Vitrification Of Porcine Oocytes Research Articles

Role of astaxanthin as an efficient antioxidant on the in vitro maturation and vitrification of porcine oocytes

As one of the most powerful natural antioxidants, astaxanthin (Ax) has begun to be applied to the field of reproductive biology. Here we used porcine oocyte as a model to explore how Ax improves the oocyte potential during in vitro maturation (IVM), and we also investigated the cytoprotective effects of Ax on the vitrified oocytes. Ax supplementation (final concentration of 2.5 μM) was subjected for immature oocytes during vitrification and subsequent IVM; fresh oocytes were also matured in vitro in the presence or absence of 2.5 μM Ax. Our results showed that Ax significantly increased the survival rate of vitrified oocytes, and promoted the blastocyst yield of both fresh and vitrified oocytes after parthenogenetic activation and somatic cell nuclear transfer. The oocytes treated with Ax displayed significantly lower reactive oxygen species generation and higher glutathione level. Vitrification of oocytes had no impact on caspase-3, cathepsin B and autophagic activities; Ax significantly decreased the cathepsin B activity in both fresh and vitrified oocytes. Moreover, the relative fluorescence intensity of lysosomes was significantly increased in vitrified oocytes, which was recovered by Ax treatment. The mitochondrial activity did not differ between fresh and vitrified oocytes, and was significantly enhanced in Ax-treated oocytes. Furthermore, Ax significantly restored the decreased expression of BMP15, ZAR1, POU5F1, GPX4 and LAMP2 genes in vitrified oocytes. Both fresh and vitrified oocytes treated with Ax showed significantly higher mRNA levels of GDF9, POU5F1, SOD2, NRF2 and ATG5. Taken together, this study provides new perspectives in understanding the mechanisms by which Ax improves the developmental competence of both fresh and vitrified porcine oocytes.

31 Effect of vitrification of porcine oocytes on production of ATP and mitochondrial DNA copy number

This experiment evaluated the effects of vitrification at different time points of invitro maturation (IVM) on ATP production and mitochondrial DNA (mtDNA) copy number of porcine oocytes. Treatments included vitrification at 24h of IVM (V24), vitrification at 44h of IVM (V44), and a control group consisting of fresh oocytes after 48h of IVM. Porcine cumulus–oocyte complexes (COCs) were obtained from a commercial vendor and underwent the first 24h of IVM during shipment in a portable incubator. Upon arrival, COCs were randomly allocated into treatments. The oocytes in the V44 and control groups were incubated at 38.8°C and 5.5% CO2 to continue IVM. Before vitrification, COCs were denuded in hyaluronidase by vortexing, followed by 3 washes in holding medium (Hanks’ balanced salt solution–HEPES + 4% BSA). Denuded oocytes were vitrified using a 3-step, dimethyl sulfoxide (DMSO)- and ethylene glycol-based protocol (VitriCool kit, IVF Bioscience), Cryolocks as carriers, and liquid nitrogen as cryogenic agent. All steps were carried out at room temperature. Warming was achieved using the VitriWarm kit (IVF Bioscience) consisting of 4 dilution steps. After warming, the oocytes were washed in holding medium and incubated in IVM medium to complete 48h of maturation (24h for V24 and 4h for V44). All warming steps were performed at 38.5°C. Oocytes destined for ATP production assessment (Control n=26, V44 n=27, V24 n=28) were frozen in 50µL of ultra-pure water, whereas oocytes destined for mtDNA copy number quantification (Control n=32, V44 n=30, V24 n=32) were snap-frozen in ∼1µL of holding medium. Samples were kept at −80°C until further processing. The ATP content of single oocytes was determined using an ATP bioluminescent somatic cell kit (FLASC, Sigma-Aldrich). The assessment of mtDNA copy number in single oocytes was performed by amplifying the porcine Mt-ND4 gene (F atccaagcactatccatcacca, R ccgatgattacgtgcaaccc; NC_000845.1) and quantification was carried out using a Droplet Digital PCR system (Bio-Rad Laboratories). Results for ATP production and mtDNA copy number were analysed through ANOVA with Tukey’s adjustment (SAS 9.4; Sas Institute Inc.). No differences were found in mtDNA copy number among groups (Control 178 004.69±19 207.23, V44 170 483.67±18 127.18, V24 176 767.50±27 211.09; P=0.36). In contrast, all groups differed in ATP content (pg/µL) among each other (Control 26.36±4.99, V44 20.26±6.61, V24 16.54±8.07; P<0.0001). These data indicate that although there was no effect on mitochondrial number, ATP production/storage ability is significantly reduced as a result of vitrification-warming. Vitrification at 44h of IVM followed by a 4-h post-warming incubation showed the highest ATP content among the vitrification treatments.

Vitrification of Porcine Oocytes and Zygotes in Microdrops on a Solid Metal Surface or Liquid Nitrogen.

Oocyte cryopreservation is a potent approach to keep female germplasm safe from epidemic diseases. In the last decade, we developed simple, cheap, and robust vitrification protocols which enable quick cryopreservation of immature porcine oocytes and zygotes in large numbers. In this chapter, we describe vitrification procedures for porcine oocytes and zygotes where they are vitrified in 1-2μL aliquots of a defined (protein-free) vitrification medium and dropped either on a metal surface pre-cooled from the bottom with liquid nitrogen (solid surface vitrification) or directly into liquid nitrogen. Vitrified microdrops can be stored in cryo-vials in liquid nitrogen. Low concentrations of permeating cryoprotectants during equilibration and proper temperatures during equilibration and warming are crucial for achieving high survival rates. The device used for cooling does not seem to affect system efficacy as vitrification of oocytes or zygotes either on Cryotop® sheets or in microdrops were equally effective.

Vitrification of porcine cumulus-oocyte complexes at the germinal vesicle stage does not trigger apoptosis in oocytes and early embryos, but activates anti-apoptotic Bcl-XL gene expression beyond the 4-cell stage.

The aim of the present study was to clarify whether or not our vitrification procedure at the germinal vesicle (GV)-stage triggers the apoptotic cascade in oocytes and subsequent embryos. Immature porcine cumulus-oocyte complexes were either vitrified and warmed (vitrified group) or subjected to cryoprotectant agents (CPA group) or cultured without any treatment (control). Oocytes of all treatment groups were subjected to in vitro maturation (IVM), fertilization, and embryo culture. Apoptosis was assayed in live oocytes at the end of IVM culture and in cleavage-stage embryos after in vitro fertilization (IVF). We detected similar frequencies of DNA fragmentation, levels of caspase activity, phosphatidylserine externalization, and mRNA levels for pro-apoptotic Bax and CASP3 genes in oocytes at the end of IVM and in early embryos among all groups. However, in the vitrified group, the anti-apoptotic Bcl-XL gene was upregulated in 4–8 cell embryos, which caused an 8-fold significant increase in the Bcl-XL/Bax mRNA ratio compared with the control and CPA groups (P < 0.05). In conclusion, vitrification of porcine oocytes at the GV stage by our method did not trigger the apoptotic cascade in oocytes and subsequent embryos but triggered the upregulation of the anti-apoptotic Bcl-XL gene in embryos.

27 Vitrification at the germinal vesicle stage does not trigger apoptosis in porcine oocytes and early embryos

Porcine immature oocytes can survive vitrification at high rates and retain their ability to undergo maturation and fertilization; however, the procedure reduces their competence for subsequent embryo development via unknown mechanisms (Somfai et al. 2014 Plos One 9, e97731). The aim of the present study was to clarify whether our vitrification procedure at the germinal vesicle stage triggers apoptosis in oocytes and subsequent developing embryos. Immature porcine cumulus-oocyte complexes obtained from slaughterhouse-derived ovaries were vitrified and warmed by our method (Appeltant et al. 2018 Cryobiology 85, 87-94) immediately after collection (vitrified group). The oocytes were equilibrated in 2% (vol/vol) ethylene glycol and 2% (vol/vol) propylene glycol for 13-15min. Then, they were vitrified by dropping them into liquid nitrogen in 2-μL microdrops of a medium composed of 17.5% ethylene glycol, 17.5% propylene glycol, 0.3M sucrose, and 50mgmL−1 polyvinylpyrrolidone. After warming, they were subjected to IVM, fertilization (IVF), and embryo culture using chemically defined media (Yoshioka et al. 2008 J. Reprod. Dev. 54, 208-213). From each collected batch, a group of oocytes was processed without vitrification (control group). Apoptosis was assayed in membrane-intact oocytes at the end of IVM and in cleavage-stage embryos on Day 2 after IVF (Day 0) by the CaspACE FITC-VAD-FMK In Situ Caspase Marker (Promega; Experiment 1), deoxynucleotidyl transferase (TdT) dUTP nick-end labelling (TUNEL; Experiment 2), and analysis of mRNA levels by RT-qPCR for the pro-apoptotic Bax and CASP3 genes (Experiment 3). Each experiment was replicated three times. Data were analysed by Kruskal-Wallis test followed by Dunn's multiple comparisons test. The mean survival rate of vitrified oocytes was 89.2%. There was no significant difference between the control and vitrified groups in relative caspase levels in IVM oocytes and in 2- to 4-cell embryos after IVF; however, significantly increased caspase activity (P&amp;lt;0.05) was detected in oocytes and embryos after treatment with 10 μM staurosporine (positive control). There was no significant difference between the control and vitrified groups in the proportion of TUNEL-positive oocytes (4.1 and 0.8%, respectively) and embryos (0 and 0%, respectively), whereas 96.6% of oocytes and 100% of cleavage stage embryos treated with 1000IUmL−1 deoxyribonuclease I (positive control) were proven to be TUNEL positive (P&amp;lt;0.05). Similar mRNA levels for Bax and CASP3 genes were detected in oocytes at the end of IVM and subsequent developing 4- to 8-cell embryos between the control and vitrified groups. In conclusion, vitrification of porcine oocytes at the germinal vesicle stage by our method did not trigger apoptosis in oocytes and subsequent developing embryos. This work was supported by the Japan Science and Technology Agency (JST)/Japan International Cooperation Agency (JICA) Science and Technology Research Partnership for Sustainable Development (SATREPS).

Porcine oocyte vitrification in optimized low toxicity solution with open pulled straws

One of the greatest challenges for reproductive cryobiologists today is to develop an efficient cryopreservation method for human and domestic animal oocytes. The objective of the present study was to optimize a low toxicity solution called VM3 to vitrify porcine oocytes using an open pulled straw (OPS) device and to evaluate the effects on viability, chromosomal organization and cortical granules distribution. Two experiments were conducted in this study. Firstly, we determined the minimum concentration of cryoprotectant present in the VM3 solution required (7.6 M) for vitrification using an OPS device. The appearance of opacity was observed when using a cooling solution at -196°C; no observable opacity was noted as vitrification. In addition, the ultrastructure of oocytes in VM3 or VM3 optimized solution was examined using cryo-scanning electron microscopy. The minimum total cryoprotectant concentration present in VM3 solution necessary for apparent vitrification was 5.6 M when combined with use of an OPS device. Use of both vitrification solutions showed a characteristic plasticized surface. In the second experiment, the relative cytotoxicity of vitrification solutions (VM3 and VM3 optimized) was studied. Oocyte viability, chromosomal organization and the cortical granules distribution were assessed by fluorescent stain. After warming, oocyte survival rate was similar to that of fresh oocytes. The vitrification process significantly reduced correct chromosomal organization and cortical granules distribution rates compared with the fresh oocytes group. However, correct chromosomal organization and cortical granules distribution rates did not differ among oocytes placed in different vitrification solutions. In conclusion, our data demonstrated that the VM3 solution can be optimized and that reduction in concentration to 5.6 M enabled vitrification of oocytes with an OPS device, however use of the VM3 optimised solution had no beneficial effect on vitrification of porcine oocytes.