TCRβ Chain Research Articles

Monoallelic and monogenic Tcrb assembly enforced by Vβ recombination signal sequences and physiological roles for Tcrb repertoire and allelic exclusion

Abstract Monoallelic expression of antigen receptor (AgR) genes is assumed to be critical for the proper selection and function of T and B lymphocytes. V(D)J recombination of Tcrb, Igh, and Igk loci is regulated such that most cells assemble and express functional AgR genes from one allele (allelic exclusion). The V gene segment recombination signal sequences (RSSs) of Tcrb and Igh loci are weak and have been proposed to mediate monoallelic V-to-DJ recombination. To test the role of Vβ RSSs in promoting Tcrb allelic exclusion, we created and studied mice harboring replacements of the DJCβ-distal V2 and -proximal V31 RSSs with the stronger 3′Dβ1 RSS. Here, we show a substantial role for weak Vβ RSSs in limiting: Vβ recombination frequency, biallelic functional Vβ-to-DJβ recombination and biallelic TCRβ expression, and dual TCRβ chain expression encoded by a single Tcrb allele. Our data indicate that weak Vβ RSSs limit Vβ recombination to promote monogenic Tcrb assembly in the time window before feedback inhibition halts Vβ recombination. Given that AgR allelic exclusion is most stringently applied to Tcrb and Igh, whose assembly and expression drives cellular proliferation, we hypothesized that mechanisms directing monoallelic induction of RAG double strand breaks (DSBs) evolved at Tcrb and Igh loci in part to suppress DSBs from entering S phase and forming oncogenic AgR translocations. We find that p53D/D mice with V2 and V31 RSS replacements succumb more rapidly to thymic lymphomas than their p53D/D counterparts, which is consistent with our model. As Vβ RSS replacement mice exhibit dramatic shifts in the Vβ repertoire, we also have begun using them to test relationships between Vβ repertoire and host defense.

MHC Restriction: Where Are We Now?

MHC Restriction: Where Are We Now?

Extensive intrathecal T cell renewal following hematopoietic transplantation for multiple sclerosis.

A recent study of autologous hematopoietic stem cell transplantation (AHSCT) for active relapsing-remitting multiple sclerosis (RRMS) showed efficacy in preventing disease worsening. However, the immunologic basis for efficacy remains poorly defined. Multiple sclerosis pathology is known to be driven by inflammatory T cells that infiltrate the CNS. Therefore, we hypothesized that the preexisting T cell repertoire in the intrathecal compartment of active RRMS participants was ablated and replaced with new clones following AHSCT. T cell repertoires were assessed using high-throughput TCRβ chain sequencing in paired cerebrospinal fluid (CSF) and peripheral blood CD4+ and CD8+ T cells from participants that underwent AHSCT, before and up to 4 years following transplantation. More than 90% of the preexisting CSF repertoire in participants with active RRMS was removed following AHSCT and replaced with clonotypes predominantly generated from engrafted autologous stem cells. Of the preexisting clones in CSF, approximately 60% were also detected in blood before therapy, and concordant treatment effects were observed for clonotypes in both compartments following AHSCT. These results indicate that replacement of the preexisting TCR repertoire in active RRMS is a mechanism for AHSCT efficacy and suggest that peripheral blood could serve as a surrogate for CSF to define mechanisms associated with efficacy in future studies of AHSCT.

TCR Repertoire Diversity of Peripheral PD-1+CD8+ T Cells Predicts Clinical Outcomes after Immunotherapy in Patients with Non-Small Cell Lung Cancer.

T-cell receptor (TCR)-based biomarkers might predict patient response to immune checkpoint blockade (ICB) but need further exploration and validation for that use. We sequenced complementarity-determining region 3 of TCRβ chains isolated from PD-1+ CD8+ T cells to investigate its value for predicting the response to anti-programmed cell death 1 (PD-1)/PD-ligand 1 (PD-L1) therapy in patients with non-small cell lung cancer (NSCLC). Two independent patient cohorts (cohort A, n = 25; cohort B, n = 15) were used as discovery and validation sets, respectively. Pre- and post-ICB peripheral blood samples were collected. In cohort A, patients with high PD-1+ CD8+ TCR diversity before ICB treatment showed better response to ICB and progression-free survival (PFS) compared with patients with low diversity [6.4 months vs. 2.5 months, HR, 0.39; 95% confidence interval (CI), 0.17-0.94; P = 0.021]. The results were validated in cohort B. Pre-ICB PD-1+ CD8+ TCR diversity achieved an optimal Youden's index of 0.81 (sensitivity = 0.87 and specificity = 0.94) for differentiating the ICB response in the merged dataset (cohort A plus cohort B). Patients with increased PD-1+ CD8+ TCR clonality after ICB treatment had longer PFS (7.3 months vs. 2.6 months, HR, 0.26; 95% CI, 0.08-0.86; P = 0.002) than those with decreased clonality. Thus, TCR diversity and clonality in peripheral blood PD-1+ CD8+ T cells may serve as noninvasive predictors of patient response to ICB and survival outcomes in NSCLC.

Optogenetic Tuning of Ligand Binding to The Human T cell Receptor Using The opto-ligand-TCR System.

T cells are one major cell type of the immune system that use their T cell antigen receptor (TCR) to bind and respond to foreign molecules derived from pathogens. The ligand-TCR interaction half-lives determine stimulation outcome. Until recently, scientists relied on mutating either the TCR or its ligands to investigate how varying TCR-ligand interaction durations impacted on T cell activation. Our newly created opto-ligand-TCR system allowed us to precisely and reversibly control ligand binding to the TCR by light illumination. This system uses phytochrome B (PhyB) tetramers as a light-regulated TCR ligand. PhyB can be photoconverted between a binding (ON) and non-binding (OFF) conformation by 660 nm and 740 nm light illumination, respectively. PhyB ON is able to bind to a synthetic TCR, generated by fusing the PhyB interacting factor (PIF) to the TCRβ chain. Switching PhyB to the OFF conformation disrupts this interaction. Sufficiently long binding of PhyB tetramers to the PIF-TCR led to T cell activation as measured by calcium influx. Here, we describe protocols for how to generate the tetrameric ligand for our opto-ligand-TCR system, how to measure ligand-TCR binding by flow cytometry and how to quantify T cell activation via calcium influx.

Dynamic changes of T cell receptor repertoires in patients with hepatitis B virus-related acute-on-chronic liver failure.

T cell-mediated immune injury plays a critical role in the pathogenesis of hepatitis B virus-related acute-on-chronic liver failure (HBV-ACLF). Given the high short-term mortality and crucial role of T cells in the disease progression, it is necessary to investigate the dynamics of T cell clones during HBV-ACLF. The aim of this study was to longitudinally investigate dynamic changes in the composition and perturbation of T cell receptor β (TCRβ) chain repertoires and to determine whether TCR repertoire characteristics were associated with HBV-ACLF patient outcomes. Peripheral blood mononuclear cells (PBMCs) were collected at two time points from 5 HBV-ACLF patients. Global CD4+ and CD8+ T cells were sorted using magnetic beads. TCRβ complementarity-determining region 3 was analyzed by unbiased high-throughput sequencing. During HBV-ACLF, there was a significant decrease in the diversity of T cell repertoires and an increase in proportion of the most 100 abundant clonotypes of CD8 T cells but not CD4. Decreased CD8 repertoire diversity was positively correlated with the reduction of the Model for End-Stage Liver Disease (MELD) score. There was significant clonal expansion in CD8 but not in CD4 T cell repertoires in HBV-ACLF patients during disease progression. Patients with greater clonal expansions in CD8 T cell repertoires may have better outcomes. CD8 TCRβ repertoire diversity may serve as a potential predictive marker for disease outcome.

Extracellular vesicles derived from injured vascular tissue promote the formation of tertiary lymphoid structures in vascular allografts.

Tertiary lymphoid structures (TLS) accumulate at sites of chronic injury where they function as an ectopic germinal center, fostering local autoimmune responses. Vascular injury leads to the release of endothelial‐derived apoptotic exosome‐like vesicles (ApoExo) that contribute to rejection in transplanted organs. The purpose of the study was to evaluate the impact of ApoExo on TLS formation in a model of vascular allograft rejection. Mice transplanted with an allogeneic aortic transplant were injected with ApoExo. The formation of TLS was significantly increased by ApoExo injection along with vascular remodeling and increased levels of antinuclear antibodies and anti‐perlecan/LG3 autoantibodies. ApoExo also enhanced allograft infiltration by γδT17 cells. Recipients deficient in γδT cells showed reduced TLS formation and lower autoantibodies levels following ApoExo injection. ApoExo are characterized by proteasome activity, which can be blocked by bortezomib. Bortezomib treated ApoExo reduced the recruitment of γδT17 cells to the allograft, lowered TLS formation, and reduced autoantibody production. This study identifies vascular injury‐derived extracellular vesicles (ApoExo), as initiators of TLS formation and demonstrates the pivotal role of γδT17 in coordinating TLS formation and autoantibody production. Finally, our results suggest proteasome inhibition with bortezomib as a potential option for controlling TLS formation in rejected allografts.

A TCR β-Chain Motif Biases toward Recognition of Human CD1 Proteins.

High-throughput TCR sequencing allows interrogation of the human TCR repertoire, potentially connecting TCR sequences to antigenic targets. Unlike the highly polymorphic MHC proteins, monomorphic Ag-presenting molecules such as MR1, CD1d, and CD1b present Ags to T cells with species-wide TCR motifs. CD1b tetramer studies and a survey of the 27 published CD1b-restricted TCRs demonstrated a TCR motif in humans defined by the TCR β-chain variable gene 4-1 (TRBV4-1) region. Unexpectedly, TRBV4-1 was involved in recognition of CD1b regardless of the chemical class of the carried lipid. Crystal structures of two CD1b-specific TRBV4-1+ TCRs show that germline-encoded residues in CDR1 and CDR3 regions of TRBV4-1-encoded sequences interact with each other and consolidate the surface of the TCR. Mutational studies identified a key positively charged residue in TRBV4-1 and a key negatively charged residue in CD1b that is shared with CD1c, which is also recognized by TRBV4-1 TCRs. These data show that one TCR V region can mediate a mechanism of recognition of two related monomorphic Ag-presenting molecules that does not rely on a defined lipid Ag.

T cell receptor specificity drives accumulation of a reparative population of regulatory T cells within acutely injured skeletal muscle

Foxp3+CD4+ regulatory T cells (Tregs) play important roles in controlling both homeostatic processes and immune responses at the tissue and organismal levels. For example, Tregs promote muscle regeneration in acute or chronic injury models by direct effects on local muscle progenitor cells, as well as on infiltrating inflammatory cells. Muscle Tregs have a transcriptome, a T cell receptor (TCR) repertoire, and effector capabilities distinct from those of classical, lymphoid-organ Tregs, but it has proven difficult to study the provenance and functions of these unique features due to the rarity of muscle Tregs and their fragility on isolation. Here, we attempted to sidestep these hindrances by generating, characterizing, and employing a line of mice carrying rearranged transgenes encoding the TCRα and TCRβ chains from a Treg clone rapidly and specifically expanded within acutely injured hindlimb muscle of young mice. Tregs displaying the transgene-encoded TCR preferentially accumulated in injured hindlimb muscle in a TCR-dependent manner both in the straight transgenic model and in adoptive-transfer systems; non-Treg CD4+ T cells expressing the same TCR did not specifically localize in injured muscle. The definitive muscle-Treg transcriptome was not established until the transgenic Tregs inhabited muscle. When crossed onto the mdx model of Duchenne muscular dystrophy, the muscle-Treg TCR transgenes drove enhanced accumulation of Tregs in hindlimb muscles and improved muscle regeneration. These findings invoke the possibility of harnessing muscle Tregs or their TCRs for treatment of skeletal muscle pathologies.

High-throughput sequencing of CD4+ T cell repertoire reveals disease-specific signatures in IgG4-related disease

BackgroundCD4+ T cells play critical roles in the pathogenesis of IgG4-related disease (IgG4-RD). The aim of this study was to investigate the TCR repertoire of peripheral blood CD4+ T cells in IgG4-RD.MethodsThe peripheral blood was collected from six healthy controls and eight IgG4-RD patients. TCR β-chain libraries of CD4+ T cells were constructed by 5′-rapid amplification of cDNA ends (5′-RACE) and sequenced by Illumina Miseq platform. The relative similarity of TCR repertoires between samples was evaluated according to the total frequencies of shared clonotypes (metric F), correlation of frequencies of shared clonotypes (metric R), and total number of shared clonotypes (metric D).ResultsThe clonal expansion and diversity of CD4+ T cell repertoire were comparable between healthy controls and IgG4-RD patients, while the proportion of expanded and coding degenerated clones, as an indicator of antigen-driven clonal expansion, was significantly higher in IgG4-RD patients. There was no significant difference in TRBV and TRBJ gene usage between healthy controls and IgG4-RD patients. The complementarity determining region 3 (CDR3) length distribution was skewed towards longer fragments in IgG4-RD. Visualization of relative similarity of TCR repertoires by multi-dimensional scaling analysis showed that TCR repertoires of IgG4-RD patients were separated from that of healthy controls in F and D metrics. We identified 11 IgG4-RD-specific CDR3 amino acid sequences that were expanded in at least 2 IgG4-RD patients, while not detected in healthy controls. According to TCR clonotype networks constructed by connecting all the CDR3 sequences with a Levenshtein distance of 1, 3 IgG4-RD-specific clusters were identified. We annotated the TCR sequences with known antigen specificity according to McPAS-TCR database and found that the frequencies of TCR sequences associated with each disease or immune function were comparable between healthy controls and IgG4-RD patients.ConclusionAccording to our study of CD4+ T cells from eight IgG4-RD patients, TCR repertoires of IgG4-RD patients were different from that of healthy controls in the proportion of expanded and coding degenerated clones and CDR3 length distribution. In addition, IgG4-RD-specific TCR sequences and clusters were identified in our study.

CDR3αdrives selection of the immunodominant Epstein Barr virus (EBV) BRLF1-specific CD8 T cell receptor repertoire in primary infection.

The T cell receptor (TCR) repertoire is an essential component of the CD8 T-cell immune response. Here, we seek to investigate factors that drive selection of TCR repertoires specific to the HLA-A2-restricted immunodominant epitope BRLF1109-117 (YVLDHLIVV) over the course of primary Epstein Barr virus (EBV) infection. Using single-cell paired TCRαβ sequencing of tetramer sorted CD8 T cells ex vivo, we show at the clonal level that recognition of the HLA-A2-restricted BRLF1 (YVL-BR, BRLF-1109) epitope is mainly driven by the TCRα chain. For the first time, we identify a CDR3α (complementarity determining region 3 α) motif, KDTDKL, resulting from an obligate AV8.1-AJ34 pairing that was shared by all four individuals studied. This observation coupled with the fact that this public AV8.1-KDTDKL-AJ34 TCR pairs with multiple different TCRβ chains within the same donor (median 4; range: 1–9), suggests that there are some unique structural features of the interaction between the YVL-BR/MHC and the AV8.1-KDTDKL-AJ34 TCR that leads to this high level of selection. Newly developed TCR motif algorithms identified a lysine at position 1 of the CDR3α motif that is highly conserved and likely important for antigen recognition. Crystal structure analysis of the YVL-BR/HLA-A2 complex revealed that the MHC-bound peptide bulges at position 4, exposing a negatively charged aspartic acid that may interact with the positively charged lysine of CDR3α. TCR cloning and site-directed mutagenesis of the CDR3α lysine ablated YVL-BR-tetramer staining and substantially reduced CD69 upregulation on TCR mutant-transduced cells following antigen-specific stimulation. Reduced activation of T cells expressing this CDR3 motif was also observed following exposure to mutated (D4A) peptide. In summary, we show that a highly public TCR repertoire to an immunodominant epitope of a common human virus is almost completely selected on the basis of CDR3α and provide a likely structural basis for the selection. These studies emphasize the importance of examining TCRα, as well as TCRβ, in understanding the CD8 T cell receptor repertoire.

Optimized IGH Chain Sequencing for Detection of Very Low Frequency B Cell Malignancies from RNA or DNA Input

Background High throughput sequencing (HTS) of rearranged TCRB and IGH chains has been demonstrated as a means to detect malignant T and B cells at a frequency as low as 10E-6. However, onerous input requirements (typically 20-30ug gDNA input over multiple library preparations) have impeded widespread adoption of 10E-6 as a threshold for minimal residual disease (MRD) translational research studies. Here we demonstrate an optimized highly multiplex PCR approach for amplifying IGH chains from fresh or FFPE-preserved RNA or DNA input material. Coupled with automated clonotyping and clonal lineage detection, we demonstrate detection of malignant B cell clones at a frequency of 10E-6 from a single library preparation. Methods Rearranged IGH chains were amplified using multiplex framework 3 and joining gene primers targeting all human IGH variable and joining gene alleles in the IMGT database (Oncomine IGH-SR assay). Libraries were generated from 25 or 100ng total RNA or 2ug gDNA derived from (1) peripheral blood leukocyte (PBL) or bone marrow (BM) spiked with Ramos B-cell cell line and (2) PBL or BM spiked with synthesized chronic lymphocytic leukemia (CLL) rearrangements from literature. Sequencing analysis was performed using the Gene Studio S5 and Ion Reporter to identify clonotypes, track clones across samples, and identify B cell clonal lineages. Clonal lineages were defined such that lineage members have a shared variable and joining gene identity, identical CDR3 lengths, and CDR3NT sequences within 85% similarity of other lineage members. Automated rarefaction analysis in Ion Reporter was used to determine optimal sequencing depth. Results Ramos and synthesized spike in controls were detected at a frequency of 10E-5 using 25ng of PBL total RNA and sequencing to 3M reads depth, and 10E-6 using 100ng input and 10M reads depth. gDNA-based libraries required 2ug and 3M reads depth to detect spike-in rearrangements at a frequency of 10E-5, while 10E-6 was achieved by combining the results from four 2ug gDNA libraries, each sequenced to 3M reads depth. Input and sequencing depth requirements were consistent across PBL or bone marrow derived libraries. Rarefaction analysis confirmed that the sequencing depth was appropriate for the targeted limit of detection. Conclusions These results demonstrate routine detection of B cell malignancy IGH chains at a frequency of 10E-6 using a limited amount of RNA or DNA material, comparing favorably to existing HTS-based approaches. We anticipate this approach to become a routine component of rare clone tracking applications including those involving B-ALL and CLL, particularly where sample material is limited or a low limit of detection is of paramount importance. Disclosures Looney: Thermo Fisher Scientific: Employment. Toro:Thermo Fisher Scientific: Employment. Lowman:Thermo Fisher Scientific: Employment. Chang:Thermo Fisher Scientific: Employment. Pickle:Thermo Fisher Scientific: Employment. Topacio-Hall:Thermo Fisher Scientific: Employment. Hyland:Thermo Fisher Scientific: Employment.

Determination of a T cell receptor of potent CD8+ T cells against simian immunodeficiency virus infection in Burmese rhesus macaques

Cumulative studies on human immunodeficiency virus (HIV)-infected individuals have shown association of major histocompatibility complex class I (MHC-I) polymorphisms with lower viral load and delayed AIDS progression, suggesting that HIV replication can be controlled by potent CD8+ T-cell responses. We have previously established an AIDS model of simian immunodeficiency virus (SIV) infection in Burmese rhesus macaques and found a potent CD8+ T cell targeting the Mamu-A1*065:01-restricted Gag241-249 epitope, which is located in a region corresponding to the HIV Gag240-249 TW10 epitope restricted by a protective MHC-I allele, HLA-B*57. In the present study, we determined a T cell receptor (TCR) of this Gag241-249 epitope-specific CD8+ T cell. cDNA clones encoding TCR-α and TCR-β chains were obtained from a Gag241-249-specific CD8+ T-cell clone. Coexpression of these TCR-α and TCR-β cDNAs resulted in reconstitution of a functional TCR specifically detected by Gag241-249 epitope-Mamu-A1*065:01 tetramer. Two of three previously-reported CD8+ T-cell escape mutations reduced binding affinity of Gag241-249 peptide to Mamu-A1*065:01 but the remaining one not. This is consistent with the data obtained by molecular modeling of the epitope-MHC-I complex and TCR. These results would contribute to understanding how viral CD8+ T-cell escape mutations are selected under structural constraint of viral proteins.

Low-grade glioma harbors few CD8 T cells, which is accompanied by decreased expression of chemo-attractants, not immunogenic antigens

In multiple tumor types, prediction of response to immune therapies relates to the presence, distribution and activation state of tumor infiltrating lymphocytes (TILs). Although such therapies are, to date, unsuccessful in gliomas, little is known on the immune contexture of TILs in these tumors. We assessed whether low and high-grade glioma (LGG and HGG, grade II and IV respectively) differ with respect to number, location and tumor reactivity of TILs; as well as expression of molecules involved in the trafficking and activation of T cells. Intra-tumoral CD8 T cells were quantified by flow cytometry (LGG: n = 12; HGG: n = 8) and immunofluorescence (LGG: n = 28; HGG: n = 28). Neoantigen load and expression of Cancer Germline Antigens (CGAs) were assessed using whole exome sequencing and RNA-seq. TIL-derived DNA was sequenced and the variable domain of the TCRβ chain was classified according to IMGT nomenclature. QPCR was used to determine expression of T cell-related genes. CD8 T cell numbers were significantly lower in LGG and, in contrast to HGG, mainly remained in close vicinity to blood vessels. This was accompanied by lower expression of chemo-attractants CXCL9, CXCL10 and adhesion molecule ICAM1. We did not observe a difference in the number of expressed neoantigens or CGAs, nor in diversity of TCR-Vβ gene usage. In summary, LGG have lower numbers of intra-tumoral CD8 T cells compared to HGG, potentially linked to decreased T cell trafficking. We have found no evidence for distinct tumor reactivity of T cells in either tumor type. The near absence of TILs in LGG suggest that, at present, checkpoint inhibitors are unlikely to have clinical efficacy in this tumor type.

1228P - The mutant neoantigen specific T cell is a personalized immunotherapy in refractory solid tumour

BackgroundImmune checkpoint inhibitors are an important therapy. However, their essence is nonspecific and efficiency of single usage is not satisfactory. The mutant neoantigen specific T (Nas-T) cell, as an adoptive cell treatment, is a specific immunotherapy for each individual. Our previous research has proved that the combined immunotherapy of mutant Nas-T cell and PD1 antibody is more effective than PD1 alone in prolonging PFS (World Conference on Lung Cancer 2018). We aim to evaluate the characteristics of the immune repertoire (IR) as a predictive biomarker for immunotherapy and to construct personalized and specific TCR-T. Methods14 patients with advanced solid tumors who failed after multiline treatments were recruited. They were divided into durable clinical benefit (complete response, partial response or stable disease for more than 3 months) and non-durable clinical benefit (DCB and NCB) based on PFS. Peripheral blood was collected at baseline and each cycle. IR-seq of the CDR3 regions of human TCRβ chains was used to interrogate the TCRs frequency. We used single neoantigen to stimulate the infused T cells and performed RNAseq for the sorted CD137(+) cells to obtain the full-length TCR α and β chain. Lastly, we constructed TCR-T cells via transfecting the TCR α/β pair into the T cells of patients and co-cultured with neoantigen to analyze the functionality of TCRs. ResultsAfter neoantigen pulsing, the clonality of infused T cells pool significantly increased (P=0.0001), suggesting some tumor-specific T-cells were expanded and enriched after neoantigen pulsing. Compared to baseline, T-cell repertoire of NCB and DCB after 1st cycle displayed significant changes: Shannon 1.19 vs 0.97 (P=0.002); clonality 0.68 vs 1.19 (P=0.001). Elevated clonality may indicate expanded tumor-specific T-cells which could recognize mutant neoantigen specifically. Besides, based on the in vitro TCR-T experiments, the constructed TCR-T cells can specifically recognize the mutant neoantigen and lyse the target cells expressing the corresponding neoantigen.Table1228PTableNeoantigen SequenceHLA-I typingTCR VαTCR VβGene nameSequence*All V Hits With Score#Clonal Sequence#All V Hits With Score#Clonal Sequence#MTAP/SPINK1 Fused GeneVLLPRHMKVA0201TRAV35 (574.6)TGTGCTGGGTATGGCTCTAGCAA CACAGGCAAACTAATCTTTTRBV19 (646.8)TGTGCCAGTCGGACAGGGGGA TCACCCCTCCACTTTFERNYVSNVSKFA2301TRAV29DV5 (667.6)TGTGCAGCTTCAACTGGGGCAAA CAACCTCTTCTTTTRBV7-2 (626.7)TGTGCCAGCACCTCTGCCCCC TCCTACGAGCAGTACTTCSPINK1FLLSALALLB4403TRAV20 (589.1)TGTGCTGTTCCCCTGGGAACAGG CTTTCAGAAACTTGTATTT (response to neoantigen)TRBV21-1 (557.8)TGTGCCAGCAGCAAAGACCCT AGCGGGAATCAAGAGACCCAGTACTTCCLCN6ALIGAAASLB6701TRAV19 (612.4)TGTGCTCTTCTGAATTATGGTGGTGC TACAAACAAGCTCATCTTTTRBV6-5 (675.4)TGTGCCAGCAGTGGGACAGCCAATGA GCAGTTCTTC (response to neoantigen)MTAPAESFMFRTWC0401TRAV38-2DV8 (658.4)TGTGCTTATTGGGAGCTTGTCTCTGGGG CTGGGAGTTACCAACTCACTTTCTRBV5-1 (637.6)TGCGCCAGCAGCTTGACTAGCGGGGGG TTCTACGAGCAGTACTTCTAP1RLSLFLALVC0702TRAV16 (622.2)TGTGCTCCCTGGGCCCTAGGAGGAGG TGCTGACGGACTCACCTTTTRBV30 (403.4)TGTGCCTGGAGTGTAACAGGGGGC AAAGCAGATACGCAGTATTTTMAN2C1FLQGRNFFL ConclusionsThe mutant Nas-T cell is a personalized immunotherapy. IR is a potential predictive biomarker. Legal entity responsible for the studyShunchang Jiao. FundingHas not received any funding. DisclosureAll authors have declared no conflicts of interest.

1420P - Automated rarefaction analysis for precision B and T cell receptor repertoire profiling from peripheral blood and FFPE-preserved tumour

BackgroundIdentifying the optimal input amount and sequencing depth for B and T cell receptor repertoire profiling is challenging owing to variation in material quality and lymphocyte diversity in blood and FFPE preserved tumor specimens. Rarefaction analysis has emerged as a potential approach for assessing whether immune repertoire libraries have been sequenced to saturation. Here we present a novel automated method for saturation analysis of IGH and TCRB chain libraries derived from sequencing of peripheral blood leukocytes (PBL) and FFPE-preserved tumor RNA and DNA. MethodsHuman TCRB and IGH repertoire libraries were generated using the Oncomine TCRB and IGH assays from: (1) 25ng PBL total RNA (2) 500ng PBL gDNA (3) 150ng RNA from FFPE preserved NSCLC and (4) 200ng gDNA from FFPE preserved brain tissue. Libraries were sequenced on the Ion Torrent Gene Studio S5 then analyzed with Ion Reporter to identify clonotypes, quantify clonal expansion and diversity, and for IGH chain libraries, identify B cell clonal lineages and assess isotype usage. We then repeated clonotyping and analysis of secondary repertoire features using data that had been downsampled to fixed read depths. ResultsWe observed an asymptotic relationship between the sequencing depth and the number of B and T cell clones detected, clone Shannon diversity, and B cell clonal lineage richness and diversity, indicating that libraries had been sequenced to saturation. By contrast, T and B cell normalized Shannon entropy appeared robust to sequencing depth. ConclusionsAutomated downsampling analysis may serve as a convenient tool for optimizing sequencing depth and input amount for B and T cell repertoire sequencing studies. We expect this approach to become a routine component of immune repertoire analysis. Legal entity responsible for the studyThermo Fisher Scientific. FundingThermo Fisher Scientific. DisclosureL. Quagliata: Full / Part-time employment: Thermo Fisher Scientific. T. Looney: Full / Part-time employment: Thermo Fisher Scientific. D. Topacio-Hall: Full / Part-time employment: Thermo Fisher Scientific. G. Lowman: Full / Part-time employment: Thermo Fisher Scientific.

Inherent reactivity of unselected TCR repertoires to peptide-MHC molecules

The repertoire of αβ T cell antigen receptors (TCRs) on mature T cells is selected in the thymus where it is rendered both self-tolerant and restricted to the recognition of major histocompatibility complex molecules presenting peptide antigens (pMHC). It remains unclear whether germline TCR sequences exhibit an inherent bias to interact with pMHC prior to selection. Here, we isolated TCR libraries from unselected thymocytes and upon reexpression of these random TCR repertoires in recipient T cell hybridomas, interrogated their reactivities to antigen-presenting cell lines. While these random TCR combinations could potentially have reacted with any surface molecule on the cell lines, the hybridomas were stimulated most frequently by pMHC ligands. The nature and CDR3 loop composition of the TCRβ chain played a dominant role in determining pMHC-reactivity. Replacing the germline regions of mouse TCRβ chains with those of other jawed vertebrates preserved reactivity to mouse pMHC. Finally, introducing the CD4 coreceptor into the hybridomas increased the proportion of cells that could respond to pMHC ligands. Thus, αβ TCRs display an intrinsic and evolutionary conserved bias for pMHC molecules in the absence of any selective pressure, which is further strengthened in the presence of coreceptors.

Mucosal-Associated Invariant T Cells Expressing the TRAV1-TRAJ33 Chain Are Present in Pigs.

Mucosal-associated invariant T (MAIT) cells are a subpopulation of evolutionarily conserved innate-like T lymphocytes bearing invariant or semi-invariant TCRα chains paired with a biased usage of TCRβ chains and restricted by highly conserved monomorphic MHC class I-like molecule, MR1. Consistent with their phylogenetically conserved characteristics, MAIT cells have been implicated in host immune responses to microbial infections and non-infectious diseases, such as tuberculosis, typhoid fever, and multiple sclerosis. To date, MAIT cells have been identified in humans, mice, cows, sheep, and several non-human primates, but not in pigs. Here, we cloned porcine MAIT (pMAIT) TCRα sequences from PBMC cDNA, and then analyzed the TCRβ usage of pMAIT cells expressing the TRAV1-TRAJ33 chain, finding that pMAIT cells use a limited array of TCRβ chains (predominantly TRBV20S and TRBV29S). We estimated the frequency of TRAV1-TRAJ33 transcripts in peripheral blood and tissues, demonstrating that TRAV1-TRAJ33 transcripts are expressed in all tested tissues. Analysis of the expression of TRAV1-TRAJ33 transcripts in three T-cell subpopulations from peripheral blood and tissues showed that TRAV1-TRAJ33 transcripts can be expressed by CD4+CD8−, CD8+CD4−, and CD4−CD8− T cells. Using a single-cell PCR assay, we demonstrated that pMAIT cells with the TRAV1-TRAJ33 chain express cell surface markers IL-18Rα, IL-7Rα, CCR9, CCR5, and/or CXCR6, and transcription factors PLZF, and T-bet and/or RORγt. In conclusion, pMAIT cells expressing the TRAV1-TRAJ33 chain have characteristics similar to human and mouse MAIT cells, further supporting the idea that the pig is an animal model for investigating MAIT cell functions in human disease.

T Cell Receptor Immune Repertoires Are Promptly Reconstituted After Methicillin-Resistant Staphylococcus aureus Infection

T cells represent a subset of lymphocytes characterized by immunosurveillance and immunoregulation function. Peripheral blood mononuclear cells (PBMCs) are enriched in T cells, which exert critical antimicrobial roles in infectious diseases. High-throughput sequencing of the T cell receptor (TCR) provides deep insight into monitoring the immune microenvironment. Flow cytometry was used to analyse the distribution of αβ/γδ T cells and their CD69, IFN-γ/IL-17 expression from PBMCs. Here, we utilized next-generation sequencing (NGS) to detect the complementarity determining region 3 (CDR3) of TCRβ (TRB) and TCRδ (TRD) chain after methicillin-resistant Staphylococcus aureus (MRSA) infection. Our data demonstrated a significant increase in the activation of αβ and γδ T cells after MRSA infection. Simultaneously, significantly high CDR3 amino acid (AA) diversity and markedly reconstituted TCR immune repertoires were observed after MRSA infection. Finally, we identified several MRSA-specific initial CDR3 AA motifs after MRSA infection. Our work reveals the profiles of TRB and TRD immune repertoires in response to MRSA and demonstrates a reconstitution of the TCR immune repertoire after MRSA infection.

Abstract 1347: Peripheral blood TCRB chain convergence in chronic viral infection and cancer: Emerging trends from a novel immune repertoire biomarker

Abstract Background T cell receptor (TCR) convergence refers to the phenomenon whereby antigen-driven selection enriches for TCRs having shared antigen specificity but different nucleotide sequences. Previous work has demonstrated the potential utility of TCR convergence as a predictive biomarker for response to checkpoint blockade and dendritic cell based immunotherapy for cancer. The extent to which convergence arises owing to chronic viral infection is not yet established. Here we sought to identify features of chronic cytomegalovirus (CMV) infection using TCRB profiling of peripheral blood (PBL) total RNA. Methods Total RNA from PBL was obtained from 35 blood donors of known CMV status, then used for TCRB sequencing via the Oncomine TCRB-LR assay (amplicon spanning CDR 1, 2 and 3) and the Ion Torrent S5. In parallel, we prepared libraries via the Oncomine TCRB-SR assay (CDR3 only). Data were used to identify TCRB repertoire features correlated with CMV status and compare repertoire features across the two assays. For context, we compare CMV-related convergence to previous reports detailing convergent T cell responses in individuals with cancer. Results T cell clone evenness was reduced in CMV positive individuals irrespective of age, predictive of CMV status (AUC=.86, p=2E-4, Wilcoxon), and strongly correlated between LR and SR assays (Spearman cor=.96). TCR convergence was elevated in CMV positive individuals and uncorrelated with evenness (Spearman cor = -.03) such that the combination of convergence and evenness improved the performance of a logistic regression classifier (AUC= .93). Conclusions We identify reduced T cell evenness and elevated TCR convergence as features of chronic CMV infection. CMV infection appears to significantly alter the T cell repertoire, suggesting that CMV status may be required for proper interpretation of T cell expansion in the context of immunotherapy for cancer. TCR convergence may detect T cell responses to a broad range of viral and tumor neoantigens and thus may serve as a particularly useful biomarker for the identification of immunogenic tumors having few genetic alterations. Citation Format: Timothy J. Looney. Peripheral blood TCRB chain convergence in chronic viral infection and cancer: Emerging trends from a novel immune repertoire biomarker [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2019; 2019 Mar 29-Apr 3; Atlanta, GA. Philadelphia (PA): AACR; Cancer Res 2019;79(13 Suppl):Abstract nr 1347.