Cucumber Mosaic Virus Infection Research Articles

Arabidopsis PDLP7 modulated plasmodesmata function is related to BG10-dependent glucosidase activity required for callose degradation

The microdomains of plasmodesmata, specialized cell-wall channels responsible for communications between neighboring cells, are composed of various plasmodesmata-located proteins (PDLPs) and lipids. Here, we found that, among all PDLP or homologous proteins in Arabidopsis thaliana genome, PDLP5 and PDLP7 possessed a C-terminal sphingolipid-binding motif, with the later being the only member that was significantly upregulated upon turnip mosaic virus and cucumber mosaic virus infections. pdlp7 mutant plants exhibited significantly reduced callose deposition, larger plasmodesmata diameters, and faster viral transmission. These plants exhibited increased glucosidase activity but no change in callose synthase activity. PDLP7 interacted specifically with glucan endo-1,3-β-glucosidase 10 (BG10). Consistently, higher levels of callose deposition and slower virus transmission in bg10 mutants were observed. The interaction between PDLP7 and BG10 was found to depend on the presence of the Gnk2-homologous 1 (GnK2-1) domain at the N terminus of PDLP7 with Asp-35, Cys-42, Gln-44, and Leu-116 being essential. In vitro supplementation of callose was able to change the conformation of the GnK2-1 domain. Our data suggest that the GnK2-1 domain of PDLP7, in conjunction with callose and BG10, plays a key role in plasmodesmata opening and closure, which is necessary for intercellular movement of various molecules.

The N-Terminal Region of Cucumber Mosaic Virus 2a Protein Is Involved in the Systemic Infection in Brassica juncea.

Brassica juncea belongs to the Brassicaceae family and is used as both an oilseed and vegetable crop. As only a few studies have reported on the cucumber mosaic virus (CMV) in B. juncea, we conducted this study to provide a basic understanding of the B. juncea and CMV interactions. B. juncea-infecting CMV (CMV-Co6) and non-infecting CMV (CMV-Rs1) were used. To identify the determinants of systemic infection in B. juncea, we first constructed infectious clones of CMV-Co6 and CMV-Rs1 and used them as pseudo-recombinants. RNA2 of CMV was identified as an important determinant in B. juncea because B. juncea were systemically infected with RNA2-containing pseudo-recombinants; CMV-Co6, R/6/R, and R/6/6 were systemically infected B. juncea. Subsequently, the amino acids of the 2a and 2b proteins were compared, and a chimeric clone was constructed. The chimeric virus R/6Rns/R6cp, containing the C-terminal region of the 2a protein of CMV-Rs1, still infects B. juncea. It is the 2a protein that determines the systemic CMV infection in B. juncea, suggesting that conserved 160G and 214A may play a role in systemic CMV infection in B. juncea.

Integrated transmission electron microscopy and proteomic analyses reveal the cytoarchitectural response to cucumber mosaic virus infection in tobacco

Cucumber mosaic virus (CMV) causes huge economic losses to agriculture every year; thus, understanding the mechanism of plant resistance to CMV is imperative. In this study, an integrated analysis of transmission electron microscopy (TEM) observations and proteomic results was used to identify cytoarchitectural differences in Nicotiana tabacum cv. NC82 (susceptible) and cv. Taiyan 8 (T.T.8; resistant) following infection with CMV. The TEM observations showed that the structure of the chloroplasts and mitochondria was severely damaged at the late stage of infection in NC82. Moreover, the chloroplast stroma and mitochondrial cristae were reduced and disaggregated. However, in T.T.8, organelle structure remained largely intact Selective autophagy predominated in T.T.8, whereas non-selective autophagy dominated in NC82, resembling cellular disorder. Proteomic analysis of T.T.8 revealed differentially expressed proteins (DEPs) mostly associated with photosynthesis, respiration, reactive oxygen species (ROS) scavenging, and cellular autophagy. Biochemical analyses revealed that ROS-related catalase, autophagy-related disulfide isomerase, and jasmonic acid and antioxidant secondary metabolite synthesis-related 4-coumarate:CoA ligase (Nt4CL) exhibited different trends and significant differences in expression in the two cultivars after CMV inoculation. Furthermore, mutant phenotyping verified that reduced Nt4CL expression impaired resistance in T.T.8. The identified DEPs are crucial for maintaining intracellular homeostatic balance and likely contribute to the mechanism of CMV resistance in tobacco. These findings increase our understanding of plant cytological mechanisms conferring resistance to CMV infection.

Distribution of Mosaic Disease in Ridge Gourd (Luffa acutangula (L.) Roxb.), Characterization of Associated Virus and Screening for Virus Resistance

Aims: A survey was conducted in the ridge gourd growing areas of Kasaragod, Kannur and Kozhikkode district, India, to assess the prevalence of virus diseases. Molecular detection and characterization indicated the presence of mixed infection of Tomato leaf curl New Delhi virus (ToLCNDV) and Cucumber mosaic virus (CMV) in infected samples of ridge gourd collected from surveyed locations. Additionally, a screening of popular varieties/hybrids was undertaken to identify resistance sources against the Begomovirus in Ridge gourd.
 Study Design: CRD design for screening for resistance genotype.
 Place and Duration of Study: Department of Plant Pathology, College of Agriculture, Padannakkad. November 2022 - 2023.
 Methodology: Twenty-five ridge gourd plants were selected from a field and scored during survey. Major weeds and insects in and around the location were collected and identified.  Screening for resistance was carried out in vitro by grafting infected scion on to healthy ridge gourd plants. Begomovirus infections were confirmed by polymerase chain reaction (PCR) using specific coat protein primers. Presence of CMV was detected using specific primers.
 Results: Disease incidence (DI) of surveyed locations ranged from 5.3-100 per cent and vulnerability index (VI) from 26.57-84.08. Kunjathur, Thalangady, and Hosabettu areas of Kasaragod district recorded the highest incidence (100%). The highest VI (84.08) was recorded in Thalangady (Kasaragod). Bemisia tabaci and Aphis gossypii were the associated insects and Synedrella sp., Ageratum conizoides and Alternanthera sp. were the associated weeds.
 Screening of varieties indicated moderately susceptible reactions of RG7 and RG10 after 60 days of grafting. PCR based molecular detection of ToLCNDV using coat protein specific primers yielded amplicons of approximately 575 bp. All the isolated sequences were found to be related to ToLCNDV on sequencing and blast analysis. Phylogenetic studies revealed that isolates from Thrikaripur, Mavichery, and Poolacode were closely related to each other. Cucumber mosaic virus, a RNA virus was also detected from isolated samples using specific primers of CMV with an amplicon size of 400 bp.
 Conclusion: The study revealed that the ridge gourd cultivated in areas of Kasaragod, Kannur and Kozhikode were infected with ToLCNDV and CMV; RG7 and RG10 were moderately susceptible among the varieties and hybrids screened. The presence of the begomovirus was detected in weeds indicating its role in perpetuation and spread of the virus disease in the field. 

Silencing of a Nicotiana benthamiana ascorbate oxidase gene reveals its involvement in resistance against cucumber mosaic virus

Main conclusionSilencing of an ascorbate oxidase (AO) gene in N. benthamiana enhanced disease severity from cucumber mosaic virus (CMV), showing higher accumulation and expansion of the spreading area of CMV.A Nicotiana benthamiana ascorbate oxidase (NbAO) gene was found to be induced upon cucumber mosaic virus (CMV) infection. Virus-induced gene silencing (VIGS) was employed to elucidate the function of AO in N. benthamiana. The tobacco rattle virus (TRV)-mediated VIGS resulted in an efficient silencing of the NbAO gene, i.e., 97.5% and 78.8% in relative quantification as compared to the control groups (TRV::eGFP- and the mock-inoculated plants), respectively. In addition, AO enzymatic activity decreased in the TRV::NtAO-silenced plants as compared to control. TRV::NtAO-mediated NbAO silencing induced a greater reduction in plant height by 15.2% upon CMV infection. CMV titer at 3 dpi was increased in the systemic leaves of NbAO-silenced plants (a 35-fold change difference as compared to the TRV::eGFP-treated group). Interestingly, CMV and TRV titers vary in different parts of systemically infected N. benthamiana leaves. In TRV::eGFP-treated plants, CMV accumulated only at the top half of the leaf, whereas the bottom half of the leaf was “occupied” by TRV. In contrast, in the NbAO-silenced plants, CMV accumulated in both the top and the bottom half of the leaf, suggesting that the silencing of the NbAO gene resulted in the expansion of the spreading area of CMV. Our data suggest that the AO gene might function as a resistant factor against CMV infection in N. benthamiana.

Cucumber mosaic virus impairs the physiological homeostasis of Panax notoginseng and induces saponin-mediated resistance

As an important medicinal plant, Panax notoginseng often suffers from various abiotic and biotic stresses during its growth, such as drought, heavy metals, fungi, bacteria and viruses. In this study, the symptom and physiological parameters of cucumber mosaic virus (CMV)-infected P. notoginseng were analyzed and the RNA-seq was performed. The results showed that CMV infection affected the photosynthesis of P. notoginseng, caused serious oxidative damage to P. notoginseng and increased the activity of several antioxidant enzymes. Results of transcriptome analysis and corresponding verification showed that CMV infection changed the expression of genes related to plant defense and promoted the synthesis of P. notoginseng saponins to a certain extent, which may be defensive ways of P. notoginseng against CMV infection. Furthermore, pretreatment plants with saponins reduced the accumulation of CMV. Thus, our results provide new insights into the role of saponins in P. notoginseng response to virus infection.

Natural occurrence of cucumber mosaic virus infecting Adenium obesum plants in Brazil

AbstractIn 2022, virus‐like symptoms were observed in Adenium obesum plants in Brazil. High‐throughput sequencing analysis found three contig sequences of cucumber mosaic virus (CMV) genome segments, which were of 3352, 3006 and 2221 nucleotides, and shared 98.59%, 95.02% and 98.05% nucleotide identities with the nucleotide sequences of CMV RNAs 1, 2 and 3, respectively. Phylogenetic analysis of the coat protein gene indicated that the CMV isolate belongs to the subgroup IB. Symptoms of mottle like those observed in the field samples were reproduced on mechanically inoculated plants of A. obesum, and RT‐PCR confirmed the CMV infection. CMV was transmitted by Aphis gossypii to A. obesum plants. This is the first report of CMV infecting A. obesum plants in Brazil.

Effect of Cucumber mosaic virus Infection on the Chemical Content of some Genotypes of Tomato Plant (Solanum lycopersicom L.)

This study was conducted in the Plant Viruses laboratory and plastic houses at the Department of Plant Protection/College of Agriculture, University of Kerbala, during the growing season of 2022-2023. The aim of this study was to test the response of some tomato genotypes against Cucumber mosaic virus (CMV) and to understand the impact of the infection on the mineral content (sodium, iron, and lead), plant hormones (gibberellins and cytokinins), and chemical compounds (total phenols) in tomato fruits. The results of testing genotypes of tomato plants (Bayan, Heba Madina, Mercur, Oscar, Emmylou, Basmah, Plato, Zenga, and Joleene) showed that all genotypes were sensitive to infection, with varying sensitivey degrees. It was found that the genotypes Bayan and Heba were the most sensitive to infection with CMV at 88.88% and 100%, respectively. On the other hand, the genotypes Madina, Joleene, and Zenga were the least sensitive to infection, with infection rates of 31.11%, 44.44%, and 46.66%, respectively. The results also demonstrated that viral infection had a significant effect on reducing the levels of the iron and lead in the genotypes infected with CMV, and the genotypes Basmah and Heba were the most affected (with a significant difference) with levels of 0.018 ppm and 0.016 mmol L-1, respectively, compared to their levels in non-infected plants, which were 0.023 ppm and 0.024 mmol L-1, respectively. Additionally, it was observed that viral infection had a significant impact on reducing the level of the gibberellin hormone, with a decrease of 53.53 μg ml-1, and an increase in the levels of sodium, cytokinin hormone, and phenols in the genotypes infected with the CMV, with levels of 0.38 ppm, 87.56 μg ml-1, and 0.45 mg g-1 dry weight, respectively, compared to their levels in non-infected plants, which were 55.30 μg ml-1, 0.22 ppm, and 31.32 μg ml-1, and 0.42 mg g-1 dry weight, respectively.

The RNA-binding domain of DCL3 is required for long-distance RNAi signaling.

The online version contains supplementary material available at 10.1007/s42994-023-00124-6.

Effect of Cucumber mosaic virus infection on aphid colony development on aphid colony development

Effect of Cucumber mosaic virus infection on aphid colony development on aphid colony development

Effect of Cucumber mosaic virus on the Content of Some Melon Genotypes of Some Mineral Elements and Plant Hormones

This study was conducted to determine the effect of cucumber mosaic virus (CMV) infection on the levels of some mineral elements and plant hormones in some melon genotypes. All experiments mentioned in this research were conducted in the Laboratory of plant virology and Greenhouses belonging to the Plant Protection Department/ College of the Agriculture/ University of Kerbala. PCR amplification using the complementary DNA (cDNA), synthesized from RNA isolated from an infected plant, produced a 650bp PCR product. A BLAST search using the nucleotide sequence of the PCR product demonstrated that this CMV isolate was previously registered at the National Centre for Biotechnology Information (NCBI) with a similarity of 100% with some CMV isolates identified in Hungary (AJ517802), Australia (U22821), and Slovenia (OL142046). It was also found that all melon genotypes evaluated in this study were susceptible to CMV, and the genotypes HA-144 and HA-609 were the most susceptible to CMV among the other tested genotypes. Results also showed that the CMV infection significantly reduced the levels of some minerals (calcium, magnesium, and manganese), and the genotypes HA-144, GM-3034, and GA-1534 were the most affected by the virus.; whereas the mineral elements sodium and potassium were significantly increased in their levels in infected plants, especially in the genotype HA-609. The CMV infection also clearly reduced the level of the hormone gibberellin in genotypes and the GA-1534 genotype was the most impacted and significantly different from their levels in the uninfected plants. However, the CMVinfected genotypes showed a significant increase in the level of the hormones cytokinin. 

Genome-Wide Identification and Characterization of the WRKY Gene Family in Cucurbita maxima.

In higher plants, WRKY transcription factors are broadly involved in a variety of life activities and play an important role in both biotic and abiotic stress responses. However, little is known about the functions of WRKY genes in the popular species, such as Cucurbita maxima (pumpkin), which is planted worldwide. In the present study, 102 CmWRKY genes were identified in the C. maxima genome. Chromosome location, multiple sequence alignment, phylogenetic analysis, and synteny analysis of the CmWRKYs were performed. Notably, we found that silencing CmWRKY22 promoted cucumber mosaic virus (CMV) infection, whereas overexpression of CmWRKY22 inhibited the CMV infection. Subsequently, an electrophoretic mobility shift assay (EMSA) confirmed that CmWRKY22 was able to bind to the W-box at the promoter of CmPR1b, which is a responsive gene of the salicylic acid (SA) signaling pathway. In summary, this study has provided a foundation for the antiviral functions of WRKY transcription factors in C. maxima.

A New Strategy of Cross-Protection Based on Attenuated Vaccines: RNA Viruses Are Used as Vectors to Control DNA Viruses

Plant viruses can infect various types of plants, including food and oil crops, and ornamental flowers, threatening agricultural production and food supply. Cross-protection is an efficient strategy against severe viral strains. Due to distinct infection mechanisms, cross-protection cases involving RNA viruses and DNA viruses often rely on the utilization of corresponding attenuated strains for control purposes. In this study, we utilized cucumber mosaic virus (CMV), a member of the RNA virus group, as the foundational framework for developing attenuated vaccines. We developed four vaccines by inserting relevant sequences from tomato yellow leaf curl virus (TYLCV), a DNA virus. All vaccines demonstrated effective prevention against TYLCV infection, with relative control efficacies exceeding 80%. Subsequently, we evaluated the preventive effects of these vaccines on mixed infections of CMV and TYLCV. Our findings demonstrated that CMV (R2-2bPTI-TYC1C4), CMV (R2-2bPTII-TYC1C4), and CMV (R2-2bPTIII-TYRep) displayed significant efficacy in preventing mixed infections. Following pre-inoculation with these vaccines, the disease index of tomato plants decreased from 100 to 56. This work provides theoretical foundations and tangible resources for controlling TYLCV through cross-protection while suggesting a feasible strategy for utilizing weak RNA virus vaccines to control DNA viruses.

Evaluation of the Weeds around Capsicum annuum (CA) Cultivation Fields as Potential Habitats of CA-Infecting Viruses.

Capsicum annuum (CA) is grown outdoors across fields in Jeollabuk-do, South Korea. The weeds surrounding these fields were investigated regarding the infection of 11 viruses infecting CA during the year 2014-2018. In the reverse transcription polymerase chain reaction diagnosis, 546 out of 821 CA samples (66.5%) were infected by nine viruses, and 190 out of 918 weed samples (20.7%) were infected by eight viruses. Correlation analysis of the mutual influence of the viruses infecting CA and weeds during these 5 years showed that five viruses had significant positive correlations with the infection in both CA and weeds. Over the study period, the weeds infected by cucumber mosaic virus (CMV) in the previous year were positively correlated with the incidence of CMV infection in CA in the current year, although the correlation was lower for tomato spotted wilt virus (TSWV) compared to CMV. The CMV infection percent was 14.0% in summer annuals, 11.4% in perennials, and 7.8% in winter annuals. However, considering the overwintering period without CA, the infection percent was 5.2% higher in winter annuals and perennials than that in summer annuals, indicating that winter annual and perennial weeds served as the main habitats for insect vectors. The TSWV infection percent in weeds was 10.4% in summer annuals, 6.4% in winter annuals, and 6.2% in perennials. The weeds surrounding CA fields, acting as the intermediate hosts, were found to be the potent sources of infection, influencing the spread and diversity of CA-infecting viruses. The results of this study can contribute to prevent viral infection in agricultural fields.

Catalases mediate tobacco resistance to virus infection through crosstalk between salicylic acid and auxin signaling pathways.

Catalases (CATs) play important roles in plant growth, development and defense responses. Previous studies have shown that CATs exhibit different or even opposite effects on plant immunity in different plant-pathogen interactions, but little is known about the mechanisms. In this study, Nicotiana tabacum plants with overexpression or knockout of CAT genes, tobacco mosaic virus (TMV) and cucumber mosaic virus (CMV) were employed to investigate the role of CAT in compatible plant-virus interactions. The results showed that there were dynamic changes in the effect of CAT on N. tabacum defense responses. Overexpression of catalase 1 (CAT1) and catalase 3 (CAT3) improved N. tabacum resistance in the early stage of virus infection but depressed it during the late stages of pathogenesis, especially in CAT3 overexpressing plants. The lower level of electrolyte leakage, lower contents of malonaldehyde and hydrogen peroxide (H2 O2 ), higher activities of antioxidant enzymes and improved functions of photosystem II corresponded to the milder symptoms and higher resistance of infected tobacco plants. In addition, the infection of TMV and CMV resulted in expression changes of CATs in tobacco plants, and pretreatment with H2 O2 facilitated TMV and CMV infection. Further experiments showed that the content of salicylic acid (SA) and the expression of genes related to SA signaling pathway were positively correlated with plant resistance, whereas auxin and its related signaling pathway were related to the viral susceptibility of plants. Taken together, our results demonstrated that CAT1 and CAT3 mediated tobacco resistance to virus infection through crosstalk between SA and auxin signaling pathways.

A selective autophagy receptor VISP1 induces symptom recovery by targeting viral silencing suppressors

Selective autophagy is a double-edged sword in antiviral immunity and regulated by various autophagy receptors. However, it remains unclear how to balance the opposite roles by one autophagy receptor. We previously identified a virus-induced small peptide called VISP1 as a selective autophagy receptor that facilitates virus infections by targeting components of antiviral RNA silencing. However, we show here that VISP1 can also inhibit virus infections by mediating autophagic degradation of viral suppressors of RNA silencing (VSRs). VISP1 targets the cucumber mosaic virus (CMV) 2b protein for degradation and attenuates its suppression activity on RNA silencing. Knockout and overexpression of VISP1 exhibit compromised and enhanced resistance against late infection of CMV, respectively. Consequently, VISP1 induces symptom recovery from CMV infection by triggering 2b turnover. VISP1 also targets the C2/AC2 VSRs of two geminiviruses and enhances antiviral immunity. Together, VISP1 induces symptom recovery from severe infections of plant viruses through controlling VSR accumulation.

HCPro affects heterologous virus infection through salicylic acid and auxin pathways

AbstractMixed infection by plant viruses is common in nature, but how a key viral protein of one virus affects the infection by heterologous viruses is not yet fully understood. The helper component proteinase (HCPro) is a widely studied RNA silencing suppressor encoded by viruses of the family Potyviridae. Here, we investigated the defence response of Nicotiana tabacum plants overexpressing HCPro of chilli veinal mottle virus (HCPro‐OX) to tobacco mosaic virus and cucumber mosaic virus infection. We monitored the physiological and molecular changes of HCPro‐OX plants in response to virus infection. The results showed that HCPro‐OX plants under virus infection exhibited higher susceptibility at the early stage but stronger tolerance at the later stage compared to wild‐type plants. The tolerance to heterologous virus infection of HCPro‐OX plants corresponded to a lower level of reactive oxygen species accumulation and higher activities of several antioxidant enzymes. Reverse transcription‐quantitative PCR assays showed that the expression of genes related to salicylic acid (SA) pathways was significantly upregulated, but the expression of genes related to the auxin pathways was downregulated at the late stage of virus infection in HCPro‐OX plants compared to wild‐type plants. By contrast, the situation in the early stage of virus infection was reversed. In addition, pretreatment with SA, the auxin naphthylacetic acid (NAA) and their respective inhibitors 1‐aminobenzotriazole (ABT) and naphthalam (NPA) further confirmed the antagonistic effects of SA and NAA in the response of HCPro‐OX plants to heterologous virus infection. Thus, our results demonstrate that HCPro affects heterologous virus infection through SA and auxin pathways.

Pathogenicity of RNA satellite associated with cucumber mosaic virus (CMV) on chilli (Capsicum annuuum L.)

Obstacles that often occur in cultivation of tomatoes, chilies, and tobacco is the occurrence of diseases caused by viruses. One of them is infected with the Cucumber mosaic virus (CMV), this virus infection is very dangerous for large red chili, tomato and tobacco farming which results in quite large losses for farmers in Indonesia. Controlling viral infections caused by CMV is very difficult due to the high genetic diversity of CMV making it difficult to obtain resistant types of red pepper, tomato and tobacco, the range of CMV host plants is wide, and CMV can be transmitted by aphids and ticks. non-persistent whiteheads. The aim of this journal review was to determine the pathogenicity of sat-RNA associated with CMV in red chilies, tomatoes and tobacco. Based on the results of reviews from several journals, it can be seen that RNA satellite is effective against CMV infection on chili, tomato, and tobacco plants. Which can be seen by administering the CARNA vaccine to each plant treatment.

Plasmodesmal endoplasmic reticulum proteins regulate intercellular trafficking of cucumber mosaic virus in Arabidopsis.

Plasmodesmata (PD) are plasma membrane-lined cytoplasmic nanochannels that mediate cell-to-cell communication across the cell wall. A range of proteins are embedded in the PD plasma membrane and endoplasmic reticulum (ER), and function in regulating PD-mediated symplasmic trafficking. However, knowledge of the nature and function of the ER-embedded proteins in the intercellular movement of non-cell-autonomous proteins is limited. Here, we report the functional characterization of two ER luminal proteins, AtBiP1/2, and two ER integral membrane proteins, AtERdj2A/B, which are located within the PD. These PD proteins were identified as interacting proteins with cucumber mosaic virus (CMV) movement protein (MP) in co-immunoprecipitation studies using an Arabidopsis-derived plasmodesmal-enriched cell wall protein preparation (PECP). The AtBiP1/2 PD location was confirmed by TEM-based immunolocalization, and their AtBiP1/2 signal peptides (SPs) function in PD targeting. In vitro/in vivo pull-down assays revealed the association between AtBiP1/2 and CMV MP, mediated by AtERdj2A, through the formation of an AtBiP1/2-AtERdj2-CMV MP complex within PD. The role of this complex in CMV infection was established, as systemic infection was retarded in bip1/bip2w and erdj2b mutants. Our findings provide a model for a mechanism by which the CMV MP mediates cell-to-cell trafficking of its viral ribonucleoprotein complex.

First report of Tomato yellow mottle-associated virus infecting pepper (Capsicum annuum L.) in China.

Tomato yellow mottle-associated virus (TYMaV), is a member of the genus Cytorhabdovirus in the family Rhabdoviridae, which has been reported to infect tomato (Lycopersicon esculentum) (Xu et al. 2017), Solanum nigrum (Li et al., 2022) and Nicotiana benthamiana (Zhou et al. 2019). In July 2021, virus-like symptoms of chlorosis, mosaic, and ring spots were observed in pepper, tomato, and eggplant during a survey of viral symptoms in Huzhou City, Zhejiang Province, China. To identify viral agents potentially associated with these diseases, an Oxford Nanopore cDNA library from the mixed samples was generated and sequenced. Briefly, total RNA from 10 leaf tissue samples (3 pepper plants, 4 tomato plants, and 3 eggplant plants) was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan) and pooled in equal amounts (100 ng/l each). The library was constructed using a PCR-cDNA sequencing kit (SQK-PCS109; Oxford Nanopore Technologies, Oxford, UK) in accordance with the manufacturer's instructions. Approximately 8.6 million reads were obtained from the Oxford MinION platform. After removing adapters and low-quality reads using iVar v1.3.1 (Grubaugh et al., 2019), the clean reads were subjected to BLASTn search in the GenBank database. We identified sequences derived from potato virus X (PVX), potato virus Y (PVY), cucumber mosaic virus (CMV), pepper mottle virus (PepMoV), and TYMaV. Of these reads, 339 with lengths ranging from 375 to 8651 nt were mapped to the genome of TYMaV (GeneBank Accession No. KY075646.1) at a 98.2% query coverage. To identify TYMaV-infected plants in the pooled samples, all 10 samples were analyzed by two-step RT-PCR using AMV reverse transcriptase (Takara, Tokyo, Japan) combined with random primers N6 (Takara, Dalian, China) and high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan) with primer pairs: N-F 5'- CAGGGAGAGAATGTACAAGTTGATC'/N-R 5'- GACCTTGCTCATCTGATGCAAC -3', amplifying 420 bp of the 3'end of nucleoprotein (N) gene. A pepper sample showing chlorosis symptom was positive for the TYMaV infection, but negative for PVX, PVY, CMV or PepMoV infection when tested using the primers listed in table S1. To confirm the genome sequence of TYMaV Zhejiang isolate (TYMaV-ZJ), we carried out two-step RT-PCR with seven primer pairs (Table S1) designed based on the reference TYMaV genome (GeneBank accession number KY075646.1). PCR products were cloned into pLB vector (Tiangen, Beijing, China) and Sanger sequenced in both directions. At least five independent clones of each fragment were sequenced to avoid possible mutations introduced by PCT. The sequences were assembled into a nearlyfull-length genome of TYMaV -ZJ which was composed of 13344nt (GeneBank accession number OP296980). Pairwise sequence comparison revealed that TYMaV -ZJ genome shared 91.50% and 85.59% nt sequence identity with that of the TYMaV tomato isolate (KY075646.1) and the Solanum nigrum isolate (MW527091.1), which is higher than the species demarcation threshold of 75% for the genus Cytorhabdovirus (Walker et al., 2022). To the best of our knowledge, this is the first report of TYMaV infecting pepper.