• All Solutions All Solutions Caret
    • Editage

      One platform for all researcher needs

    • Paperpal

      AI-powered academic writing assistant

    • R Discovery

      Your #1 AI companion for literature search

    • Mind the Graph

      AI tool for graphics, illustrations, and artwork

    • Journal finder

      AI-powered journal recommender

    Unlock unlimited use of all AI tools with the Editage Plus membership.

    Explore Editage Plus
  • Support All Solutions Support
    discovery@researcher.life
Discovery Logo
Sign In
Paper
Search Paper
Cancel
Pricing Sign In
  • My Feed iconMy Feed
  • Search Papers iconSearch Papers
  • Library iconLibrary
  • Explore iconExplore
  • Ask R Discovery iconAsk R Discovery Star Left icon
  • Chat PDF iconChat PDF Star Left icon
  • Chrome Extension iconChrome Extension
    External link
  • Use on ChatGPT iconUse on ChatGPT
    External link
  • iOS App iconiOS App
    External link
  • Android App iconAndroid App
    External link
  • Contact Us iconContact Us
    External link
Discovery Logo menuClose menu
  • My Feed iconMy Feed
  • Search Papers iconSearch Papers
  • Library iconLibrary
  • Explore iconExplore
  • Ask R Discovery iconAsk R Discovery Star Left icon
  • Chat PDF iconChat PDF Star Left icon
  • Chrome Extension iconChrome Extension
    External link
  • Use on ChatGPT iconUse on ChatGPT
    External link
  • iOS App iconiOS App
    External link
  • Android App iconAndroid App
    External link
  • Contact Us iconContact Us
    External link

Related Topics

  • Desirable Products
  • Desirable Products
  • Single Product
  • Single Product
  • Production Scheme
  • Production Scheme
  • Fast Production
  • Fast Production

Articles published on Target Products

Authors
Select Authors
Journals
Select Journals
Duration
Select Duration
10122 Search results
Sort by
Recency
  • New
  • Research Article
  • 10.1186/s40643-025-00985-3
Techno-economic analysis of industrial-scale fermentation for formate dehydrogenase (FDH) production
  • Dec 6, 2025
  • Bioresources and Bioprocessing
  • Julia Cunniffe + 7 more

The conversion of carbon dioxide (CO2) into formate offers a promising route to enable a circular, carbon-smart bioeconomy. Formate is increasingly recognized as a versatile and energy-dense platform molecule that can serve as a feedstock for microbial fermentation, energy storage, and sustainable chemical and fuel production. A key bottleneck in this value chain is the availability of cost-effective and scalable formate dehydrogenase (FDH), which catalyze the initial reduction of CO2 to formate. However, little is known about the economic feasibility of producing and purifying FDH at industrial scale. In this study, we developed data-driven techno-economic models to assess the production cost of FDH in Methylorubrum extorquens (M. extorquens) using lab-scale data and projected outcomes across four scenarios: 1 L empirical, 5 L empirical, base, and optimistic. Our results show that the minimum selling price when using FDH as a crude protein preparation ranged from $2300/kg (1 L empirical) to $75/kg (optimistic), while the use of purified FDH resulted in costs ranging from $99,000/kg to $970/kg, respectively. Sensitivity analyses revealed that protein purity has the greatest influence on final production cost, with substrate and electricity costs also contributing significantly to the two empirical scenarios. These findings provide insight into cost bottlenecks and help identify engineering targets for scaling FDH enzyme production, supporting the development of CO2-to-formate technologies and the broader formate-based bioeconomy.Graphical abstract

  • New
  • Research Article
  • 10.1186/s12879-025-12278-3
Prospective evaluation of 2nd generation rapid diagnostic tests for the serological diagnosis of gambiense human African trypanosomiasis in the Democratic Republic of the Congo.
  • Dec 6, 2025
  • BMC infectious diseases
  • Sara Tablado Alonso + 13 more

Accurate diagnosis is essential for achieving the 2030 goal of eliminating gambiense human African trypanosomiasis (gHAT) transmission. In recent years, novel screening and confirmatory laboratory tests, including rapid diagnostic tests incorporating recombinant antigens (2nd generation RDTs), an inhibition ELISA (iELISA) and RT-qPCR, have been developed. However, data on their diagnostic performance remain limited. This study aimed to evaluate the specificity of these newly developed tests, with particular emphasis on 2nd generation RDTs. During routine mobile team screening rounds in the Democratic Republic of the Congo, all consenting individuals aged ≥ 12 years provided a venous blood sample to screen for gHAT by Card Agglutination Test for Trypanosomiasis (CATT) and three RDTs (Abbott Bioline HAT 2.0, HAT Sero K-SeT and HAT Sero K-SeT 2.0). The remaining blood samples were shipped to the Institut National de Recherche Biomédicale, for further testing by iELISA, immune trypanolysis and RT-qPCR. gHAT cases were defined by the direct visualization of trypanosomes in blood or lymph. A total of 1503 participants were recruited in the Kwilu and Lomami provinces. Among the screening tests, CATT demonstrated the highest specificity at 98.3% (95% CI 97.6-99.0%). followed by HAT Sero K-SeT at 91.0% (95% CI 89.5-92.4%), HAT Sero K-SeT 2.0 at 87.1% (95% CI 85.4-88.8%) and Abbott Bioline HAT 2.0 at 76.4% (95% CI 74.3-78.6%). Among the laboratory tests, immune trypanolysis achieved a specificity of 97.8% (95% CI 97.1-98.6%) while iELISA reached 96.1% (95% CI 95.1-97.1%). RT-qPCR had the highest specificity at 99.9% (95% CI 99.7-100%). None of the RDTs met the 95% specificity threshold as recommended by the WHO target product profiles for gHAT, emphasizing the need for further improvements in their specificity. The trial was retrospectively registered under NCT05637632 in clinicaltrials.gov on November 24, 2022.

  • New
  • Research Article
  • 10.15407/polymerj.47.04.191
Synthesis, structure, and performance characteristics of adhesives based on alkyl acrylates with different cross-linkers
  • Dec 4, 2025
  • Polymer journal
  • Olga Slisenko + 3 more

New acrylate adhesive materials with increased adhesion ability and a wide temperature range were synthesized through photoinitiated radical polymerization. Low-molecular trifunctional trimethylolpropane triacrylate (TMPTA) or bifunctional oligoetherurethane dimethacrylate (OUA) that allow for adjusting the structural features and adhesive properties of the target products, were used as crosslinking agents. The complete conversion of C=C bonds of acrylic monomers, as indicated by the disappearance of characteristic absorption bands of double bonds (C=C) in the range of 1638–1621, 1406 cm−1, was confirmed by FTIR spectroscopy. The multiphase structure of synthesized copolymers was confirmed by the presence of low-temperature relaxation transitions, which are essential for maintaining the main characteristics of the materials across a wide temperature range (at least down to −20 °C). The Tg of acrylate adhesives synthesized using OUA is lower than that of similar adhesives made with TMPTA, indicating greater flexibility of the chains and resulting in more elastic adhesive materials. Replacing the crosslinking agent with TMPTA increases the Tg to −42.8 °C by shortening the segments between the crosslinking nodes, resulting in more rigid polymer chains of the acrylate copolymer. It is found that the thermooxidative behavior of the synthesized copolymer matrices is highly dependent on their structure. Specifically, the presence of a COOH-containing monomer causes the matrix to start degrading at lower temperatures, but the rate of destruction decreases significantly afterward compared to matrices containing exclusively acrylates with hydrocarbon substituents. The created adhesives demonstrate high adhesion rates through the method of uniform layering on various types of model surfaces, including those with applied artificial sweat. It is shown that the best adhesive samples exhibit improved performance indicators comparable to those of top commercial adhesive products of this type.

  • New
  • Research Article
  • 10.1016/j.ijfoodmicro.2025.111438
Managing Shiga toxin-producing Escherichia coli (STEC) risk in beef: how lack of data impairs risk analysis.
  • Dec 2, 2025
  • International journal of food microbiology
  • Simone Belluco + 7 more

Managing Shiga toxin-producing Escherichia coli (STEC) risk in beef: how lack of data impairs risk analysis.

  • New
  • Research Article
  • 10.1016/j.foodchem.2025.146277
Whole-process biomimetic synthesis of melanin-like amino acid surfactants by 2-iodoxybenzoic acid mediated regioselective oxidation of pterostilbene.
  • Dec 1, 2025
  • Food chemistry
  • Hong Zhou + 4 more

Whole-process biomimetic synthesis of melanin-like amino acid surfactants by 2-iodoxybenzoic acid mediated regioselective oxidation of pterostilbene.

  • New
  • Research Article
  • 10.1016/j.jenvman.2025.127895
Recent advances in electro-fermentation technology: Sustainable approach for enhanced chemical bioproduction from mix-culture to pure-culture.
  • Dec 1, 2025
  • Journal of environmental management
  • Zhijie Yang + 3 more

Recent advances in electro-fermentation technology: Sustainable approach for enhanced chemical bioproduction from mix-culture to pure-culture.

  • New
  • Research Article
  • 10.2174/0118744710379515250506045145
68Ga]Ga-DOTA-TOC Synthesis by a Cassette Developer System with [68Ga]GaCl3 from Cyclotron using Liquid Target: An Italian Experience.
  • Dec 1, 2025
  • Current radiopharmaceuticals
  • Michela Cossandi + 9 more

[68Ga-DOTA-D-Phe1-Tyr3]octreotide ([68Ga]Ga-DOTA-TOC) is a somatostatin analogue largely used in PET/CT applications for the detection of gastroenteropancreatic neuroendocrine tumors (GEP-NET). Initially, it was obtained using a 68Ge/68Ga generator. The increasing cost of good manufacturing practice-compliant generators has led to the need to find alternative ways of producing Gallium-68 (68Ga). The aim of this work is to show the production optimization of [68Ga]Ga-DOTA-TOC via cyclotron, derived from three years of experience. The production of [68Ga]GaCl3 via the 68Zn(p,n)68Ga reaction was optimized using a PETtrace 800 cyclotron (equipped with ZnO liquid target) and the synthesis of [68Ga]Ga- DOTA-TOC was performed by FASTlab2 developer system according to the Guidelines on Good Radiopharmacy Practice (cGRPP). Quality control process was validated according to the current specific monograph (2482) of the European Pharmacopoeia (Ph. Eur.). [68Ga]Ga-DOTA-TOC was produced in 40 minutes; ten validation batches met the quality criteria expected by the Ph. Eur. The synthesis process has involved many issues due to the use of acidic reagents and related corrosion of some components of cyclotron and developer system, resulting in 12.2% failed syntheses and a target breakdown after 11 months. The main issues, their causes and the strategies used to solve them are reported in the troubleshooting section: thanks to these strategies, the number of failed syntheses has decreased, and today, we have achieved a 0% failure rate. Liquid target production of [68Ga]Ga-DOTA-TOC, once consolidated, instead of 68Ge/68Ga generator has many advantages.

  • New
  • Research Article
  • 10.1016/j.vaccine.2025.127938
Summary of human West Nile virus vaccine meeting, 2024: Investigating barriers to development.
  • Dec 1, 2025
  • Vaccine
  • Randall J Nett + 16 more

Summary of human West Nile virus vaccine meeting, 2024: Investigating barriers to development.

  • New
  • Research Article
  • 10.1016/j.jcis.2025.138292
Ampere-level glycerol electrooxidation enabled by oxygen vacancy-riched crystalline/amorphous Co3O4-x/ZrO2-x Heterointerface.
  • Dec 1, 2025
  • Journal of colloid and interface science
  • Yiming Guo + 2 more

Ampere-level glycerol electrooxidation enabled by oxygen vacancy-riched crystalline/amorphous Co3O4-x/ZrO2-x Heterointerface.

  • New
  • Research Article
  • 10.30574/wjarr.2025.28.2.3907
Identification and optimization of production processes on 200 TS A6 engine using lean manufacturing approach at PT Trimitra Marganda Unggul Tegal
  • Nov 30, 2025
  • World Journal of Advanced Research and Reviews
  • Denny Nurkertamanda + 2 more

PT. Trimitra Marganda Unggul (TMU) is a manufacturing company that focuses on producing underbody components for motorcycles and cars. One of the key performance indicators utilized is Gross Stroke per Hour (GSPH), which serves as a reference for production targets and evaluations of machine productivity. This study aims to identify the factors impeding the achievement of the production target or GSPH for the 200 TS A6 machine, while also providing recommendations for improvement to enhance productivity using a Lean Manufacturing approach. From October to December 2024, the average GSPH recorded on the 200 TS A6 engine was 265 strokes/hour, which is below the company's standard of 320 strokes/hour. The analysis using Process Activity Mapping (PAM) indicates the presence of significant non-value-added (NVA) activities leading to inefficiencies in the production process. The proposed improvement recommendations are estimated to yield a 69% increase in GSPH compared to previous records.

  • New
  • Research Article
  • 10.20885/teknoin.vol30.iss2.art6
Penerapan Metode NBM, REBA, dan QEC untuk menurunkan Risiko Kerja di PT XYZ
  • Nov 30, 2025
  • Teknoin
  • Elanjati Worldailmi + 2 more

The high number of defects in the ironing process at PT XYZ indicates potential ergonomic problems that impact product quality and worker health. This study aims to assess ergonomic risk levels and identify the main causes of musculoskeletal complaints among ironing operators. The Nordic Body Map (NBM) method was used to measure musculoskeletal complaints, the Rapid Entire Body Assessment (REBA) to assess work posture in detail, and the Quick Exposure Check (QEC) to evaluate ergonomic risk factors comprehensively. The study was conducted on four ironing operators, with primary posture measurements taken from the operator with the most representative posture pattern. The NBM results showed that the majority of workers were in the moderate risk category with dominant complaints in the forearms and wrists. The REBA analysis produced a score of 7, indicating action level 2 and requiring improvement in work posture. Meanwhile, the QEC results showed a very high risk (exposure score ≥ 70%) in all operators, especially in the wrist and shoulder segments. Based on these findings, root causes were identified and grouped into machine, method, human, and environment aspects using a fishbone diagram. Recommendations for improvement include anthropometrically based workbench redesign, adjustments to production targets, improved work methods, and environmental controls. This research provides a basis for ergonomic improvements to reduce the risk of injury and improve the quality of the ironing process at PT XYZ.

  • New
  • Research Article
  • 10.1094/pdis-07-25-1565-pdn
First Report of Root-Knot Nematode, Meloidogyne enterolobii , on Siraitia grosvenorii in Guangxi, China
  • Nov 29, 2025
  • Plant Disease
  • Xiaoyan Liang + 8 more

Siraitia grosvenorii (S. grosvenorii) belongs in the Cucurbitaceae Juss family and produces a fruit that is an economically important medicinal and sweetener crop in Guangxi, China (Guo et al. 2024). In April 2023, S. grosvenorii plants exhibiting stunted growth, wilted leaves and root galls were observed at the research farm of the Guangxi Institute of Botany in Guilin, Guangxi, China (GPS 25°4'58.7"N, 110°18'44.6"E) during a disease investigation survey. In the surveyed area, nearly 90% of S. grosvenorii plants showed these symptoms which were apparently caused by an undetermined species of root-knot nematode. Root samples from 20 S. grosvenorii plants revealed extensive galling and egg masses. Nematodes at various growth stages were extracted from the root samples by the shallow dish method and morphological identification was carried out. Females exhibited a spherical to pyriform shape with a distinct short neck. The perineal pattern was elliptical with rounded termini, exhibiting fine, smooth striae and a high dorsal arch. The second-stage juveniles (J2) were slender, with a conical tail terminus bearing a distinct hyaline region that ended bluntly rounded. Morphological measurements (mean, standard deviation, and range) of J2s (n = 20) included body length = 467.8 ± 17.0 (434.4 to 489.4) µm, body width = 22.0 ± 0.8 (20.5 to 23.4) µm, stylet length = 15.7 ± 0.8 (14.1 to 16.7) µm, tail = 42.2 ± 3.2 (36.9 to 47.7) µm. Measurements of females (n = 20) were: body length = 627.7 ± 42.2 (568.5 to 672.5) µm, body width = 494.5 ± 42.4 (440.8 to 556.7) µm. The observed characteristics of Meloidogyne enterolobii aligned with those documented by Yang and Eisenback (1983) and EPPO (2016). J2s that hatched from a single egg mass were used for DNA extraction and molecular identification. Using D2A/D3B (5’-ACAAGTACCGTGAGGGAAAGT/TCGGAAG GAACCAGCTACT-3’), the D2-D3 expansion segment of 28S rDNA region was obtained and sequenced (Subbotin et al. 2006). The target product was 759 bp (GenBank accession no. PV983999), which was 100% homologous to the M. enterolobii sequences available in GenBank (KX823400 and KX823397). For further confirmation, species identification was validated using the M. enterolobii-specific primers MK7-F/MK7-R (GATCAGAGGCGGGCGCATTGCGA /CGAACTCGCTCGAACTCGAC) (Tigano et al. 2010). An expected PCR fragment of approximately 520 bp was amplified; this fragment is absent in populations of M. incognita and M. arenaria (Tigano et al. 2010). Thus, the unknown nematode was conclusively identified as M. enterolobii. To perform Koch’s postulates, 20 healthy S. grosvenorii seedlings were grown in sterile soil until they developed 4 - 6 functional leaves. The seedlings were artificially inoculated with J2s of the original population of M. enterolobii at an inoculum density of 2,500 J2s per plant (n = 10), while 10 control seedlings were treated with sterile water. After 60 days of cultivation in a greenhouse at 26 ℃ with a 13-hour photoperiod, plant roots were observed for nematode symptoms. Non-inoculated plants exhibited no root galls and grew well, whereas all J2-inoculated plants developed field-typical root galls. The average root-knot rating for the inoculated group was 6.1 (on a scale of 0 to 10) (Bridge and Page 1980), confirming the pathogenicity of M. enterolobii to S. grosvenorii. To our knowledge, this is the first report of S. grosvenorii as a new host for M. enterolobii in China. Furthermore, M. enterolobii has been documented to infect several cucurbit hosts, including watermelon, cucumber, and Luffa cylindrica. Given its broad host range and high pathogenicity, M. enterolobii readily infects the roots of S. grosvenorii in cultivation, leading to stunted growth and diminished economic returns. Consequently, it may pose a significant threat to S. grosvenorii production in the future. Further monitoring and the development of effective management strategies are thus warranted.

  • New
  • Research Article
  • 10.1149/ma2025-02271515mtgabs
Kinetic Study of Ethanol Electro-Reforming for Acetaldehyde Production in Perchloric Acid Solution
  • Nov 24, 2025
  • Electrochemical Society Meeting Abstracts
  • Kai Hung Cheng + 2 more

Introduction In recent years, the increasing adoption of hydrogen energy has significantly propelled advancements in hydrogen production through electrolysis. However, the oxygen produced as a byproduct during this process has not been effectively utilized so far. Therefore, this research focuses on the production of chemical compounds through organic electrosynthesis in place of oxygen generation as the anode reaction. Specifically, this study targets the synthesis of acetaldehyde from the oxidation of ethanol. Previous studies have investigated the concentration dependency and potential dependency of ethanol electro-oxidation in sulfuric acid[1]. This study establishes a kinetic model for ethanol electro-oxidation through experiments examining temperature and interfacial potential dependencies without the effects of anion adsorption. It provides valuable kinetic parameters that can be used in electrochemical simulators and offers a method for evaluating electrochemical catalysts from a chemical engineering perspective. Experimental A schematic of the experimental setup is shown in Fig. 1. Platinum electrodes (De Nora Permelec Ltd, JL-510 coating DSE) were placed on silicone gaskets with flow channels, and the gaskets were sandwiched between silicone gaskets, PTFE plates, and stainless-steel endplates. A cation exchange membrane (Chemours, Nafion® NR-212) was placed in the center to separate the reactions at the two electrodes. An electrochemical measurement system (Hokuto Denko, HZ-pro) was used to measure current and solution resistance. In the experiments, perchloric acid was used as the electrolyte; solutions containing ethanol were supplied to the anode, while perchloric acid solutions were supplied to the cathode. The reaction was performed at 25–40 ℃ and atmospheric pressure. High-performance liquid chromatography (Hitachi High-Tech Science, Chromaster®, ion exclusion column GL-C610-S, Hitachi High-Tech Science 5450 RI Detector) was used for product analysis. Results and Discussion The ethanol electro-oxidation reaction is a consecutive reaction in which acetaldehyde is formed and further oxidized to acetic acid. In addition, the parallel reaction of ethanol oxidizing into carbon dioxide also occurs simultaneously. The reaction equations are expressed by Eqs. (1)–(3), and the uncovered fraction of the catalyst active site is expressed as θ v in Table 1. Assuming the reaction mechanism involving Eqs. (1)–(4), the overall reaction rate equations r s1, r s2 and r s3 are expressed in Eqs. (5)–(11)[2]. Under conditions of low conversion and negligible anion adsorption, Eq. (5) for ethanol electro-oxidation to acetaldehyde can be simplified as Eq. (12) [3]. Where Ki [L/mol] is the adsorption equilibrium constant for component i.As shown in Fig. 2, the Langmuir plot demonstrates that the values of K EtOH at 25 °C, 35 °C, and 40 °C were 1.26 L/mol, 0.76 L/mol, and 0.55 L/mol, respectively. This result indicates that increasing the reaction temperature weakens the adsorption of ethanol on the electrode surface as expected. Furthermore, the activation energy for each reaction, Ei was calculated to be 43 kJ/mol, 11 kJ/mol, 52 kJ/mol from the slope of the Arrhenius plot shown in Fig. 3. Increasing the temperature enhances the rate of ethanol being converted to acetaldehyde (the target product), but it may also accelerate the side reaction of acetaldehyde, further oxidation into acetic acid. Therefore, careful temperature control is necessary. Similarly, as shown in Fig. 4, experiments were conducted at interfacial potential differences between 0.6–0.8 V. The Tafel slope bi for each reaction was determined from Eq. (9), yielding values of 0.120 V, 0.153V, and 0.276 V for Rxns 1, 2, and 3.Adjustment of the potential can effectively increase the reaction rates of ethanol-to-acetaldehyde and acetaldehyde-to-acetic acid. However, the side reaction, ethanol directly converting to carbon dioxide is less sensitive to potential changes. The relationship between ethanol conversion and acetaldehyde selectivity is shown in Fig.5. The results indicate that even at an ethanol conversion of 90%, an acetaldehyde selectivity of approximately 97% can still be achieved. Conclusions In this study, we analyzed the reaction kinetics of ethanol electro-reforming for producing acetaldehyde, an important industrial chemical. The dependencies of the reaction rate on temperature and interfacial potential difference were measured, and the kinetic parameters of the reactions were determined by Arrhenius plot and Tafel plot. By simultaneously tuning temperature and potential, the reaction pathway can be effectively controlled, thus enhancing the yield and selectivity toward acetaldehyde. Future research should focus on developing models that account for the adsorption of water, acetaldehyde, and by-products at high conversion and high potential differences. Reference [1] K. Cheng, K. Namura and M. Kawase, 244th ECS meeting (Gothenburg, 2023), L01-2561[2] K. Cheng and M. Kawase, PRiME 2024 (Honolulu, 2024), L03-3904[3] K. Cheng and M. Kawase, SCEJ 55th Fall meeting (Sapporo, 2024), S305 Figure 1

  • New
  • Research Article
  • 10.3310/nihropenres.14054.1
The development of patient-focused diagnostic target product profiles for detection of infection and exacerbation in people with cystic fibrosis
  • Nov 24, 2025
  • NIHR Open Research
  • Kile Green + 3 more

Background Infections and exacerbations are common for people living with Cystic Fibrosis (pwCF). This project aimed to develop patient-focused diagnostic target product profiles (TPP) to address unmet diagnostic needs for pwCF with international relevance. Methods This project involved three phases, guided by an expert advisory group of key opinion leaders (KoLs) including methodologists, pwCF, and clinical staff, and including lived experience perspectives at every stage. Phase 1 involved a landscape analysis to identify and prioritise unmet diagnostic needs via focus groups with clinical experts and pwCF, as well as a scoping review of the diagnostic space and available diagnostic tests. Phase 2 involved drafting the TPPs using evidence from existing literature and regulatory documentation, focus groups, one-to-one interviews with KoLs, and web-based surveys, to define ‘minimal’ and ‘optimal’ characteristics for each TPP. Phase 3 refined and validated the TPP content through additional interviews, a two-round modified Delphi exercise, and a virtual symposium. Results A comprehensive document detailing four TPPs was drafted and released freely for use. The document includes aspirational TPPs covering diagnostics for managing acute pulmonary exacerbations, rapid pathogen identification, and antimicrobial susceptibility tests, as well as a detailed TPP defining in-vitro diagnostic tests for rapid detection of non-tuberculous mycobacteria (NTM) pulmonary infections. The document contains additional guidance for diagnostic development and research needs identified for pwCF. Conclusions The project consulted with over 150 individuals and experts in CF infection management, and diagnostic development. The TPP guidance document supports research and development of patient-focused diagnostics for the benefit of pwCF.

  • New
  • Research Article
  • 10.1002/bbb.70089
Biolubricant intensified process design: evaluation and technoeconomic assessment
  • Nov 24, 2025
  • Biofuels, Bioproducts and Biorefining
  • Ana E L Budin + 4 more

Abstract Biolubricants are nontoxic and biodegradable, and they exhibit properties comparable to mineral‐oil lubricants. This study examines two alternative transesterification pathways based on renewable feedstocks: the reaction of castor oil with isoamyl alcohol (process 1) and with isobutyl alcohol (process 2). Molecular distillation (MD) was employed to separate and purify the target products. Process evaluation and technoeconomic assessment (TEA) require a simulation model. As MD is not available in commercial simulators such as Aspen Plus, the separation was emulated using a sequence of flash vessels. The proposed emulation approach was validated for two binary mixtures whose distilled mass fractions matched literature values. The intensified production process for isoamyl ricinoleate and isobutyl ricinoleate recovered 99% of the ester‐rich fraction (99% w/w) in the distillate stream. At a 15% internal rate of return (IRR), the minimum product selling price for the isobutyl alcohol pathway (USD 1964 per ton) was lower than that of the isoamyl alcohol pathway (USD 2101 per ton). This work demonstrates a cost‐effective process design that combines intensified separation with renewable raw materials.

  • New
  • Research Article
  • 10.18805/ag.df-800
Integrated Crop Management with Hazton Planting Method on Paddy Rice Plants in North Maluku Province, Indonesia
  • Nov 24, 2025
  • Agricultural Science Digest - A Research Journal
  • Ekaria + 2 more

Background: The application of integrated crop management with the Hazton planting method can increase rice production, but the adoption rate of this technology still needs to be higher. So, there is a gap in the effectiveness of cultivation innovation that hinders the achievement of rice production targets. This study aims to identify socioeconomic factors that affect the integration of crop management with the Hazton method on rice paddy crops. Methods: The analysis method used is multiple linear regression analysis. All statistical analyses were performed using IBM SPSS 21 software. Result: The study’s results showed that age, formal education, farming experience, land area, income and the role of extension and financing institutions significantly influenced 67% of the implementation of integrated crop management with the Hazton planting method on rice paddy crops. Meanwhile, age, family labor and institutional support for production input had no significant effect. These findings imply that increased adoption requires targeted education and training programs, especially in areas with extensive rice cultivation activities. Easily accessible financing schemes and strong institutional support are also important to support the sustainable adoption of the technology. This research contributes to the understanding of the influence of socioeconomic factors on the adoption of agricultural technology in remote areas and provides insights for the development of policies to support rice self-sufficiency in Indonesia.

  • New
  • Research Article
  • 10.1149/ma2025-02381803mtgabs
(Invited) Catalyst and Catalyst Support Innovations at Scale: Enabling the Future of PEM Fuel Cells and Water Electrolyzers
  • Nov 24, 2025
  • Electrochemical Society Meeting Abstracts
  • Michele L Ostraat + 3 more

Pajarito Powder (Pajarito) manufactures a proprietary Engineered Catalyst Support (ECS) that is optimized for proton exchange membrane fuel cell (PEMFC) and water electrolysis (PEMWE) applications due to its extremely high surface area, desired mesopore volume, and corrosion resistance. This ECS platform offers a controlled pore architecture for excellent catalyst dispersion and balanced mass transport, which uniquely enables more efficient utilization of precious metal catalysts, a critical feature limiting the widespread implementation of PEMFC and PEMWE technologies. Further improvements in these technologies will be driven in part by improvements at the catalyst support level, including reducing carbon corrosion, limiting metal particle detachment, and slowing catalyst particle agglomeration by fine tuning the ECS pore structure and heteroatom dopant concentration. Here, we present key advantages driven by performance data of the mesoporous carbon catalyst support design over other carbonaceous support materials in PEMFC and PEMWE applications. Such improvements enhance catalyst material performance and durability in PEMFC and PEMWE, both limitations to the widespread implementations of these technologies. These findings highlight Pajarito’s unique feedback loop between our ECS materials suite, our metal deposition know-how, and our performance testing research and development teams’ ability to precisely and collaboratively control and tune the characteristics of our deposited catalysts simultaneously to maximize the performance, reliability, and durability of our supported catalysts for PEMFC and PEMWE applications.Further improvements to Pajarito’s manufacturing capabilities have been accelerated by recent Department of Energy (DOE) awards geared towards the high-volume production and validation of advanced platinum (Pt) and platinum alloys (PtM) on ECS. These awards have enabled our ECS scale-up campaign, accelerating Pajarito’s production capacity towards widespread implementation of state-of-the-art mesoporous catalyst materials. Domestic manufacturing of Pajarito’s durable engineered catalyst support ECS materials and supported Pt (Pt/ECS) and Pt alloy-based catalysts (PtM/ECS where M = Ni or Co) is accelerating to 4 kg/day with the needed durability, quality, and reliability to facilitate the United States DOE’s production target of 20,000 stacks per year. This project will advance the technology readiness level of ECS and Pt/ECS production from 4 → 8. The project team will deliver an improved production process that enhances sustainability of and reduces the carbon footprint of Pajarito’s manufacturing process while keeping the resulting catalysts cost competitive. Pajarito’s ECS and catalyst costs (not including platinum group metal (PGM) costs) will be reduced by > 90%, enabling greater market adoption.

  • New
  • Research Article
  • 10.1038/s41598-025-25368-8
Covalent organic frameworks-supported copper bismuth oxide nanoparticles as an efficient and green photocatalyst for benzyl alcohol oxidation
  • Nov 21, 2025
  • Scientific Reports
  • Sanaz Hajimohamadzadehtorkambour + 3 more

This work presents a sustainable and eco-friendly method using covalent organic frameworks (COFs) under visible light to selectively photocatalyze the oxidation of aromatic alcohols into beneficial aromatic aldehyde compounds. Under mild conditions, this work investigated a composite of CuBi₂O₄ and CTFs (CTF-CuBi₂O₄) as a heterogeneous photocatalyst for the oxidation of benzyl alcohols to their respective benzaldehydes using TBHP as the oxidizing agent. Several microscopic and spectroscopic techniques, including FT-IR, PXRD, SEM, TEM, EDAX, BET, TGA, UV-DRS, Matt-Schottky, and PL, were used to investigate the physical and structural features of this photocatalyst. Moreover, mass spectroscopy, 1H NMR, and13C NMR were the techniques applied to verify the corresponding benzaldehydes’ structures. The target products can be synthesized in moderate to high yields under appropriate reaction conditions. This technology offers advantages such as diminished reaction time and temperature (room temperature), utilization of visible light as a renewable and eco-friendly energy source, moderate reaction conditions, application of a recyclable catalyst, enhanced selectivity, and minimized undesirable byproducts. Additionally, the stability and recyclability of the catalyst were examined under ideal conditions, revealing that it can be reversibly reused for up to 6 cycles without substantial loss of activity.Supplementary InformationThe online version contains supplementary material available at 10.1038/s41598-025-25368-8.

  • New
  • Research Article
  • 10.1021/acs.joc.5c02322
Visible-Light-Promoted Intermolecular Annulation Toward Efficient Synthesis of Multisubstituted Pyrazoles.
  • Nov 21, 2025
  • The Journal of organic chemistry
  • Lei Deng + 8 more

A visible-light-promoted intermolecular annulation between aryl hydrazines and α-bromoketones for synthesizing 1,3,5-trisubstituted pyrazoles is described from commercially available starting materials. This protocol features a broad substrate scope, transition metal catalyst-free conditions, and operational simplicity. The approach proceeds under mild reaction conditions using air as the oxidant. Gram-scale experiments and postsynthetic modifications demonstrate its practical utility. Mechanistic studies indicate that α-bromoketones undergo self-coupling, forming 1,2-diacylvinylene intermediates that subsequently cyclize with aryl hydrazines under visible-light irradiation to afford the target products.

  • New
  • Research Article
  • 10.1021/acs.accounts.5c00584
Precise Engineering of Multimetal Sites in Metal-Organic Frameworks for Efficient and Selective Electrochemical Reduction of CO2 to C2 and Urea Products.
  • Nov 20, 2025
  • Accounts of chemical research
  • Hao-Lin Zhu + 2 more

ConspectusThe electrochemical carbon dioxide reduction reaction (eCO2RR) is a promising technology for reducing carbon emissions and producing valuable multicarbon and nitrogen-containing chemicals from CO2. Among these, C2 products such as ethylene (C2H4), ethanol (EtOH), acetate (AcO-)/acetic acid (AcOH), and urea are of particular interest due to their industrial value. The key to achieving these products lies in controlling C-C and C-N bond coupling, particularly by regulating the adsorption energy and geometry of the reaction intermediates. Compared to single-metal catalysts, multimetal systems offer better control over these intermediates through spatial configurations and adjustable adsorption properties, enabling more selective C-C and C-N coupling. However, achieving high selectivity for the target product remains challenging due to complex interactions among reaction pathways, binding energies, and the dynamic electrochemical environment. To overcome this, it is essential to understand how metal types, metal site arrangements, and coordination environments influence intermediate activation. Metal-organic frameworks (MOFs) offer a unique platform for designing such catalysts due to their structural order and atomic-level tunability. This Account systematically summarizes the structural engineering strategies of multimetal catalysts based on MOFs in the eCO2RR and categorizes them into three typical types: (1) Multicopper sites, which can promote C-C coupling reactions between *CO and *CHO intermediates and are conducive to the generation of C2H4; further optimization of the chemical microenvironment can significantly enhance catalytic efficiency. (2) Adjacent heterometal sites based on Cu and oxyphilic metal such as the Cu-Sn site, which display different affinities of distinct metal centers for C and O atoms in the eCO2RR, achieving C-C coupling between *CO and *OCH2 intermediates for the production of EtOH. (3) Cooperative Fe-based multimetallic sites, which take advantage of the strong nitrogen affinity of Fe sites and the CO2 activation ability of Cu/Ni centers to promote selective C-N coupling for urea synthesis. The above structure-performance relationships provide theoretical basis and practical guidance for yielding target C2 products or urea with high selectivity through eCO2RR. This Account not only constructs a conceptual framework for the selective synthesis of C2 compounds and urea starting from CO2 but also highlights the flexibility and controllability of MOF-based multimetal catalysts as an ideal platform for CO2 resource utilization and systematically provides guidance for the selective acquisition of specific complex products. Finally, we summarize several key design principles and future development directions, aiming to bridge the gap between a molecular-level understanding and practical device integration. To further enhance performance and deepen understanding of the catalytic mechanism, subsequent research is still needed to develop MOF-based electrocatalysts with more performance multimetallic site configurations and promote their application in industrial-related electrochemical manufacturing.

  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • .
  • .
  • .
  • 10
  • 1
  • 2
  • 3
  • 4
  • 5

Popular topics

  • Latest Artificial Intelligence papers
  • Latest Nursing papers
  • Latest Psychology Research papers
  • Latest Sociology Research papers
  • Latest Business Research papers
  • Latest Marketing Research papers
  • Latest Social Research papers
  • Latest Education Research papers
  • Latest Accounting Research papers
  • Latest Mental Health papers
  • Latest Economics papers
  • Latest Education Research papers
  • Latest Climate Change Research papers
  • Latest Mathematics Research papers

Most cited papers

  • Most cited Artificial Intelligence papers
  • Most cited Nursing papers
  • Most cited Psychology Research papers
  • Most cited Sociology Research papers
  • Most cited Business Research papers
  • Most cited Marketing Research papers
  • Most cited Social Research papers
  • Most cited Education Research papers
  • Most cited Accounting Research papers
  • Most cited Mental Health papers
  • Most cited Economics papers
  • Most cited Education Research papers
  • Most cited Climate Change Research papers
  • Most cited Mathematics Research papers

Latest papers from journals

  • Scientific Reports latest papers
  • PLOS ONE latest papers
  • Journal of Clinical Oncology latest papers
  • Nature Communications latest papers
  • BMC Geriatrics latest papers
  • Science of The Total Environment latest papers
  • Medical Physics latest papers
  • Cureus latest papers
  • Cancer Research latest papers
  • Chemosphere latest papers
  • International Journal of Advanced Research in Science latest papers
  • Communication and Technology latest papers

Latest papers from institutions

  • Latest research from French National Centre for Scientific Research
  • Latest research from Chinese Academy of Sciences
  • Latest research from Harvard University
  • Latest research from University of Toronto
  • Latest research from University of Michigan
  • Latest research from University College London
  • Latest research from Stanford University
  • Latest research from The University of Tokyo
  • Latest research from Johns Hopkins University
  • Latest research from University of Washington
  • Latest research from University of Oxford
  • Latest research from University of Cambridge

Popular Collections

  • Research on Reduced Inequalities
  • Research on No Poverty
  • Research on Gender Equality
  • Research on Peace Justice & Strong Institutions
  • Research on Affordable & Clean Energy
  • Research on Quality Education
  • Research on Clean Water & Sanitation
  • Research on COVID-19
  • Research on Monkeypox
  • Research on Medical Specialties
  • Research on Climate Justice
Discovery logo
FacebookTwitterLinkedinInstagram

Download the FREE App

  • Play store Link
  • App store Link
  • Scan QR code to download FREE App

    Scan to download FREE App

  • Google PlayApp Store
FacebookTwitterTwitterInstagram
  • Universities & Institutions
  • Publishers
  • R Discovery PrimeNew
  • Ask R Discovery
  • Blog
  • Accessibility
  • Topics
  • Journals
  • Open Access Papers
  • Year-wise Publications
  • Recently published papers
  • Pre prints
  • Questions
  • FAQs
  • Contact us
Lead the way for us

Your insights are needed to transform us into a better research content provider for researchers.

Share your feedback here.

FacebookTwitterLinkedinInstagram
Cactus Communications logo

Copyright 2025 Cactus Communications. All rights reserved.

Privacy PolicyCookies PolicyTerms of UseCareers