White Radish Research Articles

Design and Experimentation of a Self-Propelled Picking Type White Radish Combine Harvester

In view of the low level of mechanized harvesting of white radish in China and other developing countries and the current situation of “no machine can be used” due to the expensive imported machines, a self-propelled white radish combine harvester was designed based on the material, growth characteristics, and agronomic pattern of white radish. This combines harvester can realize the functions of white radish tassel gathering, deep soil loosening, clamping and conveying, tassel cutting, and collecting. In this research, the overall design of the harvester is described, and the structural and working parameters and kinematic requirements of the tassel gathering device, clamping and conveying device, tassel cutting device, and vibrating deep loosening device are determined by mechanical and kinematic analysis. Innovatively, a range of values for the tassel gathering speed ratio of 1.7–4.2 is proposed for the operation of the tassel gathering device suitable for white radish harvesting. The prototype was bench tested with the loss rate, damaged rate, and impurity rate as performance evaluation indexes. The results show that under the pitch of 240 mm between the taper angle of the tassel-raising device, a speed of 80 rpm for the tassel gathering device gathering claw belt rotation, a speed of 120 rpm for the clamping and conveying pulley rotation, a vibration frequency of 2 Hz and an amplitude of 15 mm for the vibrating deep loosening device, and a forward speed of 0.5 m/s (tassel gathering speed ratio: 1.7). The loss rate was 2.75%, the damage rate was 4.99%, and the impurity rate was 1.64%. During the operation, the innovatively designed white radish leaf gathering device can better fulfill the function of tassel gathering, and the systems worked well together, meeting the requirements of mechanized combined harvesting of white radish, but the adaptability to complex working conditions in the field needs to be further strengthened. This research can provide a reference for the design and optimization of mechanized white radish harvesting equipment.

Vision-Based White Radish Phenotypic Trait Measurement with Smartphone Imagery

White radish is a nutritious and delectable vegetable that is enjoyed globally. Conventional techniques for monitoring radish growth are arduous and time-consuming, encouraging the development of novel methods for quicker measurements and greater sampling density. This research introduces a mathematical model working on high-resolution images to measure radish’s biophysical properties automatically. A color calibration was performed on the dataset using a color checker panel to minimize the impact of varying light conditions on the RGB images. Subsequently, a Mask-RCNN model was trained to effectively segment different components of the radishes. The observations of the segmented results included leaf length, leaf width, root width, root length, leaf length to width, root length to width, root shoulder color, and root peel color. The automated real-life measurements of these observations were then conducted and compared with actual results. The validation results, based on a set of white radish samples, demonstrated the models’ effectiveness in utilizing images for quantifying phenotypic traits. The average accuracy of the automated method was confirmed to be 96.2% when compared to the manual method.

PENGARUH JENIS TANAH DAN KONSENTRASI ASAP CAIR TERHADAP PERTUMBUHAN SERTA HASIL TANAMAN LOBAK PUTIH DAN MERAH

This study aims to determine the concentration of liquid smoke on the growth and yield of white and red radishes. Knowing the best type of soil by giving the concentration of liquid smoke for the growth and yield of red and white radishes. Knowing the type of radish that gives the best radish growth and yield. The research was carried out at the UPTD Bantul Agricultural Seed Center on Mindi Street, Ngentak Hamlet, Sumberagung Village, Kapanewon Jetis, Bantul Regency, Special Region of Yogyakarta starting in October 2022 - January 2023. This research was a factorial experiment consisting of 3 factors. The first factor is the type of soil, the concentration of liquid smoke, and the type of horseradish. Based on the results of the study, it can be concluded that the Mediterranean soil type treatment gave better results than the red-yellow podzolic soil. Treatment of liquid smoke concentration of 1% and 3% gave the same results. This type of white radish plant gives better growth and yield than the red radish type

The accumulation of element and heavy metal concentrations in different parts of some carrot and radish types.

Vegetables, which are an important part of human nutrition, are very rich in minerals necessary for human health, and heavy metals can be found in vegetables at high rates because they can be easily taken by plant roots and leaves. In this study, the macro, micro element and heavy metal element concentrations accumulated in different parts of some carrot and radish types were investigated. The element concentrations in the samples were analyzed by Inductively coupled plasma optical emission spectrometry (ICP-OES; Varian-Vista Model) equipment. P, K, Ca, Mg and S contents of the head of orange and black carrot samples were determined as 602.30 and 727.23mg/kg, 19,790.91 and 22,230.21mg/kg, 1765.66 and 1609.41mg/kg, 580.34 and 660.79mg/kg and 376.21 and 4444.46mg /kg respectively. Also, exterior parts of orange and black carrots contained 281.65 and 336.43mg/kg P, 7768.37 and 10,109.44mg/kg K, 169.88 and 272.18mg/kg Ca, 112.08 and 189.28mg/kg Mg and 135.43 and 217.60mg/kg S, respectively. P and K contents of the head parts of radish samples (white, red and black radish) were determined between 302.14 (red radish) and 1111.53mg/kg (black radish) to 13,717.2 (red radish) and 22,202.4mg/kg (white radish), respectively. Fe amounts of the roots of radish samples changed between20.47 (red radish) and 45.93mg/kg (white radish). As and Ba were the most abundant heavy metals in both carrot and radish parts. The Ni contents of the parts of the carrots contain more than 50% lower than the head part. Also, while Pb contents of the parts of orange carrot change between 0.189µg/g (interior of body) and 0.976µg/g (shell), Pb amounts of the black carrot parts were recorded between 0.136 (head) and 0.536µg/g (interior of body). The results obtained differed according to the vegetable type and parts. The head part of the radishes was the richest in zinc, followed by root, shell, exterior of body and interior of body in descending order. In general, the parts where heavy metals were most localized were the head and shell parts. The most localized parts of heavy metals in radishes were the head, shell and root parts. As a result, the most of the edible inner parts of carrots and radishes are thought to have a positive effect on human health, since their heavy metal content is low.

Antimicrobial activities of untreated and grape vinegar treated selected vegetables against common food borne pathogens

In the post-Covid-19 era, plant-based diets and products have become more popular. Fruit vinegar is considered a healthy drink, rich in bioactive compounds like organic acids, polyphenols, flavonoids and alkaloids that provide several beneficial properties. Fruit vinegar also contains several beneficial nutrients like amino acids, sugars, vitamins and minerals. They provide energy, regulate cell metabolism, immunity, antioxidation, anticoagulation and help in the improvement of brain development. Vinegar is also known for its strong antimicrobial properties against foodborne pathogens. The aim of the present investigation was to find out the antimicrobial activities of grape vinegar against common food-borne pathogens and to see whether common vegetable lose their antimicrobial activities when soaked with grape vinegar or gain. The vegetables used in the present investigation were randomly collected from the local market. We have evaluated the antimicrobial properties of untreated and grape vinegar (GV) treated selected vegetables against Escherichia coli (ATCC8739), Bacillus subtilis, Staphylococcus aureus (ATCC 6539), Shigella flexneri (ATCC 12022), Salmonella typhi (ATCC 14028), Cronobacter sakazakii (ATCC 29544), Vibrio parahaemolyticus (ATCC 17802), Vibrio cholera (ATCC 3906) and Pseudomonas aeruginosa. Based on the randomized survey, commonly used vegetable ginger (Zingiber officinale), garlic (Allium sativum), onion (Allium cepa), raw papaya (Carica papaya), white radish (Raphanus sativus) and green chilli (Capsicum annuum) were selected for the assessment of their antimicrobial activities. Different phytochemicals were found in water extract and grape vinegar-treated vegetables. Our results suggested that in general, grape vinegar-treated vegetables showed higher antimicrobial activities against all tested food-borne pathogens, but onion, garlic, green chillies and white radish revealed drastically higher activities. Hence, it is suggested that onion, garlic, green chillies and white radish should preferably be used after soaking with grape vinegar. All vegetables except garlic and white radish showed very little antimicrobial activity against B. subtilis. V. cholera was highly sensitive to grape vinegar-treated vegetables except for garlic. Similarly, V. parahaemolyticus was highly sensitive to grape vinegar-treated green chillies, white radish, raw papaya, and onion. Shigella flexneri also showed greater sensitivity to GV-treated green chillies and white radishes. Pseudomonas aeruginosa was sensitive to ginger and green chillies only. It may safely be concluded that grape vinegar-treated vegetables are beneficial to fight against food-borne infections. The vegetable when soaked with grape vinegar did not lose their antimicrobial activities rather they gained the antimicrobial components from grape vinegar. Our studies revealed that white radish, ginger, green chilies, and onion should be used after soaking in grape vinegar while garlic and raw papaya should be eaten without treatment with grape vinegar.

Study on Pulling Dynamic Characteristics of White Radish and the Optimal Design of a Harvesting Device

The loss rate is an important index to evaluate the harvesting performance of white radish. To reduce the loss rate, it is necessary to analyze the pulling dynamic characteristics of white radish and then optimize the structure and operating parameters of the harvesting device. In this paper, according to the growth characteristics of white radish in the field, the discrete element method (DEM) was used to simulate the pulling process. The pulling force was calculated using the Edinburgh elasto-plastic adhesion model (EEPA), and the effects of soil bed compactness, pulling speed and angle on the pulling force were analyzed. The tests on pulling mechanics were carried out in the laboratory to verify the accuracy of DEM simulation results. The results showed that in the soft soil bed with compactness less than 2.8 MPa, the pulling force of radish is generally smaller than the leaf breaking force, and it is feasible to pull the radish out directly. While in a soil bed with high compactness, it is necessary to install a loosening shovel to reduce the pulling force thus reducing the loss rate due to leaf breakage. The structure and operating parameters of the harvesting device were designed according to the pulling dynamic characteristics, and the white radish harvesting tests were carried out in different fields. Statistical results show that when the soil compaction was increased from 1.47 MPa to 2.21 MPa, the average loss rate increased from 0.68% to 1.75%, and the average damage rate increased from 2.41% to 2.70%. Similarly, when the forward speed was increased from 0.18 to 0.47 m/s, the average loss rate increased from 1.08% to 1.30%, and the average damage rate increased from 2.34% to 2.74%. Overall, the maximum loss rate and the maximum damage rate could be controlled below 2.0% and 3.0%, respectively. In the hard soil bed, the loss rate can be effectively reduced from 15% to 2.5% by installing a loosening shovel.

The Preventative Effect of White Radish Roots Against Aflatoxins-Induced Oxidative Stress in Male Rats

The Preventative Effect of White Radish Roots Against Aflatoxins-Induced Oxidative Stress in Male Rats

First Report of radish tubers rot caused by Enterobacter asburiae in China.

Radish (Raphanus sativus L.) is a widely consumed vegetable in China. However, radish is susceptible to diseases, which limits its yield and development in Harbin, China. In September 2021, rotten white radish tubers were observed in the field. The incidence of this disease reached 70% in October 2021, which led to huge economic losses (i.e., 30%-40%). Water-soaked lesions appeared on the radish tubers and appeared brown-yellow, which looked similar to ginger tuber rot caused by Enterobacter asburiae (Zhang et al. 2020). The interior was rotten with no considerable smell. Over time, the lesions gradually spread into all tubers of radish. Small square pieces of radish (0.5 cm × 0.5 cm) were excised from the junction of diseased and healthy tuber, disinfected with 75% alcohol, and washed three times with distilled water then ground to prepare tissue suspensions for plating. Under 28 ℃ for 16h, single colonies were isolated from the beef extract culture medium. Single colonies appeared oval, white, and smooth, with bright and slightly raised surfaces, and with moist neat edges. Gram-negative bacterial strain CCGL 988 was obtained, with an average size of 1-2 µm × 0.5-1 µm, and 3-4 flagella. Physiological and biological test results showed that strain CCGL 988 produced acid utilizing sucrose, glucose, maltobiose, D-Sorbitol, and mannitol; negative for Voges-Proskauer, methyl red, malanate, ornithine decarboxylase, arginine decarboxylase, and lysine decarboxylase. According to the results, strain CCGL 988 was identified as Enterobacter asburiae (Hoffmann et al. 2005). The 16S rDNA region of the strain was amplified using PCR with 27F/1492R primers (López et al. 2019), and partial gyrB, atpD, rpoB genes were amplified according to Zhang et al. (2020), infB gene was amplified with primers (F:TCAATGCGTGCTCGTGGTGCTC; R: TCGATACAGTGCCACTTCACG). The 16S rDNA, gyrB, atpD, rpoB and infB sequences were deposited in GenBank under accession numbers: ON999069, OP006448, OP006449, OP006450, and OP542231, respectively. These five sequences shared 99.80%, 100%, 100%, 100% and 100% of identity with E. asburiae (GenBank Accession: NO. CP011863). Maximum-likelihood phylogenetic tree clustered CCGL 988 with E. asburiae (MEGA7, bootstrap n = 1,000). Strain CCGL 988 was able to produce pectate lyases, polygalacturonases, cellulases, proteases, and extracellular polysaccharide using the methods described by Hugouviex-Cotte-Pattat et al. (2014), and Condemine et al. (1999). Koch's postulates were conducted by inoculating 20 µl of the bacterial suspension (108 CFU/ml) on the needle wound on the surface of six healthy radish tubers; six radish tubers incubated with sterile water were negative controls. Radish tubers were incubated at 28 ℃ with 80% humidity. The inoculated radish was slightly rotten after 7 days. Water-soaked lesions with light yellow were initially observed; after 12 days, the lesions expanded gradually and appeared deep yellow. No symptoms were found in the control radish. This experiment was carried out three times, each time with three replications. The bacterium was reisolated from infected radish tuber and was confirmed to be E. asburiae by the same molecular and morphological characterization as described above. This study is the first report of E. asburiae causing radish tuber rot in China. It serves as a basis for future studies to develop management strategies for the disease to prevent radish yield loss.

Bioactive Compounds, Antioxidant Activities, and HPLC Analysis of Nine Edible Sprouts in Cambodia.

The non-nutritional health benefits of sprouts are unconfirmed. Thus, nine sprout methanolic extracts were tested for phytoconstituents and antioxidant activity. The TPC, TCC, TFC, TAC, and TALC were measured. ABTS and DPPH radical scavenging and ferric-reducing antioxidant power assays were used to assess the antioxidant activity. HPLC detected gallic acid, vanillin, syringic acid, chlorogenic acid, caffeic acid, and rutin in the extracts. The sprout extracts contained six compounds, with caffeic acid being the most abundant. Gallic acid, syringic acid, chlorogenic acid, caffeic acid, vanillin, and rutin were highest in soybean, black sesame, mustard, sunflower, white radish, and black sesame sprouts, respectively. Sunflower sprouts had the highest level of TCC while soybean sprouts had the highest level of TFC, Taiwanese morning glory had the highest level of TPC, mustard sprouts had the highest level of TALC, and black sesame sprouts had the highest level of TAC. Taiwanese morning glories scavenged the most DPPH and ABTS radicals. Colored and white radish sprouts had similar ferric-reducing antioxidant power. Antioxidation mechanisms varied by compound. Our findings demonstrated that sprouts have biological effects, and their short time for mass production offers an alternative food source for health benefits, and that they are useful for future research development of natural products and dietary supplements.

Antioxidant and antimicrobial activities of White Radish

Since prehistoric times, humans have relied on plants for a wide variety of needs, including sustenance, shelter, thermal regulation, and medical treatment. Plants are significant organics because of the many ways they may be put to use. The white radish (Raphanus raphanistrum subsp. sativus (L.) Domin) was tested for its antioxidant and antibacterial properties, as were its tuber and aerial portions. A soxhlet was used to extract ethanol from plant material. The antioxidant and oxidant capacities were tested with the use of Rel Assay TAS and TOS kits. The agar dilution technique was used to test for antimicrobial activity against the bacteria and fungus included in the experiment. As a result of the studies, the TAS value of the tuber extract of the plant was measured as 6.698±0.187, the TOS value as 5.609±0.245 and the OSI value as 0.084±0.002. The TAS value of the herbal aerial parts extract was 4.689±0.223, the TOS value was 3.746±0.128, and the OSI value was 0.080±0.003. Inhibition of tuber extract was observed at concentrations varying between 25-100 against bacterial strains and 200 µg/mL against fungal strains. Aerial parts extract showed inhibition against bacterial strains at concentrations varying between 100-200 and against fungus strains at concentrations ranging from 200-400 µg/mL. As a result, it was determined that the white radish plant has significant antioxidant and antimicrobial activity.

Physiological and biochemical markers of gamma irradiated white radish (Raphanus sativus)

Purpose A field experiment was performed to investigate the impact of low-dose gamma rays on growth parameters and bioactive compounds of white radish. Materials and methods White radish seeds were irradiated by gamma rays dose levels (10, 20, 40 and 80 Gy) beside control. Physiological and biochemical markers were done to follow the effect of gamma rays on white radish. Results The results revealed that gamma rays increased growth parameters with increasing irradiation to a dose of 40 Gy. The maximum increments were found at 14.64 (cm), 48.30 (cm), 20.84 (cm) and 5.51 (cm) for leaves number, leaves length, roots length and roots diameter, respectively, with a dose of 40 Gy. By increasing the irradiation dose to 80 Gy, the results showed reduction in all parameters studied. Ascorbic acid gave the maximum increase with the dose of 40 Gy, while phenols, flavonoids, antioxidant activity, peroxidase, and polyphenol oxidase showed the highest increase with the dose 80 of Gy in radish leaves. Similar trend was observed for the radish roots. Furthermore, the protein and isoenzyme profiles of peroxidase and polyphenol oxidase changed and induced alteration by different irradiation dose levels. Conclusion Gamma rays can be a useful tool for increasing the growth and biochemical content of white radish plants and perhaps other food crops.

Bioaccumulation and risk assessment of potential toxic elements in the soil-vegetable system as influenced by historical wastewater irrigation

To investigate the pollution status and probable health risk of potential toxic elements (PTEs) in soil and vegetables in historical wastewater irrigation region, eight types of vegetables (n = 73) and corresponding soils were collected to determine the contents of Pb, Cd, Cu, Zn, Ni and Cr, and their potential health risk to local vegetable consumers. The results showed that the mean contents of Pb, Cd, Cu, Zn, Ni and Cr in these soils were 39.72, 1.06, 38.47, 255.00, 27.45 and 61.83 mg/kg, respectively, with Cd exceeding the national standard of China (0.6 mg/kg, GB 15618–2018). Nemerow integrated pollution indices revealed that more than 50% of these soils were slightly or moderately polluted. The activity ratios of Pb, Cd, Cu and Zn ranged from 0.18 to 0.26, which was much higher than that of Ni and Cr. The average PTEs in vegetables were all within the limitation of China or FAO/WHO (except for Pb). However, the PTEs accumulation capacity in different vegetables varied greatly, with the bioaccumulation factor of cilantro (0.023, 0.232, 0.031, 0.063, 0.009 and 0.007 for Pb, Cd, Cu, Zn, Ni and Cr) and white radish (0.004, 0.058, 0.008, 0.021, 0.003 and 0.002 for Pb, Cd, Cu, Zn, Ni and Cr) being the highest and lowest, respectively. Health risk assessment revealed that local residents suffered both non-carcinogenic and carcinogenic risk, with the hazard index (HI) ranging from 0.73 to 2.45 and 2.02–6.53, and the target carcinogenic risk (TCR) ranging from 2.22 × 10−3 to 5.92 × 10−3 and 6.67 × 10−3 to 1.70 × 10−2 for adults and children, respectively. Pb and Cd contributed more than 62.37% of the HI, and Cd contributed more than 79.42% of the TCR. These results indicate that historical wastewater irrigation has a long-term impact on local food safety and potentially adverse consequences for human health.

Characterization of the volatile compounds in white radishes under different organic fertilizer treatments by HS‐GC‐IMS with PCA

AbstractOrganic agriculture and organic produce are attracting increasing attention around the world. In order to explore the effects of different organic fertilizers on the volatile flavour compounds of white radishes, six experimental groups were designed as follows: no fertilizer group (CK) and conventional chemical fertilizer group (CF) as the control, pig manure organic fertilizer (PMOF), sheep manure organic fertilizer (SMOF), earthworm manure organic fertilizer (EMOF), and earthworm manure organic fertilizer with the microbial agent (EMOF+M) as the organic groups. Headspace–gas chromatography–ion mobility spectrometry (HS‐GC‐IMS) was used to detect the volatile flavour compounds of white radishes under six different planting conditions. A total of 26 volatile flavour compounds were identified qualitatively and the common characteristic flavour compounds of organic and conventional white radishes were determined, as well as the differences in the composition and content of volatile flavour compounds in different white radishes. The flavour fingerprint of white radish was established, and principal component analysis (PCA) clearly showed that the samples in a relatively separate space could be well‐distinguished. It provided a theoretical basis for the establishment and improvement of the evaluation system of volatile flavour substances of white radish, which was of great significance in the high‐quality production of white radish and the safe and sustainable development of organic vegetable industry.

Utilization of compost derived from waste sludge of shrimp raising-ponds for crop cultivation

Compost, an organic fertilizer which is rich of nutrients, safe and environmentally friendly for crop cultivation. In this study, it was aimed at evaluatiton of the effects of the compost derived from shrimp pond waste sludge on plant growth of kohlrabi, white radish, and mustard green. The application of the compost produced in five districts (Quynh Luong, Nghi Hop, Dien Trung, Quynh Di, Hung Hoa) of Nghe An province resulted in remarkably higher plant growth. In which kohlrabi, white radish, and mustard green fertilized by the compost from Quynh Luong district had crop yields of 3.6 kg/m2, 3.4 kg/m2, 3.7 kg/m2 than the control without compost yielding 2.1-2.2 kg/m2. Similarly, other plant growth parameters of number and areas of leaves and survival rate of the plants were all significantly higher than that of the control. Moreover, the mustard greens yields applied the compost produced in the four districts including Nghi Hop, Dien Trung, Quynh Di, Hung Hoa were in the range of 3.1-3.6 kg/m2 all higher than that of the control unapplied fertilization determined as 2.2 kg/m2, but reaching relatively equivalent to that of the commercial organic fertilizer at 3.8 kg/m2, but slightly lower than that of the chemical fertilizer 4.4 kg/m2. The study revealed that the compost from shrimp pond waste sludge can be fertilized for crop cultivattion which was safe and contributing to reducing a large amount of waste sludge discharged from shrimp-raising ponds in Nghe An province.

Health risk assessment of heavy metal exposure through vegetable consumption around a phosphorus chemical plant in the Kaiyang karst area, southwestern China.

The phosphorus chemical industry is an important source of heavy metals in farmland. Vegetables grown on contaminated soil potentially impose adverse effects on human health. In this study, the pollution status and health risks of heavy metals in vegetables around a phosphorus chemical plant in Kaiyang County, Guizhou Province, southwestern China, were assessed, and the low-accumulation vegetables were screened by bioaccumulation factor (BAF) and cluster analysis. Results showed the average concentrations of Hg, As, Cd, Pb, Cr, Mn, Co, and Zn in vegetables were 0.015, 0.728 0.382, 0.227, 0.850, 27.227, 0.525, and 6.438mg/kg, respectively. The single-factor pollution index showed that Cd was moderately polluted, and Cr, Hg, As, and Pb were slightly polluted. The Nemerow pollution index showed that the overall heavy metal pollution was classified as moderately polluted. The accumulation of heavy metals in different vegetables varied greatly, and chard, crown daisy, chayote, pumpkin, eggplant, white radish, sweet potato, carrot, and potato were selected as the low-accumulator vegetables. The consumption of all vegetables except chayote poses both carcinogenic and noncarcinogenic risks; among them, the consumption of sweet potato leaves has the highest health risks. The local population needs to adjust plantation structure and change dietary habits, and government should strengthen the management of phosphorus chemical plant pollution.

Antioxidant capacity, phytochemical profiles, and phenolic metabolomics of selected edible seeds and their sprouts.

Sprouts are recognized as nutritional and functional vegetables. In this study, 17 selected seeds were germinated simultaneously. The antioxidant capacity and total phenolic content (TPC) were determined for seeds and sprouts of all species. Both seed and sprout of white radish, with the highest antioxidant capacity, and TPC among all the 17 species, were further determined for phenolic metabolomics. Four phenolic classes with 316 phenolic metabolites were identified. 198 significantly different metabolites with 146 up-regulated and 52 down-regulated were confirmed, and high amounts of phenolic acids and flavonoids were found to be accumulated in the sprout. Several metabolism and biosynthesis, including phenylpropanoid, favone and flavonol, phenylalanine, and various secondary metabolites, were significantly activated. Significant correlations were found among FRAP, DPPH, ABTS, TPC, and phenolic profiles. Therefore, white radish sprout could be served as antioxidant and could be a good source of dietary polyphenols.

Chemical Composition and Biological Activity of Tanacetum balsamita Essential Oils Obtained from Different Plant Organs.

The aim of this study is to evaluate the chemical composition of Tanacetum balsamita L. essential oils (EOs) obtained from different plant organs, flowers (FEO), leaves (LEO), and stems (SEO), as well as to assess their biological properties. The results obtained by using GC and GC/MS analysis indicate that this plant belongs to the carvone chemotype. Moreover, we examined the oil's antimicrobial and antitumor potential. Antimicrobial effects were determined using minimum inhibitory concentrations assay and the vapor phase method. Obtained results indicate better antimicrobial activity of investigated EO samples compared to the commercially available antibiotics. On the treatment with FEO, Y. enterocolitica and H. influenzae showed high sensitivity, while treatment with LEO and SEO showed the highest effects against S. aureus. The vapor phase method, as an in situ antibacterial analysis, was performed using LEO. Obtained results showed that this EO has significant activity toward S. pneumoniae in the apple and carrot models, L. monocytogenes in the pear model, and Y. enterocolitica in the white radish model. The potential antitumor mechanisms of FEO, LEO, and SEO were determined by the means of cell viability, redox potential, and migratory capacity in the MDA-MB-231 and MDA-MB-468 cell lines. The results show that these EOs exert antiviability potential in a time- and dose-dependent manner. Moreover, treatments with these EOs decreased the levels of superoxide anion radical and increased the levels of nitric oxide in both tested cell lines. The results regarding total and reduced glutathione revealed, overall, an increase in the levels of total glutathione and a decrease in the levels of reduced glutathione, indicating strong antioxidative potential in tested cancer cells in response to the prooxidative effects of the tested EOs. The tested EOs also exerted a drop in migratory capacity, which indicates that they can be potentially used as chemotherapeutic agents.

Using Numerical Analysis to Develop a Retort Process to Enhance Antioxidant Activity and Physicochemical Properties of White Radish (Raphanus sativus L.) in Different-Sized Packages

Thermal processing of white radish using retort sterilization at different temperatures was investigated according to the dimension of the package. Four different samples with the same weight and volume were placed in packages with different dimensions. The degree of sterilization (i.e., F0-value) at the cold point targeted at 6 min was determined based on experimental data and heat transfer simulation. The sterilization time was considerably increased with a decrease in surface area to unit volume ratio (φ) at each temperature. The sterilization time for the sample with the highest φ (155.56) was approximately five times faster than the sample with the lowest φ (72.22) at all heating temperatures. Numerical simulation conducted with a proper heat transfer coefficient (h) showed mostly good agreement with the experimental data (RMSE < 2 °C). Changes in color and total phenolic content were higher for samples heated at higher temperatures. Hardness values of white radish samples measured for center and edge parts separately were more uniform for samples with a high φ. Results in this study suggest that optimizing heating conditions of root vegetables must consider their package dimensions to satisfy quality attributes after sterilization. Numerical simulation can be utilized as a useful tool to design the sterilization process.

Effects of Extraction Solvents on the Total Phenolic Content, Total Flavonoid Content, and Antioxidant Activity in the Aerial Part of Root Vegetables

The present study aimed to investigate the total phenolics, total flavonoids, and antioxidant activity in terms of the DPPH scavenging, reducing power, and H2O2 scavenging of the aerial parts of onion, white radish, red radish, carrot, and beet as affected by different extraction solvents. Generally, the aerial part of these vegetables has high antioxidant properties. Samples were extracted with methanol (100 and 70%), ethanol (100 and 70%), and water. Total phenolic content was highest when the samples were extracted using 100% methanol, while extraction with 100% ethanol yielded the highest total flavonoids. The highest DPPH activity and H2O2 scavenging values were obtained by extraction of the aerial plant parts with 70% ethanol, and the 70% methanol extract had the highest reducing power. Partial least regression (PLS) was performed to validate the optimum solvent for extraction of the antioxidants and their activity in each plant. The PLS indicated that there was a variation in the validation of the different extracts for each plant. The high antioxidant capacity of root vegetables, which is natural, indicates that they may have health and dietetic advantages for consumers.

OSMOTIC DEHYDRATION OF WHITE RADISH (Raphanus Sativus L.) SLICES: MASS TRANSFER CHARACTERISTICS AND MODELING

White radish sliced at 4 mm thickness was dehydrated by traditional osmotic dehydration (TOD) with nine types of osmotic solutions prepared by a randomized combining three levels concentration of sucrose and sodium chloride. The mass transfer characteristics were evaluated through the moisture diffusivity (Dm) and solid diffusivity (Ds), the fit of model was also estimated based on three popular models, including Newton, Henderson, and Pabis and Weibull. The results showed that white radish had the highest Dm and Ds value in the 4% salt and 15% sucrose solution, which presented that the fastest transfer process occurred in this solution. In addition, the Weibull model was the best model due to the highest R2 and the lowest root mean square error and chi-square, which means this model could fully describe the mass transfer (moisture/solid transfer) behavior of white radish.