Total Reads Research Articles

De novo somatic mosaicisms of INF2 and TRPV4 in patients with Charcot-Marie-Tooth disease.

Somatic mosaicism is caused by a postzygotic de novo mutation. It is a very rare genetic event, and mosaic cases have been reported only very limitedly among Korean patients with peripheral neuropathies, including Charcot-Marie-Tooth disease (CMT) so far. This study was performed to identify and characterize somatic mosaicism in Korean families with CMT. Genetic causes were identified by whole exome sequencing (WES) and a subsequent filtering process of the variants. The level of mosaicism for the de novo somatic mutations was determined by counting altered sequences from approximately 100 colonies/mutation and the ratio of altered sequences per total reads at the mutation site using the WES data. We observed two cases of somatic mosaicism in different families with CMT: p.Cys104Tyr in INF2 (male with CMT1) and p.Ser729Arg in TRPV4 (female with CMT2). The approximate levels of mosaicism were determined to be 24% and 30% in the blood, respectively. A man with the INF2 mutation showed very mild symptoms, while a woman with the TRPV4 mutation showed severe clinical phenotypes. The INF2 mutation is specifically considered a case of gonadal mosaicism. In addition, we confirmed that the p.Cys104Tyr in INF2 is associated with the CMT1 phenotype without focal segmental glomerulosclerosis (FSGS). This study may be the first or second report for the INF2 and TRPV4 mosaicism. The degrees of the phenotypic severity for the mosaic mutations probably depend on the mutation sites and the levels of mosaicism in the affected tissues. This study suggests that somatic mosaicism may contribute to inter- or intra-familial phenotypic heterogeneity.

Abstract 3678: Liquid biopsy fragmentomics approach for the diagnosis of uterine tumors

Abstract Background: Leiomyomas (LM), also known as fibroids, are common benign tumors of the smooth muscle of the uterus that can cause pain, infertility, and abnormal menstrual bleeding. Diagnosing LM is challenging using clinical indications alone, as they share symptoms with leiomyosarcoma (LMS), a rare, aggressive uterine malignancy with a ∼50% disease-specific survival. Pre-operative distinction between LM and LMS is difficult because these tumors are rarely biopsied before surgery. We hypothesize that a non-invasive circulating tumor DNA (ctDNA) test based on LMS- and LM-specific molecular markers will provide accurate pre-operative diagnosis and guide appropriate surgical treatment. Methods: We previously analyzed point mutations and copy number alterations (CNAs) in ctDNA using deep targeted sequencing and shallow whole-genome sequencing (WGS) from plasma specimens of 7 LMS and 12 LM patients (PMIDs: 29463554, 32232185). To build on this, we performed a new analysis of the first 4 nucleotide sequences (4-mer motifs) on the 5’ end of the cell-free DNA fragments using shallow WGS data. The frequency of 256 possible 4-mer motifs was calculated using R programming and normalized to total reads in each specimen. Two-class differential analysis identified motifs enriched in LM and LMS (false discovery rate < 0.05). Results: Our previous studies demonstrated the feasibility of ctDNA detection in LMS and LM patients. In LMS patients, ctDNA was detected in 6 of 7, with >98% specificity; in LM patients, ctDNA was detected in 6 of 12, with 76% specificity. To increase ctDNA detection sensitivity, we incorporated fragmentomics as a new ctDNA marker. Our new analysis identified 66 significantly enriched and 21 significantly decreased motifs in cell-free DNA from LMS patients compared to LM patients. Motifs associated with DNASE1L3 nuclease activity (e.g., CCCA) were significantly decreased in LM compared to LMS patients. Conclusion: We identified new tumor-specific fragmentomic markers in cell-free DNA from LMS and LM patients. Combining detection of point mutations, CNAs, and fragmentomic patterns could enable a highly sensitive ctDNA assay for accurate pre-operative distinction between LM and LMS. Next, we will validate DNASE1L3 and other nucleases in tissue microarrays of 100+ LM and 200+ LMS specimens by immunohistochemistry, and validate distinct fragmentomic patterns using expanded plasma collections. This research addresses an unmet clinical need for accurate pre-operative diagnosis of uterine tumors. Citation Format: Meagan S. Cobb, Philippe Jolivet, Kristen N. Ganjoo, Deirdre A. Lum, Matt van de Rijn, Joanna Przybyl. Liquid biopsy fragmentomics approach for the diagnosis of uterine tumors [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2025; Part 1 (Regular Abstracts); 2025 Apr 25-30; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2025;85(8_Suppl_1):Abstract nr 3678.

Transcriptomic profiles of Crandell-Rees feline kidney cells infected with Varicellovirus felidalpha-1 (FHV-1) field and vaccine strains

BackgroundVaricellovirus felidalpha-1 (FHV-1, previously Felid alphaherpesvirus-1) is a significant cause of upper respiratory tract disease in feline populations. Cats infected with FHV-1 show clinical signs that vary in severity. This can be due to differences in host responses and virus strain virulence. Investigating the gene transcription profiles during infections using FHV-1 strains could inform our understanding of host and viral factors contributing to disease outcomes. This study characterised the transcriptomes of Crandell–Rees feline kidney (CRFK) cells infected with field or vaccine FHV-1 strains to better understand the host response during infection.MethodsCrandell–Rees feline kidney cells were infected with either the FHV-1 F2 vaccine strain or the 384/75 field strain associated with severe disease. The transcriptomes were characterised using RNA-sequencing. To determine the host cellular transcription profile, the total transcripts were mapped to the cat genome and compared to uninfected cells. To characterise the viral transcription profile, the total reads were mapped to each FHV-1 strain. The differentially expressed host genes between infection strains were compared and further analysed using the PANTHER database to examine host pathway regulation.ResultsThe findings in this study show the differential host gene expressions induced by FHV-1 compared to uninfected CRFK cells. Genes encoding histone proteins were upregulated, while genes involved in cell adhesion and migration processes were downregulated during infections with FHV-1. Comparative analysis between field and vaccine strains showed similarities and differences in host gene expressions. Notably, upregulated genes unique to the field strain were associated with regulatory proteins involved in the cell cycle, while downregulated host genes in field and vaccine strains showed distinct host gene and pathway expressions involved in immune activation.ConclusionsThis study demonstrates the host and viral gene expressions during FHV-1 infection shows the distinct host responses to field and vaccine strains using an in vitro model. These findings provide a foundation for future transcriptomic investigations in other cell types, including ex-vivo explants systems, to enhance our understanding of host and viral factors contributing to disease outcomes.

Deciphering the microbiome potential and metabolic profiling of animal waste co-composting reveals the co-occurrence network of non-microbial and microbial biostimulants to strengthen conservative practices in sustainable agriculture

BackgroundIndia has a rich history of agriculture with its vast biodiversity niches and traditional soil conservation practices. More recently, there have been growing molecular insights into crop-soil management practices and their niche microbial consortia and underlying services. However, harnessing traditional innovations to conserve and promote niche-specific microbiome management in agriculture has not been explored in detail. In an earlier report, we anticipated that the oldest documented microbial technology, Kunapajala, has the indigenous microbiome potential that reinforces its unifying cyclical operation interlinked with agro-waste recycling and valorization to eco-friendly food production. In the present study, we aimed to elucidate the molecular signatures of the microbiome–metabolite potential in this traditional liquid manure.ResultsOur results showed that fish- and livestock waste-derived Kunapajala are dynamic sources of plant-available macronutrients, plant growth regulators, and other bio-active compounds over 90 days of incubation. Besides estimation of microbial loads and dynamics in culture-based assays, whole genome metagenome (WGMG) sequencing data confirmed that bacteria, primarily Firmicutes and Proteobacteria, constitute the dominant kingdom (> 95% of total reads), with over 30% microbial abundance as potential plant growth-promoting rhizobacteria (PGPR), notably representing Clostridium, Corynebacterium, and Bacillus, in 30-day fermented products. The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway database further identifies the predominance of enzymatic regulations in carbohydrate and amino acid metabolism (> 20%), reflecting high organic matter turnover into different hydrolysates and metabolites in Kunapajala. To further support and validate, liquid chromatography coupled to hybrid quadrupole time-of-flight mass spectrometry (LC–QTOF-MS) based metabolite screening elucidates their potential roles in plant growth promotion and stress adaptation. We also investigate the plant biostimulant potential of Kunapajala and further establish its function as an organic fertilizer in a controlled pot-based assay in red amaranth. Overall, our microbiome–metabolite data highlight the dynamic co-occurrence of non-microbial and microbial biostimulants to redefine its niche compositional network and potential roles in sustainable agriculture.ConclusionsOur study presents the first comprehensive microbiomes and metabolite profiling of Kunapajala, which could further advance and inform strategies for customized optimization of microbial consortia in agroecosystem functioning. Overall, employing metagenomic approaches to harnessing traditional organic amendments brings new molecular insights to strengthen conservative practices in sustainable agriculture.Graphical

Transcriptome dataset to investigate the effect of deep seawater on the gene expression and functional compounds of leaves of Ligularia stenocephala.

Transcriptome dataset to investigate the effect of deep seawater on the gene expression and functional compounds of leaves of Ligularia stenocephala.

Comprehensive sequencing profile and functional analysis of IsomiRs in human pancreatic islets and beta cells.

MiRNAs regulate gene expression, influencing beta cell function and pathways. Isoforms of miRNA (isomiRs), sequence variants of miRNAs with post-transcriptional modifications, exhibit cell-type-specific expression and functions. Despite their biological significance, a comprehensive isomiR profile in human pancreatic islets and beta cells remains unexplored. This study aims to profile isomiR expression in four beta cell sources: (1) laser capture microdissected human islets (LCM-HI); (2) collagenase-isolated human islets (CI-HI); (3) sorted beta cells; and (4) the EndoC-βH1 beta cell line, and to investigate their potential role in beta cell function. Small RNA-seq and/or small RNA dataset analysis was conducted on human pancreatic islets and beta cells. Data were processed using the sRNAbench bioinformatics pipeline to classify isomiRs based on sequence variations. A beta cell-specific isomiR signature was identified via cross-validation across datasets. Correlations between LCM-HI isomiR expression and in vivo clinical parameters were analysed using regression models. Functional validation of isomiR-411-5p-Ext5p(+1) was performed via overexpression in EndoC-βH1 cells and CI-HI, followed by glucose-stimulated insulin secretion (GSIS) assays and/or transcriptomic analysis. IsomiRs constituted 59.2 ± 1.9% (LCM-HI), 59.6 ± 2.4% (CI-HI), 42.3 ± 7.2% (sorted beta cells) and 43.8 ± 1.2% (EndoC-βH1) of total miRNA reads (data represented as mean ± SD), with 3' end trimming (Trim3p) being the predominant modification. A beta cell-specific isomiR signature of 30 sequences was identified, with isomiR-411-5p-Ext5p(+1) showing a significant inverse correlation with basal insulin secretion (p=0.0009, partial R2=0.68) and total insulin secretion (p=0.005, partial R2=0.54). Overexpression of isomiR-411-5p-Ext5p(+1), but not of its canonical counterpart, importantly reduced GSIS by 51% ( ± 15.2%; mean ± SD) (p=0.01) in EndoC-βH1 cells. Transcriptomic analysis performed in EndoC-βH1 cells and CI-HI identified 47 genes significantly downregulated by isomiR-411-5p-Ext5p(+1) (false discovery rate [FDR]<0.05) but not by the canonical miRNA, with enriched pathways related to Golgi vesicle biogenesis (FDR=0.017) and trans-Golgi vesicle budding (FDR=0.018). TargetScan analysis confirmed seed sequence-dependent target specificity for 81 genes uniquely regulated by the isomiR (p=1.1 × 10⁻⁹). This study provides the first comprehensive isomiR profiling in human islets and beta cells, revealing their substantial contribution to miRNA regulation. IsomiR-411-5p-Ext5p(+1) emerges as a distinct key modulator of insulin secretion and granule dynamics in beta cells. These findings highlight isomiRs as potential biomarkers and therapeutic targets for diabetes, warranting further exploration of their roles in beta cell biology.

Nanopore Sequencing of Amoebophrya Species Reveals Novel Collection of Bacteria Putatively Associated With Karlodinium veneficum.

The dinoflagellate parasite Amoebophrya sp. ex Karlodinium veneficum plays a major role in controlling populations of the toxic bloom-forming dinoflagellate K. veneficum and is one of the few cultured representatives of Marine Alveolate Group II. The obligate parasitic nature of this Amoebophrya spp. precludes isolation in culture, and therefore, genomic characterization of this parasite relies on metagenomic sequencing. Whole-genome sequencing of an Amoebophrya sp. ex K. veneficum-infected culture using Nanopore long reads revealed a diverse community of novel bacteria as well as several species previously reported to be associated with algae. In sum, 39 metagenome-assembled genomes were assembled, and less than half of these required binning of multiple contigs. Seven were abundant but of unknown genera, 13 were identifiable at the generic level by BLAST (8 of which were apparently complete single-contig genomes), and the remaining 19 comprised less abundant (individually accounting for <2% of the total bacterial reads in the culture) and often rarer and/or novel species. Attempts to culture strains identified through sequencing revealed that only two of these bacterial isolates were readily amenable to cultivation, stressing the importance of a dual culture- and sequencing-based approach for robust community analysis. Functional annotations of metagenome-assembled genomes are presented here to support the characterization of a microbial community associated with K. veneficum and/or Amoebophrya sp. ex K. veneficum cultured from the Chesapeake Bay and give preliminary insights into the nature of the associations these bacteria have with this parasite-host complex.

Performance Evaluation of a Next-Generation Sequencing-Based T-Cell Receptor Gene Rearrangement Assay.

Performance Evaluation of a Next-Generation Sequencing-Based T-Cell Receptor Gene Rearrangement Assay.

Effects of Environmental Chemical Pollutants on Microbiome Diversity: Insights from Shotgun Metagenomics.

Chemical exposure in the environment can adversely affect the biodiversity of living organisms, particularly when persistent chemicals accumulate over time and disrupt the balance of microbial populations. In this study, we examined how chemical contaminants influence microorganisms in sediment and overlaying water samples collected from the Kinnickinnic, Milwaukee, and Menomonee Rivers near Milwaukee, Wisconsin, USA. We characterized these samples using shotgun metagenomic sequencing to assess microbiome diversity and employed chemical analyses to quantify more than 200 compounds spanning 16 broad classes, including pesticides, industrial products, personal care products, and pharmaceuticals. Integrative and differential comparative analyses of the combined datasets revealed that microbial density, approximated by adjusted total sequence reads, declined with increasing total chemical concentrations. Protozoan, metazoan, and fungal populations were negatively correlated with higher chemical concentrations, whereas certain bacterial (particularly Proteobacteria) and archaeal populations showed positive correlations. As expected, sediment samples exhibited higher concentrations and a wider dynamic range of chemicals compared to water samples. Varying levels of chemical contamination appeared to shape the distribution of microbial taxa, with some bacterial, metazoan, and protozoan populations present only at certain sites or in specific sample types (sediment versus water). These findings suggest that microbial diversity may be linked to both the type and concentration of chemicals present. Additionally, this study demonstrates the potential roles of multiple microbial kingdoms in degrading environmental pollutants, emphasizing the metabolic versatility of bacteria and archaea in processing complex contaminants such as polyaromatic hydrocarbons and bisphenols. Through functional and resistance gene profiling, we observed that multi-kingdom microbial consortia-including bacteria, fungi, and protozoa-can contribute to bioremediation strategies and help restore ecological balance in contaminated ecosystems. This approach may also serve as a valuable proxy for assessing the types and levels of chemical pollutants, as well as their effects on biodiversity.

First report of privet leaf blotch-associated virus (PLBaV) infecting lilac (Syringa vulgaris L.) in France.

Privet leaf blotch-associated virus (PLBaV) is an Idaeovirus discovered by high-throughput sequencing (HTS) in privet (Ligustrum japonicum L) in southern Italy in 2017 (Navarro et al., 2017). In privet, it causes a leaf blotch disease with yellowish or whitish chlorotic blotches or ringspots. Since this initial discovery, there have been no further reports of PLBaV and a single genomic sequence is available in GenBank (LT221868-9). A GenBank entry (HM153080) suggests that PLBaV might also infect ash (Fraxinus excelsior L.). In June 2024, a lilac (Syringa vulgaris L.) showing poor growth and leaf symptoms of light green chlorotic rings and lines was observed near Bordeaux, France. Total RNAs were extracted (Khalili et al., 2022) from symptomatic leaf tissue and analyzed by HTS (2x150 nucleotides (nt) paired reads, Illumina NovaSeq) following ribodepletion (Ribo-off rRNA Depletion Kit(Plant) and VAHTS Universal V6 RNA-seq Library Prep Kit for Illumina, Nanjing Vazyme Biotech Co, Nanjing, China). The obtained reads were trimmed, de novo assembled or mapped against references using CLC Genomics Workbench 24.0 with default settings (Candresse et al., 2018) and contigs annotated by blastx against GenBank. Two contigs were identified with very high homology with the genomic RNAs of the PLBaV reference isolate from privet. No other virus or viroid contig was identified from the lilac dataset. The RNA1 contig (5354 nt) misses only 17 nt at the 5' end and 6 nt at the 3' end and is 97.9% identical to the RNA1 of the reference isolate (LT221868). It involves 67,742 reads (0.25% of the total of 24.9 million reads of an average length of 148.6 nt), for an average coverage of 1741x. The RNA2 contig (2335 nt) misses 14 nt at the 5' end and is complete at the 3' end. It is 98.2% identical to the reference isolate (LT221869) and involves 75,140 reads (0.3% of total reads) for a 4769x average coverage. The sequences of these two contigs, representing the second near complete PLBaV genome have been deposited in GenBank (PQ786942-43). To confirm PLBaV presence in the original lilac sample, specific primers were designed for both genomic RNAs. RNA1 was amplified using primer pair PLBaV-RNA1-R1 5' TCGATTCTCAGCAATGAGATG 3' and PLBaV-RNA1-F1 5' CTGTGTGCGTTGGTCTGAGT 3' while RNA2 was amplified using the pair PLBaV-RNA2-R1 5' TGGTTGAGGTCGAGAGGTG 3' and PLBaV-RNA2-F1 5' ACTCAAGCGTAAGATGGCGTC 3'. Using the RNA purification and RT-PCR protocols of Khalili et al. (2022), both primer pairs were used at a 57°C annealing temperature, yielding amplicons of the expected size (respectively 392 and 301 nt) showing 100% identity with the HTS contigs. To the best of our knowledge, this is the first report of PLBaV in lilac in France and the second report of PLBaV ever, representing the identification of a new natural host and an extension of the known geographical distribution. Lilac, similar to privet and ash is a member of the Oleaceae family, further strengthening the association between PLBaV and this family. Since no other viral agent was identified in the HTS analysis, the chlorotic ringspot symptoms that prompted this investigation were most likely caused by PLBaV. The affected plant has since died but whether the initial poor growth and later death were caused by PLBaV is not known as these symptoms might have had another cause. Raspberry bushy dwarf virus (RBDV) the best known Idaeovirus is transmitted by pollen and seed (Isogai et al., 2014), raising the question of whether PLBaV might be similarly transmitted in its various hosts. The rarity of PLBaV reports since its discovery in 2017 suggest it should be of low concern but data is needed to better evaluate its presence in and pathogenicity to lilac.

Unexpected scarcity of ANME archaea in hydrocarbon seeps within Monterey Bay

Abstract. Marine hydrocarbon seeps typically harbor a relatively predictable microbiome, including anaerobic methanotrophic (ANME) archaea. Here, we sampled two cold seeps in Monterey Bay, CA – Clam Field and Extrovert Cliff – which have been known for decades but never characterized microbiologically. Many aspects of these seeps were typical of seeps worldwide, including elevated methane and sulfide concentrations, 13C-depleted dissolved inorganic carbon, and the presence of characteristic macrofauna. However, we observed atypical microbial communities: extremely few ANME sequences were detected in either 16S rRNA or mcrA gene surveys at Clam Field (&lt; 0.1 % of total community reads), even after 6 months of incubation with methane in the laboratory, and only slightly more ANME sequences were recovered from Extrovert Cliff (&lt; 0.3 % of total community reads). At Clam Field, a lack of ANME mcrA transcription, a lack of methane-dependent sulfate reduction, and a linear porewater methane profile were consistent with low or absent methanotrophy. Although the reason for the scarcity of ANME archaea is still unclear, we postulate that non-methane hydrocarbon release excludes anaerobic methanotrophs directly or indirectly (e.g., through competitive interactions with hydrocarbon-degrading bacteria). Our findings highlight the potential for hydrocarbon seeps without this critical biofilter and therefore greater methane emissions from sediments.

P0238 Reliability of magnetic resonance imaging indices for evaluating perianal fistulizing disease activity in paediatric Crohn’s disease

Abstract Background Progress in clinical trials and drug development for paediatric perianal fistulising CD (pfCD) depends upon accurate, reproducible imaging to assess disease activity and measure treatment response. We evaluated the inter- and intra-rater reliability of existing radiologic disease activity indices and anatomical classification systems previously identified as appropriate for assessment of paediatric pfCD.1 Methods A retrospective cohort (N=50) of magnetic resonance imaging (MRI) exams representing a full spectrum of paediatric (&amp;lt;18 years) perianal CD severity was selected by a single expert paediatric radiologist. Methods described by Zou2 were used to estimate sample size. Three separate radiologists (2 paediatric) blinded to clinical information assessed pfCD in the exams using the Magnetic Resonance Novel Index for Fistula Imaging in CD (MAGNIFI-CD), Van Assche Index (VAI), modified VAI (mVAI), Paediatric MRI based Perianal Crohn’s disease (PEMPAC) index, a visual analogue scale (VAS) of overall pfCD disease severity (range, 0-100 mm), as well as with the Park’s and St. James University Hospital anatomic classification systems. Two radiologists read all exams twice, separated by 2 weeks, and 1 radiologist read the exams once (250 total reads). Intra- and inter-rater reliability was evaluated using intraclass correlation coefficients (ICC; equivalent to weighted kappa). Precision of the ICC estimates was quantified with 95% confidence intervals (CIs) obtained using clustered bootstrapping. Degree of reliability was interpreted with benchmarks proposed by Landis and Koch3. Results Median age of children was 13.5 years (IQR 11.4-16.1), and 64% were male. Median Paediatric Crohn’s Disease Activity Index score at time of imaging was 17.5 (IQR 10-32.5). Substantial (ICC&amp;gt;0.61) inter-rater reliability was observed for MAGNIFI-CD, VAI, and mVAI (Table 1), with the highest ICCs observed for the mVAI (0.72 [0.6 to 0.79]). Moderate (ICC&amp;gt;0.41) inter-rater reliability was observed for PEMPAC, St. James University Hospital classification, and the VAS, and fair (ICC&amp;gt;0.21) inter-rater reliability was observed for Parks classification. Intra-rater reliability was nearly perfect (ICC&amp;gt;0.81) for the VAS, and substantial for all indices except for Parks classification, which had moderate (0.60 [0.44 to 0.75]) intra-rater reliability (Table 1). Conclusion Most existing multi-item MRI-based disease activity indices and the St. James Hospital classification were reliable for the assessment of paediatric pfCD in our cohort. Our preliminary results suggest that the disease activity indices may have utility to measure treatment effect in paediatric pfCD clinical trials.

First report of watermelon mosaic virus infecting faba bean (Vicia faba L.) in China.

Faba bean (Vicia faba L.) is the fourth most cultivated temperate legume (Lyu et al., 2021). It is widely grown throughout the world as a nutritious legume crop. From March to April in 2023, field-grown faba bean plants with virus-like symptoms such as mosaic, discoloration, stunting, yellowing, chlorosis and leaf curling were observed at 13 different locations in Nanjing and Xinghua City in Jiangsu Province, China. A total of sixty-five leaf samples were collected from the symptomatic faba bean plants. The leaf morphology of these plants is deformed, and the growth and development are severely affected by the infected diseases. To identify the viruses that infected the faba bean plants, the samples were mixed, and the total RNA was extracted using the TRIzol reagent (Invitrogen, USA). A small RNA sequence library was constructed using the Trusses Small RNA Sample Prep Kit (Illumina, San Diego, USA) and analysed by high-throughput sequencing using an Illumina HiSeq 2500 platform (Lianchuan Biotechnology, Hangzhou, China). The obtained clean sequencing reads were mapped mainly to 11 viruses (with mapped read counts >20000). De novo assembly of the total reads was performed using ACGT101-miR and Velvet software (LCSciences, Houston, Texas, USA). The resulting assembled contigs were analysed by BLASTn and BLASTx at National Center for Biotechnology Information. Seventy-three contigs were matched to the genome sequence of watermelon mosaic virus (WMV) in the genus Potyvirus of the family Potyviridae. RT-PCR was used to detect WMV in the high-through sequencing sample using specific primers (WMV-F: 5'- TTAACCACATTGATGGTTGC-3', WMV-R: 5'- GACCCGAAATGCTAACTGTG-3') with an expected product of 924 bp. The sequencing results of PCR amplicon confirmed that the sample was infected with WMV (Fig. S1A). RT-PCR analysis of pooled samples from each location showed that samples from three locations were infected with WMV (Fig.S1B). To detect WMV in the individual sample collected from these three locations, a total of 18 samples were analysed by RT-PCR and four samples were positive for WMV (Fig.S1C). The symptoms of the four infected plants are shown in Fig.S1D. To determine the full-length sequence of the WMV isolate from faba bean, RT-PCR was performed using five overlapping primer pairs designed according to the WMV sequences obtained by high-throughput sequencing and the aligned WMV sequences. The amplified PCR products were then inserted into pMD19-T (Takara, Dalian, China) and sequenced. The full-length sequence of the faba bean WMV was assembled from the five overlapping sequences and deposited in GenBank as WMV-Fb isolate (accession number PP782053). The complete sequence of the WMV-Fb isolate has 10,044 nt and contains a 9,648 nt open reading frame encoding a polyprotein of 3,216 amino acids. It shares the highest nucleotide sequence identity (97.46%) with two WMV isolates (accession number OM948829.1 and OM948820.1) from Zucchini in Spain and had 97.40% nucleotide sequence identity with Sapindus mukorossi potyvirus strain pt164-pot-23 (accession number MN722418.1) from Sapindus mukorossi Gaertn. in Jiangsu, China at the complete genome level. To reveal the molecular evolutionary relationships between WMV-Fb and other isolates, a phylogenetic tree was constructed using the polyprotein nucleotide acid sequence of WMV-Fb and reported WMV isolates in the G1 (classical isolates), G2 and G3 (emerging isolates) groups (Bertin et al., 2020; Abdalla et al., 2021). Phylogenetic analysis showed that the WMV-Fb isolate was clustered in the G3 group (Fig.S1E). To the best of our knowledge, this is the first report of WMV infecting faba bean. WMV has a wide host range and causes severe losses in cucurbit crops, such as melon, watermelon, zucchini, and cucumber (Dong et al., 2017; Nematollahi et al., 2021). Our results provide a better understanding of the host range of WMV and suggest that WMV poses a potential threat to legume crops.

Estimating and correcting index hopping misassignments in single-cell RNA-seq data.

Index hopping causes read assignment errors in data from multiplexed sequencing libraries. This issue has become more prevalent with the widespread use of high-capacity sequencers and highly multiplexed single-cell RNA sequencing (scRNA- seq). We conducted deep, plate-based scRNA-seq on a mixed population of mouse skin cells. Analysis of transcriptomes from 1152 cells identified four distinct cell types. To estimate the error rate in sample assignment due to index hopping, we employed differential expression analysis to identify signature genes that were highly and specifically expressed in each cell type. We quantified the proportion of misassigned reads by examining the detection rates of signature genes in other cell types. Remarkably, regardless of gene expression levels, we estimated that 0.65% of reads per gene were assigned to incorrect cell across our data. To computationally compensate for index hopping, we developed a simple correction method wherein, for each gene, 0.65% of the library's average expression level was subtracted from the expression in each cell. This correction had notable effects on transcriptome analyses, including increased cell-cell clustering distance and alterations in intermediate state assignments of cell differentiation. Index hopping misassignments are measurable and can impact the experimental interpretation of sequencing results. We devised a straightforward method to estimate and correct for the index hopping rate by quantifying misassigned genes in distinct cell types within an scRNA-seq library. This approach can be applied to any barcoded, multiplexed scRNA-seq library containing cells with distinct expression profiles, allowing for correction of the expression matrix before conducting biological analysis.

Grey and harbor seals in France (mainland and Saint-Pierre et Miquelon): microbial communities and identification of a microbial source tracking seal marker.

Seals, protected wild marine mammals, are widely found in waters around the world. However, rising concerns about their increasing numbers in some areas have led to potential worries regarding microbiological contamination of coastal areas by their feces, which could impact bathing and shellfish-harvesting activities. To the best of our knowledge, no study has been conducted on the bacterial and RNA viral communities present in the feces of both grey and harbor seals, which are the two main seal species observed in mainland France and overseas. Fecal bacterial (n = 132) and RNA viral (n = 40) communities of seals were analyzed using 16S rRNA gene amplicon high-throughput sequencing and viral RNA sequencing methods, respectively. In addition, to identify the specific characteristics of seal fecal microbial communities compared to other animal fecal microbial communities that may also contaminate coastal areas, the bacterial communities of seals were compared to those of wild waterbirds and breeding animals (i.e., cattle and pigs) which could be present in upstream catchments of coastal areas. Finally, ANCOM was used to identify unique and seal-associated Amplicon Sequence Variants (ASVs), aiming to develop a Microbial Source Tracking (MST) bacterial qPCR marker associated with seals. The bacterial communities of grey and harbor seals were not found to be significantly different and were characterized by a predominance of Firmicutes, including the genera Clostridium sensu stricto 1 and Peptoclostridium, followed by Fusobacteriota with the genus Fusobacterium, and Bacteroidota with the genus Bacteroides. However, variations in bacterial communities between sites and individuals were observed. Similar observations were made for the RNA viral communities being characterized by a predominance of Picobirnaviridae (44% of total reads) and Astroviridae (15%). This study successfully developed a sensitive (89.8%) and specific (97.1%) MST qPCR marker targeting grey seal-associated bacteria belonging to the Bifidobacteriaceae family. This marker can be used to identify potential fecal contamination of coastal areas by seals and complements the MST toolboxes of markers already developed for humans, wild birds and livestock.

A sort and sequence approach to dissect heterogeneity of response to a self-amplifying RNA vector in a novel human muscle cell line

A sort and sequence approach to dissect heterogeneity of response to a self-amplifying RNA vector in a novel human muscle cell line

Faecal sample storage without ethanol for up to 24 h followed by freezing performs better than storage with ethanol for shotgun metagenomic microbiome analysis in patients with inflammatory and non-inflammatory intestinal diseases and healthy controls

ObjectiveThe influence of different faecal collection methods on metagenomic analyses remains under discussion, and there is no general agreement on which collection method is preferable for gut microbiome research. We compared faecal samples collected in tubes without preservatives with those containing 10 mL of 96% ethanol for gut microbiome research when the timeframe from defecation to freezing at – 80 °C was up to 24 h. We aimed to compare the collection methods on faeces from participants with inflammatory and non-inflammatory gastrointestinal disorders and healthy controls to investigate the most suitable method when considering data yield, human fraction of sequencing reads, and ease of use. We also examined the faecal sample homogeneity.ResultsFaeces collected in tubes without preservatives resulted in more sequencing reads compared to faeces collected in tubes with 96% ethanol and were also easier to handle. The human fraction of total reads in faeces collected in ethanol from participants with inflammatory bowel disease was higher than all other samples. DNA extraction and sequencing from two different locations in the same faecal sample gave similar results and showed sample homogeneity.

BIOM-53. LOW-PASS WHOLE GENOME SEQUENCING OF CEREBROSPINAL FLUID IDENTIFIES TUMOR AGNOSTIC TP53 ABERRATIONS IN LEPTOMENINGEAL METASTATIC DISEASE

Abstract Leptomeningeal metastatic disease (LMD) is the spread of cancer cells into the cerebrospinal fluid (CSF)-filled spaces surrounding the central nervous system (CNS). Once LMD occurs, patients endure devastating neurologic symptoms and survive for only a few weeks to months. The clinical diagnosis of LMD has risen as patient survival from non-CNS metastatic disease improves. Unfortunately, detection of LMD even in symptomatic patients is &amp;lt;50% using the current gold standard – CSF cytology. Therefore, a strong clinical need exists for the sensitive and early detection of LMD. Here, we sought to develop a minimally invasive liquid biopsy approach to diagnose LMD using next-generation sequencing. Because copy number variations (CNVs) are common in cancer and increase after chemoradiation, we hypothesized that CNV detection in CSF may offer a means to detect LMD since patients have already undergone treatment for the underlying disease. Specifically, we sought to develop low-pass whole genome sequencing (lpWGS) of cell-free DNA in CSF to detect CNVs associated with LMD. A novel lpWGS algorithm was developed using FASTQ files trimmed to 30 million total paired reads. The genome was partitioned into one million continuous base pair segments excluding problematic areas yielding 2,445 regions across 22 autosomes. Control samples were used to model the read depth for each region to establish the euploid state. Read depth across the genome for all samples was 0.6X. CSF samples from lung cancer, breast cancer, and melanoma patients with LMD demonstrated prominent evidence of monosomies and trisomies throughout the genome. Lung cancer exhibited frequent amplifications (&amp;gt;4-fold). Notably, we observed 17p monosomy in CSF regardless of cancer type which indicates TP53 haploinsufficiency may support LMD progression, a conjecture supported by a codeletion of TP53 in one patient. lpWGS detects LMD in solid tumor cancers and may also identify novel mechanisms for LMD progression.

Mechanism of formation of hybrid abalone(Haliotis discus hannai and H. fulgens) heterosis on growth trait based on allele-specific expression analysis

Mechanism of formation of hybrid abalone(Haliotis discus hannai and H. fulgens) heterosis on growth trait based on allele-specific expression analysis

Comparative analysis of whole exome sequencing kits for the canine genome.

As the public's interest in companion dogs grows, health issues in these animals are also emerging, necessitating the optimization of whole exome sequencing (WES) as a valuable method for disease prediction. While WES targeting the human genome is well established, WES targeting the canine genome is understudied, and there is a need to find effective analysis kits. We compared and analyzed the performance of three WES kits from Twist and Agilent using the canine genome as the target to perform genetic analysis of canine diseases effectively. The levels of total reads, the duplication rate, and variant calling in canine genomic DNA samples from seven healthy dogs (three beagles, one bichon fry, one maltese, one welsh corgi, and one mixed breed) without any interventions were examined through WES via Twist and Agilent kits. We found that while Twist had the lowest total read number, the number of reads in the SSXT series was significantly (P<0.05) greater. Twist showed low evenness and high standard deviation, but the SSXT series showed relatively high evenness. Compared with Twist, the SSXT series from a depth of 30× presented a significantly (P<0.05) greater target ratio. Among the four kits, the significantly lowest duplicate ratio was confirmed for SSXT (O/N) (30% lower than Twist). The most important performance of the kit, the number of variants detected, was 48,302 for Twist and 130,506 for SSXT (O/N). On the basis of the performance comparison results, SSXT (O/N) was found to have the best performance.