinated.

Loss of two-pore channel 2 function in melanoma-derived tumours reduces tumour growth in vivo but greatly increases tumour-related toxicity in the organism

BackgroundMelanoma, a severe form of skin cancer, poses significant health risks due to its aggressive nature and potential for metastasis. The role of two-pore channel 2 (TPC2) in the development and progression of melanoma remains poorly understood. This study aims to investigate the impact of TPC2 knockout (KO) on melanoma-derived tumors, focusing on tumour growth and related toxicity in the organism.MethodsThe study utilized CHL-1 and B16 melanoma cell lines with TPC2 KO to assess the changes in proliferation dynamics. Methods included real-time monitoring of cell proliferation using the xCELLigence system, in vivo tumour growth assays in mice, histopathological analyses, inflammation marker assessment, and quantitative PCR (qPCR) for gene expression analysisResultsTPC2 KO was found to significantly alter the proliferation dynamics of CHL-1 and B16 melanoma cells. The in vivo studies demonstrated reduced tumor growth in TPC2 KO cell-derived tumors. However, a notable increase in tumor-related toxicity in affected organs, such as the liver and spleen, was observed, indicating a complex role of TPC2 in melanoma pathology.ConclusionsThe loss of TPC2 function in melanoma cells leads to reduced tumour growth but exacerbates tumour-related toxicity in the organism. These findings highlight the dual role of TPC2 in melanoma progression and its potential as a therapeutic target. Further research is needed to fully understand the mechanisms underlying these effects and to explore TPC2 as a treatment target in melanoma.Graphical

Lysosomal calcium loading promotes spontaneous calcium release by potentiating ryanodine receptors

Spontaneous calcium release by ryanodine receptors (RyRs) due to intracellular calcium overload results in delayed afterdepolarizations, closely associated with life-threatening arrhythmias. In this regard, inhibiting lysosomal calcium release by two-pore channel 2 (TPC2) knockout has been shown to reduce the incidence of ventricular arrhythmias under β-adrenergic stimulation. However, mechanistic investigations into the role of lysosomal function on RyR spontaneous release remain missing. We investigate the calcium handling mechanisms by which lysosome function modulates RyR spontaneous release, and determine how lysosomes are able to mediate arrhythmias by its influence on calcium loading. Mechanistic studies were conducted using a population of biophysically detailed mouse ventricular models including for the first time modeling of lysosomal function, and calibrated by experimental calcium transients modulated by TPC2. We demonstrate that lysosomal calcium uptake and release can synergistically provide a pathway for fast calcium transport, by which lysosomal calcium release primarily modulates sarcoplasmic reticulum calcium reuptake and RyR release. Enhancement of this lysosomal transport pathway promoted RyR spontaneous release by elevating RyR open probability. In contrast, blocking either lysosomal calcium uptake or release revealed an antiarrhythmic impact. Under conditions of calcium overload, our results indicate that these responses are strongly modulated by intercellular variability in L-type calcium current, RyR release, and sarcoplasmic reticulum calcium-ATPase reuptake. Altogether, our investigations identify that lysosomal calcium handling directly influences RyR spontaneous release by regulating RyR open probability, suggesting antiarrhythmic strategies and identifying key modulators of lysosomal proarrhythmic action.

Rac1 and Rac3 GTPases and TPC2 are required for axonal outgrowth and migration of cortical interneurons.

Rho GTPases, among them Rac1 and Rac3, are major transducers of extracellular signals and are involved in multiple cellular processes. In cortical interneurons, the neurons that control the balance between excitation and inhibition of cortical circuits, Rac1 and Rac3 are essential for their development. Ablation of both leads to a severe reduction in the numbers of mature interneurons found in the murine cortex, which is partially due to abnormal cell cycle progression of interneuron precursors and defective formation of growth cones in young neurons. Here, we present new evidence that upon Rac1 and Rac3 ablation, centrosome, Golgi complex and lysosome positioning is significantly perturbed, thus affecting both interneuron migration and axon growth. Moreover, for the first time, we provide evidence of altered expression and localization of the two-pore channel 2 (TPC2) voltage-gated ion channel that mediates Ca2+ release. Pharmacological inhibition of TPC2 negatively affected axonal growth and migration of interneurons. Our data, taken together, suggest that TPC2 contributes to the severe phenotype in axon growth initiation, extension and interneuron migration in the absence of Rac1 and Rac3.

Pharmacological inhibition of lysosomal two-pore channel 2 (TPC2) confers neuroprotection in stroke via autophagy regulation

Lysosomal function and organellar Ca2+ homeostasis become dysfunctional in Stroke causing disturbances in autophagy, the major process for the degradation of abnormal protein aggregates and dysfunctional organelles. However, the role of autophagy in Stroke is controversial since excessive or prolonged autophagy activation exacerbates ischemic brain injury. Of note, glutamate evokes NAADP-dependent Ca2+ release via lysosomal TPC2 channels thus controlling basal autophagy. Considering the massive release of excitotoxins in Stroke, autophagic flux becomes uncontrolled with abnormal formation of autophagosomes causing, in turn, disruption of excitotoxins clearance and neurodegeneration. Here, a fine regulation of autophagy via a proper pharmacological modulation of lysosomal TPC2 channel has been tested in preclinical Stroke models. Primary cortical neurons were subjected to oxygen and glucose deprivation+reoxygenation to reproduce in vitro brain ischemia. Focal brain ischemia was induced in rats by transient middle cerebral artery occlusion (tMCAO). Under these conditions, TPC2 protein expression as well as autophagy and endoplasmic reticulum (ER) stress markers were studied by Western blotting, while TPC2 localization and activity were measured by immunocytochemistry and single-cell video-imaging, respectively. TPC2 protein expression and immunosignal were highly modulated in primary cortical neurons exposed to extreme hypoxic conditions causing dysfunction in organellar Ca2+ homeostasis, ER stress and autophagy-induced cell death. TPC2 knocking down and pharmacological inhibition by Ned-19 during hypoxia induced neuroprotection. The effect of Ned-19 was reversed by the permeable form of TPC2 endogenous agonist, NAADP-AM. Of note, Ned-19 prevented ER stress, as measured by GRP78 (78 kDa glucose-regulated protein) protein reduction and caspase 9 downregulation. In this way Ned-19 restored organellar Ca2+ level. Interestingly, Ned-19 reduced the infarct volume and neurological deficits in rats subjected to tMCAO and prevented hypoxia-induced cell death by blocking autophagic flux. Collectively, the pharmacological inhibition of TPC2 lysosomal channel by Ned-19 protects from focal ischemia by hampering a hyperfunctional autophagy.

A gain-of-function TPC2 variant R210C increases affinity to PI(3,5)P2 and causes lysosome acidification and hypopigmentation

Albinism is a group of inherited disorders mainly affecting skin, hair and eyes. Here we identify a de novo point mutation, p.R210C, in the TPCN2 gene which encodes Two Pore Channel 2 (TPC2) from a patient with albinism. TPC2 is an endolysosome and melanosome localized non-selective cation channel involved in regulating pigment production. Through inside-out recording of plasma membrane targeted TPC2 and direct recording of enlarged endolysosomal vacuoles, we reveal that the R210C mutant displays constitutive channel activation and markedly increased affinity to PI(3,5)P2. Mice harboring the homologous mutation, R194C, also exhibit hypopigmentation in the fur and skin, as well as less pigment and melanosomes in the retina in a dominant inheritance manner. Moreover, mouse embryonic fibroblasts carrying the R194C mutation show enlarged endolysosomes, enhanced lysosomal Ca2+ release and hyper-acidification. Our data suggest that R210C is a pathogenic gain-of-function TPC2 variant that underlies an unusual dominant type of albinism.

Tetrandrine ameliorates cognitive deficits and mitigates tau aggregation in cell and animal models of tauopathies

BackgroundTauopathies are neurodegenerative diseases that are associated with the pathological accumulation of tau-containing tangles in the brain. Tauopathy can impair cognitive and motor functions and has been observed in Alzheimer’s disease (AD) and frontotemporal dementia (FTD). The aetiology of tauopathy remains mysterious; however, recent studies suggest that the autophagic-endolysosomal function plays an essential role in the degradation and transmission of pathological tau. We previously demonstrated that tetrandrine could ameliorate memory functions and clear amyloid plaques in transgenic AD mice by restoring autophagic-endolysosomal function. However, the efficacy of tetrandrine and the associated therapeutic mechanism in tauopathies have not been evaluated and elucidated.MethodsNovel object recognition, fear conditioning and electrophysiology were used to evaluate the effects of tetrandrine on memory functions in transgenic tau mice. Western blotting and immunofluorescence staining were employed to determine the effect of tetrandrine on autophagy and tau clearance in vivo. Calcium (Ca2+) imaging and flow cytometry were used to delineate the role of pathological tau and tetrandrine in lysosomal Ca2+ and pH homeostasis. Biochemical BiFC fluorescence, Western blotting and immunofluorescence staining were used to evaluate degradation of hyperphosphorylated tau in vitro, whereas coculture of brain slices with isolated microglia was used to evaluate tau clearance ex vivo.ResultsWe observed that tetrandrine treatment mitigated tau tangle development and corrected memory impairment in Thy1-hTau.P301S transgenic mice. Mechanistically, we showed that mutant tau expression disrupts lysosome pH by increasing two-pore channel 2 (TPC2)-mediated Ca2+ release, thereby contributing to lysosome alkalinization. Tetrandrine inhibits TPC2, thereby restoring the lysosomal pH, promotes tau degradation via autophagy, and ameliorates tau aggregation. Furthermore, in an ex vivo assay, we demonstrated that tetrandrine treatment promotes pathological tau clearance by microglia.ConclusionsTogether, these findings suggest that pathological tau disturbs endolysosomal homeostasis to impair tau clearance. This impairment results in a vicious cycle that accelerates disease pathogenesis. The success of tetrandrine in reducing tau aggregation suggests first, that tetrandrine could be an effective drug for tauopathies and second, that rescuing lysosomal Ca2+ homeostasis, thereby restoring ALP function, could be an effective general strategy for the development of novel therapies for tauopathies.

Tuning TPC2

• Combined addition of TPC2-A1-N and TPC2-A1-P increases the permeability for Ca2+ions of two-pore channel 2 (TPC2). • TPC2 can be tuned to more rapid and larger Ca2+ signals by combined stimulation of TPC2 using TPC2-A1-N and TPC2-A1-P. • Mechanism of action of TPC2-A1-N needs clarification regarding cytosolic NAADP receptor proteins.

TPC2 rescues lysosomal storage in mucolipidosis type IV, Niemann–Pick type C1, and Batten disease

Lysosomes are cell organelles that degrade macromolecules to recycle their components. If lysosomal degradative function is impaired, e.g., due to mutations in lysosomal enzymes or membrane proteins, lysosomal storage diseases (LSDs) can develop. LSDs manifest often with neurodegenerative symptoms, typically starting in early childhood, and going along with a strongly reduced life expectancy and quality of life. We show here that small molecule activation of the Ca2+‐permeable endolysosomal two‐pore channel 2 (TPC2) results in an amelioration of cellular phenotypes associated with LSDs such as cholesterol or lipofuscin accumulation, or the formation of abnormal vacuoles seen by electron microscopy. Rescue effects by TPC2 activation, which promotes lysosomal exocytosis and autophagy, were assessed in mucolipidosis type IV (MLIV), Niemann–Pick type C1, and Batten disease patient fibroblasts, and in neurons derived from newly generated isogenic human iPSC models for MLIV and Batten disease. For in vivo proof of concept, we tested TPC2 activation in the MLIV mouse model. In sum, our data suggest that TPC2 is a promising target for the treatment of different types of LSDs, both in vitro and in‐vivo.

Targeting TPC2 sensitizes acute lymphoblastic leukemia cells to chemotherapeutics by impairing lysosomal function

Despite novel therapy regimens and extensive research, chemoresistance remains a challenge in leukemia treatment. Of note, recent studies revealed lysosomes as regulators of cell death and chemotherapy response, suggesting this organelle is a novel target for chemosensitization. Interestingly, drug-resistant VCR-R CEM acute lymphoblastic leukemia (ALL) cells have an increased expression of the lysosomal cation channel Two-Pore-Channel 2 (TPC2) compared to drug-naïve CCRF-CEM ALL cells. Concurrently, knockout (KO) of TPC2 sensitized drug-resistant VCR-R CEM cells to treatment with cytostatics. The chemosensitizing effect could be confirmed in several cell lines as well as in heterogeneous, patient-derived xenograft ALL cells, using the pharmacological TPC2 inhibitors naringenin and tetrandrine. We reveal that a dual mechanism of action mediates chemo sensitization by loss of lysosomal TPC2 function. First, because of increased lysosomal pH, lysosomal drug sequestration is impaired, leading to an increased nuclear accumulation of doxorubicin and hence increased DNA damage. Second, lysosomes of TPC2 KO cells are more prone to lysosomal damage as a result of morphological changes and dysregulation of proteins influencing lysosomal stability. This leads to induction of lysosomal cell death (LCD), evident by increased cathepsin B levels in the cytosol, truncation of pro-apoptotic Bid, as well as the reversibility of cell death by co-treatment with the cathepsin B inhibitor CA-074Me in TPC2 KO cells. In summary, this study establishes TPC2 as a novel, promising, druggable target for combination therapy approaches in ALL to overcome chemoresistance, which could be exploited in the clinic in the future. Additionally, it unravels LCD signaling as an important death-inducing component upon loss of TPC2 function.

Endolysosomal Cation Channels and MITF in Melanocytes and Melanoma.

Microphthalmia-associated transcription factor (MITF) is the principal transcription factor regulating pivotal processes in melanoma cell development, growth, survival, proliferation, differentiation and invasion. In recent years, convincing evidence has been provided attesting key roles of endolysosomal cation channels, specifically TPCs and TRPMLs, in cancer, including breast cancer, glioblastoma, bladder cancer, hepatocellular carcinoma and melanoma. In this review, we provide a gene expression profile of these channels in different types of cancers and decipher their roles, in particular the roles of two-pore channel 2 (TPC2) and TRPML1 in melanocytes and melanoma. We specifically discuss the signaling cascades regulating MITF and the relationship between endolysosomal cation channels, MAPK, canonical Wnt/GSK3 pathways and MITF.

Flavonoids increase melanin production and reduce proliferation, migration and invasion of melanoma cells by blocking endolysosomal/melanosomal TPC2

Two-pore channel 2 (TPC2) resides in endolysosomal membranes but also in lysosome-related organelles such as the melanin producing melanosomes. Gain-of-function polymorphisms in hTPC2 are associated with decreased melanin production and blond hair color. Vice versa genetic ablation of TPC2 increases melanin production. We show here an inverse correlation between melanin production and melanoma proliferation, migration, and invasion due to the dual activity of TPC2 in endolysosomes and melanosomes. Our results are supported by both genetic ablation and pharmacological inhibition of TPC2. Mechanistically, our data show that loss/block of TPC2 results in reduced protein levels of MITF, a major regulator of melanoma progression, but an increased activity of the melanin-generating enzyme tyrosinase. TPC2 inhibition thus provides a twofold benefit in melanoma prevention and treatment by increasing, through interference with tyrosinase activity, the synthesis of UV blocking melanin in melanosomes and by decreasing MITF-driven melanoma progression by increased GSK3β-mediated MITF degradation.

Gene editing and synthetically accessible inhibitors reveal role for TPC2 in HCC cell proliferation and tumor growth

The role of two-pore channel 2 (TPC2), one of the few cation channels localized on endolysosomal membranes, in cancer remains poorly understood. Here, we report that TPC2 knockout reduces proliferation of cancer cells invitro, affects their energy metabolism, and successfully abrogates tumor growth invivo. Concurrently, we have developed simplified analogs of the alkaloid tetrandrine as potent TPC2 inhibitors by screening a library of synthesized benzyltetrahydroisoquinoline derivatives. Removal of dispensable substructures of the lead molecule tetrandrine increases antiproliferative properties against cancer cells and impairs proangiogenic signaling of endothelial cells to a greater extent than tetrandrine. Simultaneously, toxic effects on non-cancerous cells are reduced, allowing invivo administration and revealing a TPC2 inhibitor with antitumor efficacy in mice. Hence, our study unveils TPC2 as valid target for cancer therapy and provides easily accessible tetrandrine analogs as a promising option for effective pharmacological interference.

Pharmacological hypothesis: TPC2 antagonist tetrandrine as a potential therapeutic agent for COVID-19.

More than ten million patients worldwide have been diagnosed with coronavirus disease 19 (COVID‐19) to date (WHO situation report, 1st July 2020). There is no vaccine to prevent infection with the causative organism, severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2), nor a cure. In the struggle to devise potentially useful therapeutics in record time, the repurposing of existing compounds is a key route of action. In this hypothesis paper, we argue that the bisbenzylisoquinoline and calcium channel blocker tetrandrine, originally extracted from the plant Stephania tetrandra and utilized in traditional Chinese medicine, may have potential in the treatment of COVID‐19 and should be further investigated. We collate and review evidence for tetrandrine's putative mechanism of action in viral infection, specifically its recently discovered antagonism of the two‐pore channel 2 (TPC2). While tetrandrine's particular history of use provides a very limited pharmacological dataset, there is a suggestion from the available evidence that it could be effective at doses used in clinical practice. We suggest that further research to investigate this possibility should be conducted.

Loss of Two-Pore Channel 2 (TPC2) Expression Increases the Metastatic Traits of Melanoma Cells by a Mechanism Involving the Hippo Signalling Pathway and Store-Operated Calcium Entry.

Melanoma is one of the most aggressive and treatment-resistant human cancers. The two-pore channel 2 (TPC2) is located on late endosomes, lysosomes and melanosomes. Here, we characterized how TPC2 knockout (KO) affected human melanoma cells derived from a metastatic site. TPC2 KO increased these cells’ ability to invade the extracelullar matrix and was associated with the increased expression of mesenchymal markers ZEB-1, Vimentin and N-Cadherin, and the enhanced secretion of MMP9. TPC2 KO also activated genes regulated by YAP/TAZ, which are key regulators of tumourigenesis and metastasis. Expression levels of ORAI1, a component of store-operated Ca2+ entry (SOCE), and PKC-βII, part of the HIPPO pathway that negatively regulates YAP/TAZ activity, were reduced by TPC2 KO and RNA interference knockdown. We propose a cellular mechanism mediated by ORAI1/Ca2+/PKC-βII to explain these findings. Highlighting their potential clinical significance, patients with metastatic tumours showed a reduction in TPC2 expression. Our research indicates a novel role of TPC2 in melanoma. While TPC2 loss may not activate YAP/TAZ target genes in primary melanoma, in metastatic melanoma it could activate such genes and increase cancer aggressiveness. These findings aid the understanding of tumourigenesis mechanisms and could provide new diagnostic and treatment strategies for skin cancer and other metastatic cancers.

The name tells the story: Two-pore channels

TPC2-A1-N and TPC2-A1-P, two novel small molecules, differentially activate two-pore channel 2 (TPC2) and mimic the activation of TPC2 with NAADP and PIP2, resulting in distinct ion channel selectivities. These two different modes of TPC2 activity have physiological, and possibly pathophysiological, implications as they can modulate vesicle trafficking and lysosomal exocytosis.