Tomato Production Research Articles

Carbon monoxide is involved in melatonin-enhanced drought resistance in tomato seedlings by enhancing chlorophyll synthesis pathway

BackgroundDrought is thought to be a major abiotic stress that dramatically limits tomato growth and production. As signal molecule, melatonin (MT) and carbon monoxide (CO) can enhance plant stress resistance. However, the effect and underlying mechanism of CO involving MT-mediated drought resistance in seedling growth remains unknown. In this study, tomato (Solanum lycopersicum L. ‘Micro-Tom’) seedlings were used to investigate the interaction and mechanism of MT and CO in response to drought stress.ResultsThe growth of tomato seedlings was inhibited significantly under drought stress. Exogenous MT or CO mitigated the drought-induced impairment in a dose-dependent manner, with the greatest efficiency provided by 100 and 500 µM, respectively. But application of hemoglobin (Hb, a CO scavenger) restrained the positive effects of MT on the growth of tomato seedlings under drought stress. MT and CO treatment promoted chlorophyll a (Chl a) and chlorophyll a (Chl b) accumulations. Under drought stress, the intermediate products of chlorophyll biosynthesis such as protoporphyrin IX (Proto IX), Mg-protoporphyrin IX (Mg-Proto IX), potochlorophyllide (Pchlide) and heme were increased by MT or CO, but uroporphyrinogen III (Uro III) content decreased in MT-treated or CO-treated tomato seedlings. Meanwhile, MT or CO up-regulated the expression of chlorophyll and heme synthetic-related genes SlUROD, SlPPOX, SlMGMT, SlFECH, SlPOR, SlChlS, and SlCAO. However, the effects of MT on chlorophyll biosynthesis were almost reversed by Hb.ConclusionThe results suggested that MT and CO can alleviate drought stress and facilitate the synthesis of Chl and heme in tomato seedlings. CO played an essential role in MT-enhanced drought resistance via facilitating chlorophyll biosynthesis pathway.

Analysis of tomatoes showing iron deficiency symptoms in winter under heavy fruit load

Declines in crop productivity that are thought to be due to iron deficiency have been reported even on non-calcareous-alkaline soils. For example, tomatoes exhibit iron deficiency-like symptoms (yellowing of new leaves) if the fruit load is heavy during winter. The objective of this study is to investigate the relationship between fruit load, low temperatures, low sunlight, and iron deficiency, and to explore the possibility of increasing productivity with iron-containing fertilizers. Results of an investigation of the farms experiencing iron deficiency-like symptoms in winter showed low iron concentrations and elevated expression of iron deficiency-inducible genes in yellowing leaves. To investigate the effects of heavy fruit load on iron nutrition, plants were grown in three groups: those with a medium number of fruits per truss (MED), a high number of fruits (heavy fruit load; HEAVY), and a high number of fruits with additional iron fertilization (++Fe). The SPAD leaf-color value of the new leaves and weight of the lower leaves in winter were in the order of HEAVY < ++Fe < MED. In all groups, the iron concentrations in the upper leaves in January were lower than those in October and March. RNA-seq analysis showed that the expression of genes involved in iron absorption was suppressed in the roots in January, which may have contributed to iron deficiency in winter. These results suggest that one of the factors limiting the productivity of tomatoes in winter with heavy fruit load is iron, and that productivity can be restored by iron materials.

Finding optimum climatic parameters for high tomato yield in Benin (West Africa) using frequent pattern growth algorithm.

Tomato is one of the most appreciated vegetables in the world. Predicting its yield and optimizing its culture is important for global food security. This paper addresses the challenge of finding optimum climatic values for a high tomato yield. The Frequent Pattern Growth (FPG) algorithm was considered to establish the associations between six climate variables: minimum and maximum temperatures, maximum humidity, sunshine (Sun), rainfall, and evapotranspiration (ET), collected over 26 years in the three agro-ecological Zones of Benin. Monthly climate data were aggregated with yield data over the same period. After aggregation, the data were transformed into 'low', 'medium', and 'high' attributes using the threshold values defined. Then, the rules were generated using the minimum support set to 0.2 and the confidence to 0.8. Only the rules with the consequence 'high yield' were screened. The best yield patterns were observed in the Guinean Zone, followed by the Sudanian. The results indicated that high tomato yield was associated with low ET in all areas considered. Minimum and maximum temperatures, maximum humidity, and Sun were medium in every Zone. Moreover, rainfall was high in the Sudanian Zone, unlike the other regions where it remained medium. These results are useful in assessing climate variability's impact on tomato production. Thus, they can help farmers make informed decisions on cultivation practices to optimize production in a changing environment. In addition, the findings of this study can be considered in other regions and adapted to other crops.

Is soilless agriculture feasible for hybrid seed production in tomato (Solanum lycopersicum L.)?

Hydroponics and aeroponics are advanced techniques for cultivating plants under controlled conditions without soil in polyhouses to address soil-related problems. An experiment was designed to evaluate the potentiality of soilless methods over conventional soil-based methods for hybrid seed production of tomatoes. For initial standardization of nutrient solution and pH of the media, six different nutrient solutions viz., Hoagland’s, CPRI, Chikkaballapur, Ethiopia, USDA and Komosa nutrient solutions, were tested, and pH was standardized. The crop performance was superior in Hoagland’s nutrient solution with a pH range of 5.5–6.4. The experiment comprised three methods of production, two parental lines (TAG 1 F and TAG 2 F), and two seed treatments (S1: Control and S2: Thiram @ 2 g kg-1 + chlorpyrifos @3 g kg-1) for hybrid seed production of tomato. A hundred percent survival rate was recorded in a soilless medium, whereas seed treatment increased the percent survival rate by 9% under the conventional system. Soiless method performed better than the conventional method. Aeroponics recorded a higher plant relative growth rate (1.17), fruit weight (124.54 g), total biomass (106.44 g), and seed index (3.95 g). Hydroponics produced a higher number of seeds fruit 1 (98.42), SVI-II (294), and 6% higher protein than the conventional method. The soilless method may open up a new approach for high-quality and year-round healthy hybrid tomato seed production under protected cultivation.

Comparing dry farming of tomatoes across varieties and soil management history

Farmers faced with increasingly limited access to freshwater for irrigation are utilizing dry farming techniques to produce fruit, vegetable, and grain crops. Defined as crop production during a dry season using little or no irrigation, dry farming relies on water stored in the soil and requires specialized soil management, healthy soil biology, and careful selection of crop varieties. We investigated these three factors in a dry-farmed tomato (Solanum lycopersicum) field trial with three indeterminate varieties (Early Girl, Momotaro, and Zapotec) and two determinate genotypes (76R and rmc), the latter serving as a model system for studying the role of arbuscular mycorrhizal (AM) fungi. While five prior years of contrasting surface tillage practices changed soil properties, they did not affect marketable tomato yields or quality, nor affect plant physiology, including plant water use efficiency [intrinsic (WUEi) and long-term (δ13C)], gas exchange, stem water potential (Ψstem), and leaf relative water content (RWC). Early Girl produced a greater number of fruits and fewer non-marketable fruits than Momotaro and Zapotec. Although AM fungi root colonization was very low for both wildtype mycorrhizal genotype 76R and its reduced mycorrhizal mutant rmc, it differed significantly depending on genotype and tillage treatment. 76R produced slightly greater marketable fruit, but physiological responses did not differ significantly between genotypes. This study does not provide field-based evidence that soil chemical and biological changes resulting from no-till influence dry-farmed tomato productivity, while genotype had a clear impact on tomato yield and quality. Field-scale tillage experiments may better capture soil physical changes that affect water availability, especially at depth, and should be examined.

Sodium accumulation vs. nitrate leaching under different fertigation regimes in greenhouse soils in South Uruguay

In greenhouse conditions, soil salinity and N leaching depend on the provision of irrigation, the irrigation water quality and the application of fertilizers and organic amendments. The objective of this study was to quantify and analyze the accumulation and/or leaching process of NO3- and Na+ in greenhouse tomato production in the south region of Uruguay in fine-textured soil under different fertigation regimes. The study was conducted in four tomato crops during 2019/20/21 seasons. Three fertigation regimes were applied. Irrigation volume was the same for all treatments. Drainage was determined by using free drainage lysimeters. Concentration in soil solution and leaching of NO3- and Na+ was measured by monitoring soil solution and drainage solution. Yield, N uptake and N utilization efficiency were determined for each treatment. Soil total drainage was the main factor explaining N and Na+ leaching. The leaching of N ranges from 0 to 23.4 kg N ha-1 per tomato crop with total drainage between 0 and 46.2 % of total irrigation. Drainage necessary to avoid Na+ accumulation was 13 % of total irrigation. This drainage produced 8.4 kg of N leaching per ha-1 during tomato cropping period. Optimizing irrigation is the key factor to the salinity-nitrogen leaching paradox. Irrigation amount and timing should attempt: (1) to avoid excessive irrigation when NO3- concentration in soil solution is high, and (2) to apply leaching irrigation when Na+ concentration in soil solution is high. Soil solution monitoring with suction probes and rapid chemical analysis systems could be a useful tool to identify periods of high risk of N leaching and the right time for leaching irrigation.

Impact of repeated fumigant applications on soil properties, crop yield, and microbial communities in a plastic-mulched tomato production system

Pre-plant soil fumigation is widely applied to control nematodes, soil-borne fungal pathogens, and weeds in vegetable crops. However, most of the research evaluating the effect of fumigants on crop yield and soil microbial communities has been done on single compounds despite growers mainly applying fumigant combinations. We studied the effect of different fumigant combinations (chloropicrin, 1,3-dichloropropene, and metam potassium) on soil properties, crop yield, and the soil bacterial and fungal microbiome for two consecutive years in a plastic-mulched tomato production system in Florida (United States). While combinations of fumigants did not improve plant productivity more than the individual application of these products, application of fumigants with >60 % chloropicrin did significantly increase yield. Fumigant combinations had no significant effect on bacterial diversity, but fumigants with >35 % chloropicrin reduced soil fungal diversity and induced temporary changes in the soil bacterial and fungal community composition. These changes included short-term increases in the relative abundance of Firmicutes and Ascomycota, as well as decreases in other bacterial and fungal taxa. Repeated fumigation reduced network complexity and the relative abundance of several predicted bacterial functions and fungal guilds, particularly after fumigation and at end of harvest (3-months post fumigation). A structural equation model (SEM) showed fumigants not only directly impact crop yield, but they can also indirectly determine variations in plant productivity through effects on the soil microbiome. Overall, this study increases our understanding of the environmental and agricultural impacts of fumigants in a plastic-mulched tomato production system.

Application of Propolis Extracts in Prevention of the Occurrence and Development of Phytophthora infestans in Ecological Agricultural Production of Tomatoes (Solanum lycopersicum)

Organic Agricultural Production is a special system of food production that exists in a rule-based, socially demanding, and environmentally constrained space within wider agriculture. It must meet social standards in key areas, such as sustainable use of natural resources, while minimally impacting local ecosystems throughout the growth cycle. The use of phytopharmaceutical substitutes is a core component, replacing conventional agriculture pesticides which have been shown to damage local ecosystems. In recent years, considerable research effort has been put into discovering alternative natural substitutes with pesticidal and antifungal properties.&#x0D; The aim of this paper is to investigate the effects of propolis extracts on the growth and development of Phytopathological fungi, presenting an alternative to other phytopharmaceutical substitutes.&#x0D; In this paper, the “American” tomato species are used throughout as it represents a common supermarket tomato variety. The following are the conclusions central to this paper: (1) preventative usage of alcoholic extracts controlls the likelihood of development of Phytophthora infestans and its subsequent growth while having a reduced environmental impact (2) a comparison of propolis extracts with other staple organic extracts found improvements in profitability, produce growth speed and energy requirement (3) produce yield was increased with the use of a propolis solution compared to other organic extracts, however, a combined alcoholic extract of propolis was found to have further benefits, specifically in the prevention and neutralization of aphids.

Effects of combined nitrogen and potassium application on cherry tomato production efficiency under deficit irrigation

Appropriate deficit irrigation and nutrient supply are key to efficient agricultural water use in arid and semi–arid regions. An experiment was conducted to evaluate the effects of the combined nitrogen and potassium application on the growth of cherry tomatoes under deficit irrigation across 2021 spring(S) and fall(F). A quadratic orthogonal rotation design with three factors and three levels was adopted, for the following treatments: irrigation levels of W1 (50 % evaporation(Ep)), W2 (75 % Ep), and W3 (100 % Ep); the nitrogen application levels of N1 (S:183.8 kg/ha, F:131.3 kg/ha), N2 (S:367.5 kg/ha, F:262.5 kg/ha), and N3 (S:551.3 kg/ha, F:393.8 kg/ha); and the potassium application levels of K1 (S:98.6 kg/ha, F:70.5 kg/ha), K2 (S:197.3 kg/ha, F:140.9 kg/ha), and K3 (S:295.9 kg/ha, F:211.3 kg/ha). The results revealed that increasing the nitrogen and potassium application significantly promoted the element accumulation in fruits under W1 application, with nitrogen content increasing by 31.6 % and 24.7 %, and potassium content increasing by 25.4 % and 53.7 % in the two study seasons, respectively. When W2 was applied, increased potassium application promoted a 36.2 % and 38.3 % increase in total soluble sugar in the two study seasons, respectively. Nitrate nitrogen residue in the soil showed a downward trend with the deepening of the soil layer. The increased application of nitrogen and potassium enhanced irrigation water use efficiency, but reduced the partial factor productivity of fertilizer. Correlation and path analyses revealed that the application of nitrogen and potassium significantly affected potassium content in fruits, yield, and nitrate nitrogen residue in the 0–15 cm soil layer. The nitrogen and potassium contents in fruits significantly affected yield, with maximum path coefficients of 0.768 and 0.352, respectively. A comprehensive evaluation system consisting of five indicators was constructed, and yield obtained the maximum combined weight of 0.390 and 0.330 in the two seasons, respectively. W2N3K1 exhibited the best balancing in yield, quality, and efficiency based on the TOPSIS model. The proposed strategy offers a theoretical basis for the water–use–efficient and sustainable production of cherry tomatoes in arid and semi–arid regions.

Tomato pest recognition using convolutional neural network in Bangladesh

The tomato is one of the most popular and well-liked veggies among Asians. It is interesting to note that in Bangladesh, it is the second most significant vegetable consumed. Moreover, tomato is served not only as a vegetable, but it is also served as sauce, jam, etc., and used in making different types of cuisines. But the fact is due to the pests, thousands of tons of tomatoes are harmed every year in Bangladesh. The production of tomatoes in Bangladesh is harmed by a number of dangerous pests. We develop a solution to recognize pests at an early stage. Five different pest types, including aphids, red spider mites, whiteflies, looper caterpillars, and thrips, have been studied in this research. To identify tomato pests, we curated image datasets from online and offline repositories and processed them using a convolutional neural network (CNN) model. We used features from CNN layers for three machine learning algorithms: Random Forest (RF), support vector machine (SVM), and K-Nearest Neighbors (K-NN). This comprehensive approach allowed a thorough comparison of these algorithms in tomato pest recognition. For recognizing tomato pests, our methods generate excellent results. The accuracy of our experiment is 95.49% which indicates the successful completion of the experiment.

Prevalence of tomato’s bacterial and fungi diseases in inera farako-ba station in Burkina Faso

In Burkina Faso, plant pathogens constitute constraints on tomato production. This study makes the diagnostic on the majority of diseases at the experimental station in Farako-Bâ. The incidence and severity were evaluated in a expérimental design to evaluate the agronomic performances of 208 tomato accessions. An inventory of fungal and bacterial species was made from symptomatic samples. Morphological characterization was carried out using isolates of the majority species. The following fungal diseases: early blight, Sigatoka blight, corynesporiosis, fusarium wilt and gray mold have been identified with respective incidences of 45%, 34%, 13%, 5% and 3%. Furthermore, bacterial diseases such as bacterial speck, bacterial scab, bacterial canker and bacterial wilt appear on the studied tomato plants with respective prevalences of 58%, 26%, 15% and 1%. The severity of all these diseases on the different accessions gradually evolves until reaching a high number of leaves, stems and fruits. The induced lesions were significantly different between the strains. Given the importance of the disease, molecular characterization of the species is necessary to envisage effective control.

First report of tomato brown rugose fruit virus infecting Solanum lycopersicum in Northeast China.

Tomato (Solanum lycopersicum L.) is an important fruit and vegetable crop with high economic value due to its rich vitamins (Friedman. 2002). Over the past five years, due to tomato brown rugose fruit virus (ToBRFV) infection, the tomato production in many countries and regions in Asia, America and Europe have experienced declines in yield and quality (Salem et al. 2023). ToBRFV is a positive-sense single-stranded RNA virus of the genus Tobamovirus in the family Virgaviridae (Salem et al. 2016). In the field, ToBRFV mainly infects solanaceous crops, including tomato and pepper (Zhang et al. 2022). Symptoms on ToBRFV-infected tomato plants mainly include foliar mottle, vein necrosis, and brown mottled rugose fruit (Alfaro-Fernández et al. 2020, Hamborg et al. 2022, Ma et al. 2021). In April 2023, about 150 tomato plants showing leaf curl, brown patch, and rugose surface on fruits were found in a greenhouse grown with about 500 tomato plants in Huludao City, Liaoning province, China. Two leaves and eight fruits from each of 10 symptomatic tomato plants were sampled and subjected to dot enzyme-linked immunosorbent assay (Dot-ELISA) with an antibody against ToBRFV (LV BAO, Chengdu, China); and all samples tested positive. Sap inoculations were prepared from 0.1 g of ToBRFV-positive tomato leaves via homogenization with 0.01 mol·L-1 PBS (phosphate buffered saline, pH 7.2), which were then inoculated mechanically onto 10 tomato cv. Moneymaker and 10 Nicotiana benthamiana plants at four- to six-leaf stage, respectively. At 10 days post inoculation (dpi), the leaf curl symptoms of all tomato plants were shown, which were consistent with those on greenhouse-infected plants. At 5 dpi, the upper leaves of all N. benthamiana plants showed yellowing and curling symptoms. The results of Dot-ELISA assays revealed that these mechanically inoculated plants were positive for ToBRFV. Total RNAs of inoculated and greenhouse-collected samples were extracted using TRIzolTM reagent and analyzed by reverse-transcription (RT)-PCR with specific primers ToBRFV-FD (5' GTCCCGATGTCTGTAAGGCTTGC) and ToBRFV-RD (5' GCAGGTGCAGAGGACCATTGTAA) for ToBRFV detection, respectively. The results showed that a 680-bp fragment was obtained in all tested samples. Then, primers ToBRFV-F1 (5' GTGTATTTTTTACAACATATACC) and ToBRFV-R1 (5' AACCATTGACTCAGAACTC), ToBRFV-F2 (5' TAGCCAAGAATCACGCATG) and ToBRFV-R2 (5' AGCAGCAATAATCACCGTA), ToBRFV-F3 (GAAAGAGTGGGGACGTTACAACATTCATCGGTAAT) and ToBRFV-R3 (TGGGCCCCTACCGGGGGTTCCGGGGGAATTCGAAT) were used to amplify the full-length sequence of ToBRFV using field-collected samples. The methods of primer design are shown in supplemental file 1. The sequence obtained by Sanger sequencing showed 99.86% nucleotide (nt) identity with ToBRFV-SD isolate (accession no. MT018320.1) from Shandong province, China. The full-length sequence of ToBRFV was uploaded to GenBank database with the accession number OR437354. To our knowledge, this is the first report of ToBRFV infecting tomato in Northeast China.

Combined application of myo-inositol and corn steep liquor enhances seedling growth and cold tolerance in cucumber and tomato.

Low temperatures pose a common challenge in the production of cucumbers and tomatoes, hindering plant growth and, in severe cases, leading to plant death. In our investigation, we observed a substantial improvement in the growth of cucumber and tomato seedlings through the application of corn steep liquor (CSL), myo-inositol (MI), and their combinations. When subjected to low-temperature stress, these treatments resulted in heightened levels of photosynthetic pigments, thereby fostering enhanced photosynthesis in both tomato and cucumber plants. Furthermore, it contributed to a decrease in malondialdehyde (MDA) levels and electrolyte leakage (REP). The effectiveness of the treatment was further validated through the analysis of key gene expressions (CBF1, COR, MIOX4, and MIPS1) in cucumber. Particularly, noteworthy positive outcomes were noted in the treatment involving 0.6 mL L-1 CSL combined with 72 mg L-1 MI. This study provides valuable technical insights into leveraging the synergistic effects of inositol and maize leachate to promote early crop growth and bolster resistance to low temperatures.

Trocas gasosas e produtividade do tomateiro industrial sob diferentes tipos de irrigação e tela não-tecida para cobertura da planta

ABSTRACT This study aimed to evaluate the effects of different colors and management of polypropylene non-woven fabric coverings and two different localized irrigation systems on the physiological characteristics and yield of industrial tomatoes. The experiment was installed in a randomized block design arranged in a split-plot scheme with four replications. Surface and subsurface drip were used in the plots, and five plant cover strategies with non-woven fabric in the subplots: i) without non-woven fabric; ii) coverage with white non-woven fabric; iii) coverage with white non-woven fabric, removed between 30 and 60 days after transplanting the seedlings; iv) coverage with red non-woven fabric; v) coverage with red non-woven fabric, removed between 30 and 60 days after transplanting. Photosynthesis, transpiration, electron transport rate, stomatal conductance, carbon concentration, total fruit yield, and water use efficiency were evaluated. ANOVA and the Scott-Knott test were used. Transpiration is favored by the white non-woven fabric and the stomatal conductance by the white and uninterrupted red one. However, the tomato yield is not influenced by the coverings, except for the red one, removed only between 30 and 60 days after transplanting, which is the worst condition for industrial tomato production. Surface and subsurface irrigation can be used with the same efficiency.

Recent developments in tomato drying techniques: A comprehensive review

AbstractTomatoes, a highly perishable agricultural product, are commonly dried to extend their shelf life. They serve as raw materials in various domains, including direct consumption and as key ingredients in processed foods, functional foods, and nutraceuticals. However, producing dried tomato products with quality attributes equivalent to fresh tomatoes, such as nutrient content, appearance, flavor, texture, and reconstitution properties, poses significant challenges. Several research attempts have been made to evaluate the feasibility of different drying methods for tomatoes. Solar drying, hot air drying, and spray drying are commonly employed techniques, each with its own set of advantages and disadvantages. Conventional solar drying practices often result in extended drying times and undesirable quality parameters. Hence, it is imperative to adopt enhanced solar drying techniques for the large‐scale production of dried tomato products. Additionally, hybrid‐drying approaches can be explored to achieve better quality products with reduced drying times. Pretreatments before drying can also enhance overall drying performance. Combining conventional drying with novel drying methods, precise selection of drying parameters and pretreatments are demonstrated as efficient ways to improve the drying rate while preserving food quality. Modeling the drying process is also critical for designing large‐scale dryers, selecting appropriate drying conditions, maintaining product quality, and process optimization. Therefore, this article aims to provide detailed insight into existing drying methods with their unique features and modeling approaches, which may enable professionals and scientists to choose better and optimized tomato drying method to deliver the highest quality product to consumers.Practical ApplicationsProcessing tomatoes as dried products is a potential area to explore to minimize their postharvest loss. Lack of awareness regarding how to process, what parameters to consider, and which method to employ are hurdles in adopting and popularizing dried tomato products. Hence, it is crucial to consolidate the key findings pertaining to tomato drying from various methods into a unified platform. This will provide valuable guidance to future researchers and enable consumers to make informed decisions when selecting the most suitable drying method. Therefore, this comprehensive review aims to elucidate the current practices in tomato drying, highlighting their potential benefits and limitations.

Potential of Endophytic Fungal Isolates in Improving Productivity and Postharvest Marketable Fruit Qualities of Tomato

In Tanzania, low tomato (Solanum lycopersicum) yield and postharvest marketable fruit qualities remain significant limitations for tomato grower’s profit. Seven endophytic fungal isolates from pyrethrum and Lemongrass leaf and or flowers were evaluated to promote tomato productivity and fruit qualities. The isolates were inoculated by priming the seeds in spore suspension, and the variations in the number of germinated seeds, seedling vigour, yield and fruit qualities were compared across the treatments. It was observed that only three isolates induced more than 50% seed germination. Epf1 and Epl1 isolates showed significant promotion of seed germination (F 0.05 (pdf, 23) = 8.121 and P = 0.001) and seedling vigour. Isolate Epf1 increased fruit number (18.4%) and weight (17%) but reduced fruit size (0.63%); the Epl1 increased fruit size (12%) and reduced fruit number (14.4%). The Epf1 induced delayed fruit ripening, colour development and softening, decaying, and prolonged shelf life by 9 days. These findings indicate that promoting tomato productivity and postharvest marketable fruit qualities is isolate-specific; therefore, it requires diligent screening. Incorporation of the Epf1 isolate through seed priming with fungal spore suspension demonstrated a high potential for increasing tomato productivity and postharvest marketable fruit qualities.

Foliar application of natural zeolites affects the growth and productivity of processing tomato

The foliar application of zeolites has been proven to positively affect plant physiology suggesting that it could improve plant growth, however, this topic has been little studied. Two field trials were carried out (in 2021 and 2022) to study the potential beneficial effect of natural zeolite particle films on processing tomato crops. Natural zeolites i) clinoptinolite + and mordenite (CubZeo) and ii) micronized clinoptinolite (BigZeo) were sprayed onto the plants six times in the central crop cycles. In both trials, BigZeo promoted leaf and fruit dry mass (DM) accumulation, and leaf area from the early crop stage compared to the water-sprayed plants (Control). The final aerial DM of BigZeo plants enhanced more in the year with favourable (+39.2%) (2022) than in that with more stressing thermal conditions (2021) (+12.1%). Concurrently, the marketable yield was improved by + 36% in both years with positive effects also on fruit total soluble solids. Under heat stress, the CubZeo crop showed even lower aerial DM than the Control, however, the marketable yield remained similar due to higher fruit DM and higher incidence of blossom-end-rot (BER) in untreated plants. In 2022, CubZeo promoted DM accumulation, leaf expansion and yield even if to a lesser extent than the BigZeo treatment. In the fruits the concentrations of K, Ca, and Mg rose in zeolite-treated plants. The improved Ca level in the fruits can explain the lower occurrence of BER in the zeolite-treated plants, particularly with CubZeo. Si was observed at the highest level in fruits and stems of BigZeo-treated plants, followed by CubZeo and Control ones. The accumulation of Si could explain the best crop responses elicited by BigZeo, whereas the observed responses did not appear to involve changes in the photosynthetic machinery. However, further and comprehensive investigations are needed to define the zeolite film particle characteristics and the related physiological and nutritional changes in the plants.

Analisis Finansial Usahatani Tomat Di Desa Tumaratas Dua Kecamatan Langowan Barat Kabupaten Minahasa

This research aims to find out whether tomato farming in Tumaratas Dua Village, West Langowan District, Minahasa Regency is financially profitable. The sampling method was carried out by purposive sampling of farmers who harvested in the period June to September 2022. The number of samples taken in this research was 30 respondents. Determining the number of samples in this research was carried out using the Quota Sampling method. The data analysis method is carried out using a quantitative descriptive method by calculating costs, income, income, r/c ratio, break event point (BEP) and sensitivity analysis. Based on the results of financial calculations for tomato farming, it is known that the total production costs are IDR17.343.239/farmer amounting to IDR69.449.803/Ha income of IDR44.811.833/farmer amounting to IDR179.445.893/Ha and income of IDR62.150.628/farmer of IDR248.877.899/Ha in one planting season. The results of the feasibility analysis of tomato farming show an R/C Ratio value of 2.6. This shows that every IDR1 spent by farmers provides a profit of IDR2,6 and well worth the effort. The BEP price value shows the breakeven point at IDR2.139/kg and production BEP shows a breakeven point of 997kg. The total production of tomatoes in this study was 32,465kg/ha and the selling value of tomatoes in this study was IDR5.527/kg. The results of the sensitivity analysis in scenarios I and II show that the R/C ratio is positive &gt;1 and is worth pursuing. The results of the sensitivity analysis for scenario I to a cost increase of 42.63% show an R/C Ratio value of 1.8. The results of the sensitivity analysis of scenario II to a 49% reduction in selling prices show an R/C ratio of 1.3.

Selenium nanoparticles conferred drought tolerance in tomato plants by altering the transcription pattern of microRNA-172 (miR-172), bZIP, and CRTISO genes, upregulating the antioxidant system, and stimulating secondary metabolism.

Drought stress is one of the major limiting factors for the production of tomato in Iran. In this study, the efficiency of selenate and Se nanoparticle (SeNP) foliar application on tomato plants was assessed to vestigate mitigating the risk associated with water-deficit conditions. Tomato plants were treated with SeNPs at the concentrations of 0 and 4mg L-1; after the third sprays, the plants were exposed to water-deficit conditions. The foliar spraying with SeNPs not only improved growth, yield, and developmental switch to the flowering phase but also noticeably mitigated the detrimental risk associated with the water-deficit conditions. Gene expression experiments showed a slight increase in expression of microRNA-172 (miR-172) in the SeNP-treated plants in normal irrigation, whereas miR-172 displayed a downregulation trend in response to drought stress. The bZIP transcription factor and CRTISO genes were upregulated following the SeNP and drought treatments. Drought stress significantly increased the H2O2 accumulation that is mitigated with SeNPs. The foliar spraying with Se or SeNPs shared a similar trend to alleviate the negative effect of drought stress on the membrane integrity. The applied supplements also conferred drought tolerance through noticeable improvements in the non-enzymatic (ascorbate and glutathione) and enzymatic (catalase and peroxidase) antioxidants. The SeNP-mediated improvement in drought stress tolerance correlated significantly with increases in the activity of phenylalanine ammonia-lyase, proline, non-protein thiols, and flavonoid concentrations. SeNPs also improved the fruit quality regarding K, Mg, Fe, and Se concentrations. It was concluded that foliar spraying with SeNPs could mitigate the detrimental risk associated with the water-deficit conditions.

Optimized Tomato Production in Chinese Solar Greenhouses: The Impact of an East–West Orientation and Wide Row Spacing

Experimental studies were conducted on the cultivation of tomatoes (Solanum lycopersicum L.) at Shandong Agricultural University, China, from 2022 to 2023. Three cultivation patterns were designed as follows: a north–south orientation with a row spacing of 1.40 m (NS-1.4m), a north–south orientation with a row spacing of 1.80 m (NS-1.8m) and an east–west orientation with a row spacing of 1.80 m (EW-1.8m). A functional–structural plant model using the open source interactive modeling platform of GroIMP was constructed for the cultivation of tomatoes. The growth of plants as well as the light distribution and light interception capacity of the crop canopy were simulated and analyzed. The impacts of these cultivation patterns on the growth, photosynthetic characteristics, fruit ripening time, quality and yield of tomato plants were analyzed. The studies revealed that compared with the NS-1.4m treatment, the canopy light interception of tomato plants under the NS-1.8m and EW-1.8m treatments increased by 6.08% and 9.80% in a winter–spring crop and 6.80% and 19.76% in an autumn–winter crop, respectively. Their plant height, leaf area, aboveground dry matter accumulation, leaf net photosynthesis rate as well as the lycopene, vitamin C and sugar–acid ratio of the fruit all exhibited increasing trends, while fruit ripening was accelerated. The yield of the NS-1.8m and EW-1.8m treatments increased by 3.92% and 6.18% in a winter–spring crop and 4.17% and 9.78% in an autumn–winter crop, respectively. Structural equation modeling was used to further analyze the data, confirming that the cultivation of an east–west orientation with wide row spacing is beneficial for tomato cultivation in Chinese solar greenhouses. This cultivation pattern maximizes the canopy’s light interception, thus leading to improved fruit quality and yield. Overall, this study provides valuable insights for optimizing the cultivation pattern of solar greenhouse crops.