Keratinocyte-derived Chemokine Research Articles

Kahweol Inhibits Pro-Inflammatory Cytokines and Chemokines in Tumor Necrosis Factor-α/Interferon-γ-Stimulated Human Keratinocyte HaCaT Cells.

Atopic dermatitis (AD), marked by intense itching and eczema-like lesions, is a globally increasing chronic skin inflammation. Kahweol, a diterpene that naturally occurs in coffee beans, boasts anti-inflammatory, antioxidative, and anti-cancer properties. This research explores the anti-inflammatory action of kahweol on HaCaT human keratinocytes stimulated by tumor necrosis factor-α (TNF-α) and interferon-γ (IFN-γ), focusing on key signal transduction pathways. Our results demonstrate that kahweol markedly reduces the production of IL-1β, IL-6, C-X-C motif chemokine ligand 8, and macrophage-derived chemokine in TNF-α/IFN-γ-activated HaCaT cells. Furthermore, it curtails the phosphorylation of key proteins in the mitogen-activated protein kinase (MAPK) pathways, including c-Jun N-terminal kinase, extracellular signal-regulated kinase, and p38. Additionally, kahweol impedes the phosphorylation and nuclear translocation of the NF-κB p65 subunit and constrains its DNA-binding capability. It also hampers the phosphorylation, nuclear translocation, and DNA-binding activities of signal transducer and activator of transcription 1 (STAT1) and STAT3. Collectively, these findings suggest that kahweol hinders the generation of cytokines and chemokines in inflamed keratinocytes by inhibiting the MAPK, NF-κB, and STAT cascades. These insights position kahweol as a promising agent for dermatological interventions, especially in managing inflammatory skin conditions such as AD.

Voluntary exercise preserves visual function and reduces inflammatory response in an adult mouse model of autosomal dominant retinitis pigmentosa

Whole-body physical exercise has been shown to promote retinal structure and function preservation in animal models of retinal degeneration. It is currently unknown how exercise modulates retinal inflammatory responses. In this study, we investigated cytokine alterations associated with retinal neuroprotection induced by voluntary running wheel exercise in a retinal degeneration mouse model of class B1 autosomal dominant retinitis pigmentosa, I307N Rho. I307N Rho mice undergo rod photoreceptor degeneration when exposed to bright light (induced). Our data show, active induced mice exhibited significant preservation of retinal and visual function compared to inactive induced mice after 4 weeks of exercise. Retinal cytokine expression revealed significant reductions of proinflammatory chemokines, keratinocyte-derived chemokine (KC) and interferon gamma inducible protein-10 (IP-10) expression in active groups compared to inactive groups. Through immunofluorescence, we found KC and IP-10 labeling localized to retinal vasculature marker, collagen IV. These data show that whole-body exercise lowers specific retinal cytokine expression associated with retinal vasculature. Future studies should determine whether suppression of inflammatory responses is requisite for exercise-induced retinal protection.

Abstract 7478: Unveiling the role of two-pore channel 2 (TPC2) in cancer immunity from monocyte differentiation to cytokine production

Abstract Background: The study of TPC2 is of great interest in the field of cancer and immune diseases, as it plays a crucial role in various cellular processes, and there is substantial evidence that TPC2 sustains several cancer hallmarks (angiogenesis, autophagy, and metastasis). The expression and role of TPC2 and its relevance to cancer in the innate immune system remain unknown. Methods: U937 TPCN2 knockdown (KD) cells were developed by nucleofection-based transfection of CRISPR-Cas9 gene editing tools. sgRNA (single guide RNA): CGUGCUGGUGAGUGAGGAUG was designed to target the fourth exon of the TPCN2 gene (Transcript ID: ENST00000294309). The model was used in tandem with pharmacological modulators of TPC2 channel activity to underpin its function in monocyte differentiation, macrophage development, and IL-8 production. Molecular biology techniques, including Sanger sequencing, qPCR, ELISA, and WB, were utilized. Proteins of murine TPC2 WT and TPC2 KO cells were extracted and sent to the Discovery Proteomics Facility of the Target Discovery Institute for label-free quantification and proteomics analysis using mass spectrometry. Results: We developed TPC2-deficient human monocytes (U937 cells) with a 75% reduction in TPCN2 expression levels, and we demonstrated that TPCN2 genetically modified U937 monocytes were resistant to monocyte differentiation after treatment with increasing concentrations of PMA ranging from 100 ng/mL to 400 ng/mL. TPC2-deficient U937 monocytes were not differentiated into Mϕ. TPC2 acts as a major regulator of monocyte differentiation by modulating PKC-alpha via calpain. In addition, the levels of IL-8 were significantly reduced after treating U937 cells with Ned 19 (an NAADP antagonist) or TPC2 KD. Keratinocyte-derived chemokine (KC) and Macrophage inflammatory protein-2 (MIP-2) are the murine IL-8 homologues. Notably, the levels of MIP-2, but not KC, were significantly reduced in the TPC2 KO murine cells compared to the WT controls. Thus, TPC2 appears to be involved in IL-8 secretion in both humans and mice. In contrast to KC at the protein level, the KC expression level was significantly reduced in TPC2-deficient murine cells. TPC2 in EE/RE is involved in lipopolysaccharide (LPS)-mediated IL-8 production in U937 cells. TPC2 modulates immune targets involving CD38, PKC-alpha, and AKT.We found that 28 different proteins that play roles in cancer immunity showed significant changes in expression in TPC2-deficient murine cells (three overexpressed proteins and 25 down-expressed proteins), compared to WT. Conclusion: Our data provide the first preclinical proof of concept for TPC2 as a potential target for blocking macrophage development and modulating CD38/IL8 levels as therapeutic strategies for cancer patients, raising questions regarding the clinical utility of TPC2 as a biomarker or immunotherapy target to modulate immune responses. Citation Format: Abeer Alharbi, John Parrington. Unveiling the role of two-pore channel 2 (TPC2) in cancer immunity from monocyte differentiation to cytokine production [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 7478.

Radiation Dermatitis: Radiation-Induced Effects on the Structural and Immunological Barrier Function of the Epidermis.

An important hallmark of radiation dermatitis is the impairment of the mitotic ability of the stem/progenitor cells in the basal cell layers due to radiation-induced DNA damage, leading to suppressed cell renewal in the epidermis. However, this mechanism alone does not adequately explain the complex pathogenesis of radiation-induced skin injury. In this review, we summarize the latest findings on the complex pathogenesis of radiation dermatitis and correlate these with the clinical features of radiation-induced skin reactions. The current studies show that skin exposure to ionizing radiation induces cellular senescence in the epidermal keratinocytes. As part of their epithelial stress response, these senescent keratinocytes secrete pro-inflammatory mediators, thereby triggering skin inflammation. Keratinocyte-derived cytokines and chemokines modulate intercellular communication with the immune cells, activating skin-resident and recruiting skin-infiltrating immune cells within the epidermis and dermis, thereby orchestrating the inflammatory response to radiation-induced tissue damage. The increased expression of specific chemoattractant chemokines leads to increased recruitment of neutrophils into the irradiated skin, where they release cytotoxic granules that are responsible for the exacerbation of an inflammatory state. Moreover, the importance of IL-17-expressing γδ-T cells to the radiation-induced hyperproliferation of keratinocytes was demonstrated, leading to reactive hyperplasia of the epidermis. Radiation-induced, reactive hyperproliferation of the keratinocytes disturbs the fine-tuned keratinization and cornification processes, leading to structural dysfunction of the epidermal barrier. In summary, in response to ionizing radiation, epidermal keratinocytes have important structural and immunoregulatory barrier functions in the skin, coordinating interacting immune responses to eliminate radiation-induced damage and to initiate the healing process.

TRPM2-dependent autophagy inhibition exacerbates oxidative stress-induced CXCL16 secretion by keratinocytes in vitiligo.

Vitiligo is a depigmented skin disease due to the destruction of melanocytes. Under oxidative stress, keratinocyte-derived chemokine C-X-C motif ligand 16 (CXCL16) plays a critical role in recruiting CD8+ T cells, which kill melanocytes. Autophagy serves as a protective cell survival mechanism and impairment of autophagy has been linked to increased secretion of the proinflammatory cytokines. However, the role of autophagy in the secretion of CXCL16 under oxidative stress has not been investigated. Herein, we initially found that autophagy was suppressed in both keratinocytes of vitiligo lesions and keratinocytes exposed to oxidative stress in vitro. Autophagy inhibition also promoted CXCL16 secretion. Furthermore, upregulated transient receptor potential cation channel subfamily M member 2 (TRPM2) functioned as an upstream oxidative stress sensor to inhibit autophagy. Moreover, TRPM2-mediated Ca2+ influx activated calpain to shear autophagy related 5 (Atg5) and Atg12-Atg5 conjugate formation was blocked to inhibit autophagy under oxidative stress. More importantly, Atg5 downregulation enhanced the binding of interferon regulatory factor 3 (IRF3) to the CXCL16 promoter region by activating Tank-binding kinase 1 (TBK1), thus promoting CXCL16 secretion. These findings suggested that TRPM2-restrained autophagy promotes CXCL16 secretion via the Atg5-TBK1-IRF3 signaling pathway under oxidative stress. Inhibition of TRPM2 may serve as a potential target for the treatment of vitiligo. © 2024 The Pathological Society of Great Britain and Ireland.

NLRP3 regulates CIITA/MHC II axis and interferon-γ-inducible chemokines in Malassezia globosa-infected keratinocytes.

CIITA, a member of NOD-like receptor (NLR) family, is the major MHC II trans-activator and mediator of Th1 immunity, but its function and interaction with NLRP3 have been little studied. We found activation of NLRP3 inflammasome, increased expression of CIITA, CBP, pSTAT1, STAT1, MHC II, IFN-γ and IFN-γ-inducible chemokines (CCL1 and CXCL8), and colocalisation of NLRP3 with CIITA in Malassezia folliculitis lesions, Malassezia globosa-infected HaCaT cells and mouse skin. CoIP with anti-CIITA or anti-NLRP3 antibody pulled down NLRP3 or both CIITA and ASC. NLRP3 silencing or knockout caused CIITA downexpression and their colocalisation disappearance in HaCaT cells and mouse skin of Nlrp3-/- mice, while CIITA knockdown had no effect on NLRP3, ASC, IL-1β and IL-18 expression. NLRP3 inflammasome inhibitors and knockdown significantly suppressed IFN-γ, CCL1, CXCL8 and CXCL10 levels in M. globosa-infected HaCaT cells. CCL1 and CXCL8 expression was elevated in Malassezia folliculitis lesions and reduced in Nlrp3-/- mice. These results demonstrate that M. globosa can activate NLRP3 inflammasome, CIITA/MHC II signalling and IFN-γ-inducible chemokines in human keratinocytes and mouse skin. NLRP3 may regulate CIITA by their binding and trigger Th1 immunity by secreting CCL1 and CXCL8/IL-8, contributing to the pathogenesis of Malassezia-associated skin diseases.

A Nanoinhibitor Targeting cGAS‐STING Pathway to Reverse the Homeostatic Imbalance of Inflammation in Psoriasis

AbstractPsoriasis is a chronic skin inflammation characterized by dysregulated crosstalk between immune cells and keratinocytes. Here we show that the cyclic GMP‐AMP synthase (cGAS)‐stimulator of interferon genes (STING) pathway is a key regulator of psoriatic inflammation in a mouse model. Platinum‐doped positively charged carbon dots (Pt‐CDs) were designed to inhibit the cGAS‐STING pathway. By inhibiting the cGAS‐STING pathway with Pt‐CDs, the secretion of proinflammatory cytokines in macrophages was reduced, and the proinflammatory cytokines‐induced breakdown of immunological tolerance and overexpression of chemokines in keratinocytes was restored, which reversed the homeostatic imbalance through breaking these cytokines‐mediated intercellular positive feedback loop. Topical Pt‐CDs treatment exhibited therapeutic effects in imiquimod‐induced psoriasis mice without noticeable toxicity. The reversal of elevated expression of STING, phosphorylated STING, and downstream genes within psoriatic lesions indicates that Pt‐CDs effectively inhibit the cGAS‐STING pathway. This work suggests a promising strategy for psoriasis treatment by targeting the cGAS‐STING pathway with Pt‐CDs nanoinhibitor to restore skin homeostatic balance.

A Nanoinhibitor Targeting cGAS-STING Pathway to Reverse the Homeostatic Imbalance of Inflammation in Psoriasis.

Psoriasis is a chronic skin inflammation characterized by dysregulated crosstalk between immune cells and keratinocytes. Here we show that the cyclic GMP-AMP synthase (cGAS)-stimulator of interferon genes (STING) pathway is a key regulator of psoriatic inflammation in a mouse model. Platinum-doped positively charged carbon dots (Pt-CDs) were designed to inhibit the cGAS-STING pathway. By inhibiting the cGAS-STING pathway with Pt-CDs, the secretion of proinflammatory cytokines in macrophages was reduced, and the proinflammatory cytokines-induced breakdown of immunological tolerance and overexpression of chemokines in keratinocytes was restored, which reversed the homeostatic imbalance through breaking these cytokines-mediated intercellular positive feedback loop. Topical Pt-CDs treatment exhibited therapeutic effects in imiquimod-induced psoriasis mice without noticeable toxicity. The reversal of elevated expression of STING, phosphorylated STING, and downstream genes within psoriatic lesions indicates that Pt-CDs effectively inhibit the cGAS-STING pathway. This work suggests a promising strategy for psoriasis treatment by targeting the cGAS-STING pathway with Pt-CDs nanoinhibitor to restore skin homeostatic balance.

Ethanol extract of Herpetospermum caudigerum Wall ameliorates psoriasis-like skin inflammation and promotes degradation of keratinocyte-derived ICAM-1 and CXCL9

ObjectiveTo explore whether the ethanol extract of Herpetospermum caudigerum Wall (EHC), a Xizang medicinal plant traditionally used for treating liver diseases, can improve imiquimod-induced psoriasis-like skin inflammation. MethodsImmunohistochemistry and immunofluorescence staining were used to determine the effects of topical EHC use in vivo on the skin pathology of imiquimod-induced psoriasis in mice. The protein levels of interferon-γ (IFN-γ), tumor necrosis factor-α (TNF-α), and interleukin-17A (IL-17A) in mouse skin samples were examined using immunohistochemical staining. In vitro, IFN-γ-induced HaCaT cells with or without EHC treatment were used to evaluate the expression of keratinocyte-derived intercellular cell adhesion molecule-1 (ICAM-1) and chemokine CXC ligand 9 (CXCL9) using Western blotting and reverse transcription-quantitative polymerase chain reaction. The protein synthesis inhibitor cycloheximide and proteasome inhibitor MG132 were utilized to validate the EHC-mediated mechanism underlying degradation of ICAM-1 and CXCL9. ResultsEHC improved inflammation in the imiquimod-induced psoriasis mouse model and reduced the levels of IFN-γ, TNF-α, and IL-17A in psoriatic lesions. Treatment with EHC also suppressed ICAM-1 and CXCL9 in epidermal keratinocytes. Further mechanistic studies revealed that EHC suppressed keratinocyte-derived ICAM-1 and CXCL9 by promoting ubiquitin–proteasome-mediated protein degradation rather than transcriptional repression. Seven primary compounds including ehletianol C, dehydrodiconiferyl alcohol, herpetrione, herpetin, herpetotriol, herpetetrone and herpetetrol were identified from the EHC using ultra-performance liquid chromatography-quadrupole-time of flight-mass spectrometry. ConclusionTopical application of EHC ameliorates psoriasis-like skin symptoms and improves the inflammation at the lesion sites.Please cite this article as: Zhong Y, Zhang BW, Li JT, Zeng X, Pei JX, Zhang YM, Yang YX, Li FL, Deng Y, Zhao Q. Ethanol extract of Herpetospermum caudigerum Wall ameliorates psoriasis-like skin inflammation and promotes degradation of keratinocyte-derived ICAM-1 and CXCL9. J Integr Med. 2023; Epub ahead of print.

IL-8 Triggers Neutrophil Extracellular Trap Formation Through an Nicotinamide Adenine Dinucleotide Phosphate Oxidase- and Mitogen-Activated Protein Kinase Pathway-Dependent Mechanism in Uveitis.

To explore the mechanism underlying IL-8-induced neutrophil extracellular trap (NET) formation in patients with ocular-active Behçet's disease (BD) and the effect of inhibiting NET formation on the severity of inflammation in experimental autoimmune uveitis (EAU) mice. The serum extracellular DNA and neutrophil elastase (NE) and IL-8 levels in patients with ocular-active BD, the expression of myeloperoxidase, NE, and histone H3Cit in IL-8-induced neutrophils isolated from healthy controls, and the effects of NETs on HMC3 cells were detected. Female C57BL/6J mice were immunized with IRBP651-670 to induce EAU and EAU mice received intravitreal injection of the CXCR2 (IL-8 receptor) antagonist SB225002 or PBS. The serum levels of extracellular DNA, NE, and keratinocyte-derived chemokine (the mouse ortholog of human IL-8) and expression of myeloperoxidase, NE, and histone H3Cit in mouse retinas were detected. Disease severity was evaluated by clinical and histopathological scores. Serum keratinocyte-derived chemokine expression levels in EAU mice and IL-8 expression levels in patients with ocular-active BD increased. IL-8 notably increased NET formation in a dose-dependent manner through an nicotinamide adenine dinucleotide phosphate oxidase and mitogen-activated protein kinase pathway dependent mechanism. IL-8-induced NET formation damaged HMC3 cells in vitro. Pretreatment with SB225002 notably ameliorated the production of NETs in EAU mice. Our data confirm that NET formation is induced by IL-8. IL-8-induced NET formation was found to be related to mitogen-activated protein kinase and nicotinamide adenine dinucleotide phosphate pathways. Pretreatment with the CXCR2 antagonist SB225002 alleviated neutrophil infiltration and suppressed NET formation in EAU mice.

Development of Procathepsin L (pCTS-L)-Inhibiting Lanosterol-Carrying Liposome Nanoparticles to Treat Lethal Sepsis.

The pathogenesis of microbial infections and sepsis is partly attributable to dysregulated innate immune responses propagated by late-acting proinflammatory mediators such as procathepsin L (pCTS-L). It was previously not known whether any natural product could inhibit pCTS-L-mediated inflammation or could be strategically developed into a potential sepsis therapy. Here, we report that systemic screening of a NatProduct Collection of 800 natural products led to the identification of a lipophilic sterol, lanosterol (LAN), as a selective inhibitor of pCTS-L-induced production of cytokines [e.g., Tumor Necrosis Factor (TNF) and Interleukin-6 (IL-6)] and chemokines [e.g., Monocyte Chemoattractant Protein-1 (MCP-1) and Epithelial Neutrophil-Activating Peptide (ENA-78)] in innate immune cells. To improve its bioavailability, we generated LAN-carrying liposome nanoparticles and found that these LAN-containing liposomes (LAN-L) similarly inhibited pCTS-L-induced production of several chemokines [e.g., MCP-1, Regulated upon Activation, Normal T Cell Expressed and Presumably Secreted (RANTES) and Macrophage Inflammatory Protein-2 (MIP-2)] in human blood mononuclear cells (PBMCs). In vivo, these LAN-carrying liposomes effectively rescued mice from lethal sepsis even when the first dose was given at 24 h post the onset of this disease. This protection was associated with a significant attenuation of sepsis-induced tissue injury and systemic accumulation of serval surrogate biomarkers [e.g., IL-6, Keratinocyte-derived Chemokine (KC), and Soluble Tumor Necrosis Factor Receptor I (sTNFRI)]. These findings support an exciting possibility to develop liposome nanoparticles carrying anti-inflammatory sterols as potential therapies for human sepsis and other inflammatory diseases.

OVERLOAD-INDUCED EXTRACELLULAR MITOCHONDRIA RELEASING FROM TENDON ORGANOID LEADS TO INFLAMMATION

Tendinopathy is the most frequent musculoskeletal disease that requires medical attention. Mechanical overload has been considered as a key driver of its pathology. However, the underline mechanism on how overload induces tendinopathy and inflammation is unclear. Extracellular mitochondria (EM) are newly identified as cell-to-cell communicators. The aim of this study is to elucidate the role of mitochondria in overload-induced inflammation.We performed three-dimensional uniaxial stretching to mouse tendon organoid in bioreactors. Cyclic strain of uniaxial loadings included underload, normal load, and overload, according to previous work. We then harvested microvesicles including EM, from the bioreactor by differential centrifugation and evaluated their characteristics by flow cytometry and super-resolution confocal microscopy. Raw 264.7 mouse macrophage cell line was used for chemotaxis assay in a Boyden Chamber System with Magnetic-Activated Cell Sorting Technology. EM induced cytokines secretion by macrophages was analyzed by a bead-based multiplex assay panel. N-Acetyl-L-cysteine (NAC) was used as the antioxidant to tendon organoid to regulate mitochondrial fitness.We showed mechanical load induced tendon organoid to release microvesicles including mitochondria. The size of microvesicles is mainly in the range from 220nm to 880nm. More than 75% of microvesicles could be stained by PKH26, confirming they were with lipophilic membrane. Super-resolution confocal microscopy identified two forms of mitochondria, including mitochondria encapsulated in vesicles and free mitochondria. Overload led to the degeneration of the organoid and induced microvesicles release containing most EM. Chemotaxis assay showed that EM from overloaded tendon organoid induced macrophages chemotaxis. In addition, microvesicles extracted from overloaded tendon organoid induced the production of proinflammatory cytokines including IL-6, KC (Keratinocyte-Derived Chemokine) and IL-18. NAC treatment to tendon cells could attenuate overload-induced macrophage chemotaxis.Overload induces EM releasing from tendon cells, which leads to chemotaxis of macrophages toward tendon, resulting in induction of inflammation.

CXCR2 Antagonist RIST4721 Acts as a Potent Chemotaxis Inhibitor of Mature Neutrophils Derived from Ex Vivo-Cultured Mouse Bone Marrow

Neutrophils act as critical mediators of innate immunity, which depends on their rapid responses to chemokines followed by their migration towards sites of infection during chemotaxis. Chemokine receptors expressed on the surface of neutrophils mediate chemotaxis by activating contractile machinery as the cells escape from capillary beds and then attack pathogens. Neutrophils also contribute to inflammatory responses, which support pathogen destruction but can lead to acute and chronic inflammatory disorders. CXCR2, a G-protein-coupled chemokine receptor expressed on both myeloid and epithelial cells, is well-characterized for its capacities to bind multiple chemokines, including interleukin-8 and growth-related oncogene alpha in humans or keratinocyte chemokine (KC) in mice. Here we show that a small molecule CXCR2 antagonist termed RIST4721 can effectively inhibit KC-stimulated chemotaxis by neutrophils derived from ex vivo-cultured mouse bone marrow in a potent and dose-dependent manner. Antagonistic properties of RIST4721 are thoroughly characterized, including the maximal, half-maximal and minimum concentrations required to inhibit chemotaxis. Importantly, RIST4721-treated neutrophils exhibit robust phagocytosis and reactive oxygen species production, confirming drug specificity to chemotaxis inhibition. Together our data indicate that RIST4721 acts to inhibit inflammation mediated and potentiated by neutrophils and therefore promises to facilitate treatment of a host of inflammatory conditions.

Effect of Deferoxamine on Post-Transfusion Iron, Inflammation, and In Vitro Microbial Growth in a Canine Hemorrhagic Shock Model: A Randomized Controlled Blinded Pilot Study

Red blood cell (RBC) transfusion is associated with recipient inflammation and infection, which may be triggered by excessive circulating iron. Iron chelation following transfusion may reduce these risks. The aim of this study was to evaluate the effect of deferoxamine on circulating iron and inflammation biomarkers over time and in vitro growth of Escherichia coli (E. coli) following RBC transfusion in dogs with atraumatic hemorrhage. Anesthetized dogs were subject to atraumatic hemorrhage and transfusion of RBCs, then randomized to receive either deferoxamine or saline placebo of equivalent volume (n = 10 per group) in a blinded fashion. Blood was sampled before hemorrhage and then 2, 4, and 6 h later. Following hemorrhage and RBC transfusion, free iron increased in all dogs over time (both p < 0.001). Inflammation biomarkers interleukin-6 (IL6), CXC motif chemokine-8 (CXCL8), interleukin-10 (IL10), and keratinocyte-derived chemokine (KC) increased in all dogs over time (all p < 0.001). Logarithmic growth of E. coli clones within blood collected 6 h post-transfusion was not different between groups. Only total iron-binding capacity was different between groups over time, being significantly increased in the deferoxamine group at 2 and 4 h post-transfusion (both p < 0.001). In summary, while free iron and inflammation biomarkers increased post-RBC transfusion, deferoxamine administration did not impact circulating free iron, inflammation biomarkers, or in vitro growth of E. coli when compared with placebo.

BRD4 is involved in viral exacerbation of chronic obstructive pulmonary disease

BackgroundOur previous studies have suggested that bromodomain protein 4 (BRD4) is increased in the lung of stable chronic obstructive pulmonary disease (COPD) patients, which has been shown to be involved in inflammatory responses. We investigated its role in the viral exacerbation of COPD.MethodsBRD4, interleukin (IL)-6 and IL-8 were measured in the blood and sputum of stable COPD patients and patients with viral exacerbation. Mice were exposed to cigarette smoke (CS) and/or infected with influenza virus as an in vivo model. BRD4, IL-6 and keratinocyte-derived chemokine (KC) were measured in the lung. BEAS-2B cells were treated with CS extract and/or influenza virus as an in vitro model. BRD4, IL-6 and IL-8 were measured in the cells and/or culture supernatant.ResultsBRD4 was increased in COPD patients with viral exacerbation compared with those in stable condition and its expression was correlated with IL-6 and IL-8 expression. Inflammatory cells, IL-6, KC and BRD4 were synergistically induced in the lung of mice by viral infection and CS exposure, and the former three were decreased by JQ1 (BRD4 inhibitor) treatment. IL-6, IL-8 and BRD4 were significantly induced by CS extract and influenza virus in bronchial epithelial cells, and this upregulation was suppressed by knockdown of BRD4 expression.ConclusionsOur findings indicate that CS and viruses may synergistically induce IL-6 and IL-8 expression through their synergistic induction of BRD4 expression, which might contribute to the enhanced inflammatory response in the viral exacerbation of COPD.

Vimentin affects inflammation and neutrophil recruitment in airway epithelium during Streptococcus suis serotype 2 infection

Streptococcus suis serotype 2 (SS2) frequently colonizes the swine upper respiratory tract and can cause Streptococcal disease in swine with clinical manifestations of pneumonia, meningitis, and septicemia. Previously, we have shown that vimentin, a kind of intermediate filament protein, is involved in the penetration of SS2 through the tracheal epithelial barrier. The initiation of invasive disease is closely related to SS2-induced excessive local inflammation; however, the role of vimentin in airway epithelial inflammation remains unclear. Here, we show that vimentin deficient mice exhibit attenuated lung injury, diminished production of proinflammatory cytokines interleukin-6 (IL-6), tumor necrosis factor-alpha (TNF-α), and the IL-8 homolog, keratinocyte-derived chemokine (KC), and substantially reduced neutrophils in the lungs following intranasal infection with SS2. We also found that swine tracheal epithelial cells (STEC) without vimentin show decreased transcription of IL-6, TNF-α, and IL-8. SS2 infection caused reassembly of vimentin in STEC, and pharmacological disruption of vimentin filaments prevented the transcription of those proinflammatory cytokines. Furthermore, deficiency of vimentin failed to increase the transcription of nucleotide oligomerization domain protein 2 (NOD2), which is known to interact with vimentin, and the phosphorylation of NF-κB protein p65. This study provides insights into how vimentin promotes excessive airway inflammation, thereby exacerbating airway injury and SS2-induced systemic infection.

Intermittent Fasting Alleviates Risk Markers in a Murine Model of Ulcerative Colitis by Modulating the Gut Microbiome and Metabolome.

Clinical trials have demonstrated the health benefits of intermittent fasting (IF). However, the potential mechanism of IF in alleviating dextran sulfate sodium (DSS)-induced colitis is not fully understood. The present study was mainly designed to explore the dynamic changes in the gut microbiota and metabolome after short-term (2 weeks) or long-term (20 weeks) IF and therefore clarify the potential mechanisms by which IF ameliorates DSS-induced colitis in a murine model. Thirty-two C57BL/6 male mice were equally divided into four groups and underwent IF intervention for 2 weeks (SIF group, n = 8), 20 weeks (LIF group, n = 8), or were allowed free access to food for 2 weeks (SAL group, n = 8) or 20 weeks (LAL group, n = 8). The thirty-two C57BL/6 male mice were accepted for the diet intervention of 2 weeks of IF or fed ad libitum. Colitis was induced by drinking 2% DSS for 7 days. Our findings showed that short-term IF prominently elevates the abundance of Bacteroides, Muibaculum and Akkermansia (p < 0.001, p < 0.001, p < 0.001, respectively), and decreased the abundance of Ruminiclostridium (p < 0.05). Long-term IF, however, decreased the abundance of Akkermansia and obviously increased the abundance of Lactobacillus (p < 0.05, p < 0.001, respectively). Metabolites mainly associated with nucleoside, carbohydrate, amino acid, bile acid, fatty acid, polyol, steroid and amine metabolism were identified in the faeces using untargeted GC/MS. In particular, inosine was extremely enriched after short-term IF and long-term IF (p < 0.01, p < 0.01, respectively); butyrate, 2-methyl butyric acid and valeric acid were significantly decreased after short-term IF (p < 0.001, p < 0.001, p < 0.01, respectively); and 2-methyl butyric acid was significantly increased after long-term IF (p < 0.001). The abundance of lithocholic acid (LCA), one of the secondary bile acids, increased significantly after short-term and long-term IF based on UPLC−MS/MS (p < 0.001, p < 0.5, respectively). Of note, IF markedly mitigated DSS-induced acute colitis symptoms and down-regulated pro-inflammatory cytokines IL-1α, IL-6, keratinocyte-derived chemokine (KC) and G-CSF levels in the serum (p < 0.01, p < 0.001, p < 0.05, p < 0.001, respectively). Furthermore, a correlation analysis indicated that the disease activity index (DAI) score and serum levels of IL-1α, IL-6, KC, and G-CSF were negatively correlated with the relative abundance of Akkermansia and the faecal metabolites LCA and inosine. This study confirmed that IF altered microbiota and reprogramed metabolism, which was a promising development in the attempt to prevent DSS-induced colitis. Moreover, our findings provide new insights regarding the correlations among the mucosal barrier dysfunction, metabolome, and microbiome.

ADAMTS13 Plays a Critical Role in Acetaminophen-Induced Acute Liver Injury in Mice, and Can be a Novel Therapeutic Option

【Background】 Acetaminophen (APAP) is one of the major causes of drug-induced acute liver injury. It is known that VWF deficiency reduces hepatic platelet accumulation and promotes liver repair in APAP-induced acute liver injury in mice. We hypothesized that VWF-ADAMTS13 axis plays a role in the pathophysiology of APAP-induced acute liver injury. To investigate this hypothesis, we have used a mouse experimental model of APAP-induced hepatic injury. 【Method】 The extent of APAP-induced liver injury was compared between wild-type (WT) and ADAMTS13 gene-deleted (KO) mice (C57BL/6 background). At first, mice were fasted for 24 hours before administration of 300 mg/kg APAP via intraperitoneal injection. Forty-eight hours after APAP administration, Hepatic blood flow was measured as the average of the surface blood flow on the anterior and inferior surfaces of the liver in the right and left lobes using Laser Doppler flowmetry (ALF21N, Advance Co, Tokyo, Japan), followed by sampling of blood and hepatic tissue. Blood cell counts and biochemical analysis including aspartate aminotransferase (AST) and alanine aminotransferase (ALT) were performed. Also, histological analysis and gene expression analysis by quantitative PCR (qPCR) such as interleukin-6 (IL-6), interleukin-1beta (IL1-β), tumor necrosis factor-alfa (TNF-α), Keratinocyte-derived chemokines (KC), monocyte chemoattractant protein-1 (MCP-1), transforming growth factor-beta (TGF-β), alfa-smooth muscle actin (α-SMA) and collagen type I alfa-1 (COL1α1) were conducted using the liver samples. In addition, to confirm whether recombinant ADAMTS13 has a protective effect against APAP-induced liver injury, we administered recombinant ADAMTS13 to WT mice through the retro-orbital cavity 30 min before APAP administration and examined whether the liver injury was reduced. 【Result】 In APAP-challenged KO mice (N=13), serum levels of AST and ALT were significantly elevated compared to WT mice (N=9)（AST; 3115.4 vs 1331.1 IU/L, ALT; 3911.5 vs 1647.8 IU/L）. The area of liver necrosis was increased in KO mice compared to WT mice （area of hepatic necrosis; 58.0 vs 42.9 %）. In addition, inflammation markers other than TNF-α and MCP-1 were not significantly different, but TNF-α and MCP-1 were significantly elevated in KO mice compared to WT mice. Furthermore, hepatic blood flow was decreased in KO mice compared to WT mice（18.3 vs 21.6 ml/hr）, in accordance with the significantly reduced levels of the numbers of platelets in KO mice（269.3 vs 503.2 x109/L）. Surprisingly, the increases of ALT values and the area of hepatic necrosis observed in WT mice were significantly suppressed by recombinant human ADAMTS13 administration. 【Discussion】 We have shown that APAP-induced liver injury is exacerbated by enhanced inflammation in KO mice and clarified that ADAMTS13 plays a critical role in the liver injury induced by APAP. Moreover, we found that recombinant human ADAMTS13 administration reduces APAP-induced hepatic injury. Our results suggest that recombinant human ADAMTS13 can be a novel therapeutic option for APAP poisoning.

Biomarkers of Coagulation and Inflammation in Dogs after Randomized Administration of 6% Hydroxyethyl Starch 130/0.4 or Hartmann’s Solution

Simple SummaryCritically ill dogs often require intravenous fluid therapy to improve circulation and treat life-threatening shock. Standardly, a balanced electrolyte solution called a crystalloid is prescribed. Some veterinarians also prescribe colloid fluids like hydroxyethyl starch (HES), which are crystalloids that contain large starch molecules, as more of the volume delivered stays in circulation compared to crystalloid. However, there is concern that colloids may impair blood clot formation and increase the risk of serious bleeding. To better understand this risk, this study compared the function of individual clotting components within blood samples collected over time from critically ill dogs that received either crystalloids or HES. The blood samples were saved from a previous clinical trial where critically ill dogs requiring intravenous fluids were randomized to receive HES or crystalloids. Blood was collected before fluid therapy and then 6, 12, and 24 h after the start of the intervention fluid. The results did not provide evidence that HES impaired clotting more than crystalloids. However, considering the small sample size and variability between dogs, this result does not provide evidence that HES is safe. Larger or more targeted studies are required to further assess the effect of HES on blood clotting in dogs.Synthetic colloid fluids containing hydroxyethyl starch (HES) have been associated with impairment of coagulation in dogs. It is unknown if HES causes coagulation impairment in dogs with naturally occurring critical illness. This study used banked plasma samples from a blinded, randomized clinical trial comparing HES and balanced isotonic crystalloid for bolus fluid therapy in 39 critically ill dogs. Blood was collected prior to fluid administration and 6, 12, and 24 h thereafter. Coagulation biomarkers measured at each time point included prothrombin time, activated partial thromboplastin time, thrombin time, fibrinogen concentration, and the activities of coagulation factors V, VII, VIII, IX, and X, von Willebrand factor antigen, antithrombin, and protein C. Given the links between coagulation and inflammation, cytokine concentrations were also measured, including interleukins 6, 8, 10, and 18, keratinocyte-derived chemokine, and monocyte chemoattractant protein-1. Data were analyzed with linear mixed effects models. No significant treatment-by-time interactions were found for any biomarker, indicating that the pattern of change over time was not modified by treatment. Examining the main effect of time showed significant changes in several coagulation biomarkers and keratinocyte-derived chemokines. This study could not detect evidence of coagulation impairment with HES.

Storage with ethanol attenuates the red blood cell storage lesion

BackgroundCurrent management of hemorrhagic shock relies on control of surgical bleeding along with resuscitation with packed red blood cells and plasma in a 1-to-1 ratio. Transfusion, however, is not without consequence as red blood cells develop a series of biochemical and physical changes during storage termed “the red blood cell storage lesion.” Previous data has suggested that ethanol may stabilize the red blood cell membrane, resulting in improved deformability. We hypothesized that storage of packed red blood cells with ethanol would alter the red blood cell storage lesion. MethodsMice underwent donation and storage of red blood cells with standard storage conditions in AS-3 alone or ethanol at concentrations of 0.07%, 0.14%, and 0.28%. The red blood cell storage lesion parameters of microvesicles, Band-3, free hemoglobin, annexin V, and erythrocyte osmotic fragility were measured and compared. In additional experiments, the mice underwent hemorrhage and resuscitation with stored packed red blood cells to further evaluate the in vivo inflammatory impact. ResultsRed blood cells stored with ethanol demonstrated decreased microvesicle accumulation and Band-3 levels. There were no differences in phosphatidylserine or cell-free hemoglobin levels. After hemorrhage and resuscitation with packed red blood cells stored with 0.07% ethanol, mice demonstrated decreased serum levels of interleukin-6, macrophage inflammatory protein-1α, keratinocyte chemokine, and tumor necrosis factor α compared to those mice receiving packed red blood cells stored with additive solution-3. ConclusionStorage of murine red blood cells with low-dose ethanol results in decreased red blood cell storage lesion severity. Resuscitation with packed red blood cells stored with 0.07% ethanol also resulted in a decreased systemic inflammatory response in a murine model of hemorrhage.