Symptomatic Palms Research Articles

First report of 'Candidatus Phytoplasma palmae' (16SrIV-A subgroup) associated with palm Lethal Yellowing disease on Cocos nucifera and Pritchardia sp. in Guadeloupe, French West Indies.

Lethal Yellowing (LY) disease causes major damage to palms in Central America and the Caribbean. It has been reported as far south as Antigua (Myrie et al., 2014). LY affects over forty palm species, seriously impacts the coconut industry and alters the landscapes on islands with a tourist-based economy. In March 2021, the presence of LY disease was regularly monitored in Guadeloupe. Two palm species (Cocos nucifera and Pritchardia sp.) died on a private property in Saint-Anne, Grande Terre. Yellowing of lower fronds and necrosis of inflorescences were reported on some neighboring palms. One symptomatic Cocos nucifera (GP21-007) and four symptomatic Pritchardia sp. (GP21-005, GP21-006, GP21-008 and GP21-009) were sampled by stem drilling. Samples from four asymptomatic coconut trees (GP21-001 to GP21-004) were collected in the locality of Deshaies. DNA was extracted from the nine sawdust samples following a cetyltrimethylammonium bromide (CTAB) modified protocol (Doyle and Doyle, 1990). A quantitative polymerase chain reaction (PCR), following the protocol described by Christensen et al. (2004), was performed on DNA to diagnose the presence of phytoplasmas. An exponential amplification was observed for all DNA extracts from symptomatic palm samples (threshold number of PCR cycles (Ct) ranged from 18.50 to 23.58). DNA from asymptomatic samples yielded negative results (undetermined Ct). To identify the phytoplasma associated with LY, DNA samples were subjected to PCR, based on the 16SrRNA gene, plus internal transcribed spacers (ITS) using P1-1T (Pilet et al., 2021)/P7 (Schneider et al., 1995) primers, and secA gene using the primer pair secAFor1/secARev1 (Hodgetts et al. 2008). Amplicons of 1.8 kb covering the 16S ribosomal operon and 830 bp for the secA gene were produced using DNA from symptomatic trees. All amplicons were double strand sequenced (Genewiz, UK). The corresponding sequences were deposited in GenBank and subjected to BLASTn on NCBI. Sequences of the ribosomal operon gene (accession no. ON521114 to ON521118) were identical for the five positive samples. Sequencing revealed two distinct ribosomal operons with heterozygous peaks on the DNA chromatogram. The first aMino ambiguity (M = Adenine or Cytosine) was observed in the 16Sr RNA gene. The second was observed in the first intergenic transcript spacer. The 16S rDNA sequence (M = Cytosine) presented 100% identity with accession no. HQ613874 and 99.93% with accession no. U18747, the reference sequence for 'Candidatus Phytoplasma palmae'. The virtual RFLP pattern derived from the 16S rDNA F2nR2 fragment and identified using iPhyclassifier (Zhao et al. 2009) was identical to the reference pattern for the 16SrIV-A subgroup. A unique sequence was obtained for the partial secA gene (OP136139 to OP136143), sharing 100% identity with EU267187 for the palm LY phytoplasma preprotein translocase subunit (secA) gene. This is the first report of 'Ca. Phytoplasma palmae' (subgroup 16SrIV-A) associated with palm LY disease on Cocos nucifera and Pritchardia sp. in Guadeloupe. Measures to eradicate LY were implemented as soon as its presence was confirmed in Guadeloupe. LY phytoplasmas continue to spread in the Caribbean and are approaching South America, where the known vector, Haplaxius crudus, has already been reported (Silva et al., 2019). This poses a major threat to the coconut economy and the diversity of palm trees.

Effect of Oxytetracycline-Hydrochloride on Phytoplasma Titer and Symptom Progression of the 16SrIV-D Phytoplasma in Cabbage Palms from Florida.

Lethal bronzing (LB) is a phytoplasma disease of palms in Florida, U.S.A. Historically, the use of the antibiotic oxytetracycline-hydrochloride (OTC-HCl) was optimized to treat for LY, and currently label rates for OTC-HCl developed for LY are being used to treat palms preventatively against LB. Because of the economic impact of LB, assessing OTC-HCl against LB is essential for developing and optimizing management options for this disease. In this study, Sabal palmetto palms declining from LB were injected with OTC-HCl to assess efficacy on LB. Four groups of palms were selected that represented healthy palms, early symptomatic palms, palms with moderate symptoms, and palms with late-stage symptoms. Within each group, treatment palms injected with OTC-HCl and a control group with no antibiotics were tested weekly by quantitative PCR for 1 year. For asymptomatic palms, treated palms never developed symptoms or tested positive, whereas one of the control palms did. The early symptomatic palms that were treated had similar levels of phytoplasma to the control group but had much slower symptom development. Palms with moderate symptoms had no difference in titer between the treatment and the control group, but treated palms had much slower symptom development. Palms with late-stage symptoms showed no difference in phytoplasma titer or symptom progression between treated and control palms. These results suggest that label rates of OTC-HCl appear useful as a preventative against LB, but once symptoms develop, label rates cannot cure palms. In the meantime, removal of symptomatic palms is recommended.

‘Candidatus Phytoplasma’ species detection in coconuts in Cuba

Coconut lethal yellowing (LY) is the single most important disease presently affecting the coconut production worldwide. Symptomatic and asymptomatic coconut plants were sampled in some selected areas to verify the identity of phytoplasmas associated with LY in Cuba. Diverse phytoplasma ribosomal groups were detected in the samples from symptomatic palms such as 16SrXII, 16SrVII, and 16SrI. In several other palms 16SrIV-A subgroup phytoplasmas were identified, in the groEL gene the only positive plant from Pilon resulted diverse from the others and identical to the 16SrIV-A strains detected in Jamaica LY infected coconut palms. This is the first record of occurrence of 16SrI, -VII and-XII groups in coconut palms in Cuba.

'Candidatus Phytoplasma wodyetiae', a new taxon associated with yellow decline disease of foxtail palm (Wodyetia bifurcata) in Malaysia.

Landscape-grown foxtail palm (Wodyetia bifurcata A. K. Irvine) trees displaying symptoms of severe foliar chlorosis, stunting, general decline and mortality reminiscent of coconut yellow decline disease were observed in Bangi, Malaysia, during 2012. DNA samples from foliage tissues of 15 symptomatic palms were analysed by employing a nested PCR assay primed by phytoplasma universal ribosomal RNA operon primer pairs, P1/P7 followed by R16F2n/R2. The assay yielded amplicons of a single band of 1.25 kb from DNA samples of 11 symptomatic palms. Results from cloning and sequence analysis of the PCR-amplified 16S rRNA gene segments revealed that, in three palms, three mutually distinct phytoplasmas comprising strains related to 'Candidatus Phytoplasma asteris' and 'Candidatus Phytoplasma cynodontis', as well as a novel phytoplasma, were present as triple infections. The 16S rRNA gene sequence derived from the novel phytoplasma shared less than 96 % nucleotide sequence identity with that of each previously describedspecies of the provisional genus 'Ca. Phytoplasma', justifying its recognition as the reference strain of a new taxon, 'Candidatus Phytoplasma wodyetiae'. Virtual RFLP profiles of the R16F2n/R2 portion of the 16S rRNA gene and the pattern similarity coefficient value (0.74) supported the delineation of 'Ca. Phytoplasma wodyetiae' as the sole representative subgroup A member of a new phytoplasma ribosomal group, 16SrXXXVI.

Comparison of RNA extraction methods for RT-PCR detection of Coconut cadang-cadang viroid variant in orange spotting oil palm leaves

Coconut cadang-cadang viroid (CCCVd) is a lethal disease that has devastated the coconut industry in the Philippines. Recently, a CCCVd variant associated with orange spotting of foliage, which is a phenomenon reported in the Malaysian oil palm industry, occurring as an isolated palm with no similar symptoms on the adjacent neighbouring palms. The presence of this viroid in oil palms is difficult to detect as it is found in very low concentrations. Thus, an efficient RNA extraction method for isolating the CCCVd variant and to detect it through reverse transcriptase polymerase chain reaction (RT-PCR) using specific primers for CCCVd was required. Leaf samples from symptomatic and asymptomatic oil palms were collected from various locations in Malaysia, namely, Negeri Sembilan, Selangor and Perak. The samples were subjected to three RNA extraction methods – natrium chloride EDTA Tris-HCl mercaptoethanol extraction (NETME), polyethylene glycol extraction (PEG) and cetyltrimethylammonium bromide extraction (CTAB). The quantification of the RNA, based on optical density (OD) and concentration, showed that the CTAB extraction was the best, followed by the NETME extraction. The RNA extraction using PEG resulted in poor yields and had the lowest purity. The viroid was detected in all of the samples extracted via CTAB and NETME by RT-PCR with reduced starting material compared with PEG extracted RNA. A BLAST analysis indicated that the viroid sequences are highly conserved and shared a 93% sequence identity with the CCCVd246 variant from oil palm. Phylogenetic analysis showed that the variant belonged to an outgroup from other cocadviroids found in monocots.

Loop mediated isothermal amplification (LAMP) assay for detection of coconut root wilt disease and arecanut yellow leaf disease phytoplasma.

The coconut root wilt disease (RWD) and the arecanut yellow leaf disease (YLD) are two major phytoplasma associated diseases affecting palms in South India. Greatly debilitating the palm health, these diseases cause substantial yield reduction and economic loss to farmers. A rapid and robust diagnostic technique is crucial in efficient disease management. We established phytoplasma 16S rDNA targeted loop mediated isothermal amplification (LAMP) and real time LAMP based diagnostics for coconut RWD and arecanut YLD. The LAMP reaction was set at 65°C and end point detection made using hydroxynaphthol blue (HNB) and agarose gel electrophoresis. Molecular typing of LAMP products were made with restriction enzyme HpyCH4 V. Conventional PCR with LAMP external primers and sequencing of amplicons was carried out. Real time LAMP was performed on the Genei II platform (Optigene Ltd., UK). An annealing curve analysis was programmed at the end of the incubation to check the fidelity of the amplicons. The phytoplasma positive samples produced typical ladder like bands on agarose gel, showed colour change from violet to blue with HNB and produced unique annealing peak at 85±0.5°C in the real time detection. Restriction digestion produced predicted size fragments. Sequencing and BLASTN analysis confirmed that the amplification corresponded to phytoplasma 16S rRNA gene. LAMP method devised here was found to be more robust compared to conventional nested PCR and hence has potential applications in detection of phytoplasma from symptomatic palm samples and in rapid screening of healthy seedlings.

Molecular and Scanning Electron Microscopic Proof of Phytoplasma Associated With Areca Palm Yellow Leaf Disease in Sri Lanka

HomePlant DiseaseVol. 99, No. 11Molecular and Scanning Electron Microscopic Proof of Phytoplasma Associated With Areca Palm Yellow Leaf Disease in Sri Lanka PreviousNext DISEASE NOTES OPENOpen Access licenseMolecular and Scanning Electron Microscopic Proof of Phytoplasma Associated With Areca Palm Yellow Leaf Disease in Sri LankaC. Kanatiwela-de Silva, M. Damayanthi, R. de Silva, M. Dickinson, N. de Silva, and P. UdagamaC. Kanatiwela-de SilvaSearch for more papers by this author, M. DamayanthiSearch for more papers by this author, R. de SilvaSearch for more papers by this author, M. DickinsonSearch for more papers by this author, N. de SilvaSearch for more papers by this author, and P. UdagamaSearch for more papers by this authorAffiliationsAuthors and Affiliations C. Kanatiwela-de Silva , Department of Zoology, Faculty of Science, University of Colombo, Sri Lanka; M. Damayanthi , Sri Lanka Institute of Nanotechnology, Nanotechnology & Science Park, Mahenwatte, Pitipana, Homagama, Sri Lanka; R. de Silva , Crop Protection Division, Coconut Research Institute, Lunuwila, Sri Lanka; M. Dickinson , School of Biosciences, University of Nottingham, Sutton Bonington Campus, Loughborough, LE12 5RD, UK; N. de Silva , Sri Lanka Institute of Nanotechnology, Nanotechnology & Science Park, Mahenwatte, Pitipana, Homagama, Sri Lanka; and P. Udagama , Department of Zoology, Faculty of Science, University of Colombo, Sri Lanka. Published Online:21 Sep 2015https://doi.org/10.1094/PDIS-01-15-0072-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat The areca palm, Areca catechu L., of the Arecaceae family, is an important commercial crop in the world, where the drupe, commonly called the areca nut, is mainly used in betel quid chewing in many Asian and Oceanic countries. Areca palms have a low commercial value in Sri Lanka; they are largely grown in wet and intermediate zones on a total area of 11,968 ha in home gardens, as mixed cultivations, and seldom as small scale commercial cultivations. Although areca yellow leaf disease (AYLD) was not previously reported in Sri Lanka, it is a serious disease in neighboring India, reducing yield by much as 50% (Manimekalai et al. 2010). After an occurrence of Weligama coconut leaf wilt disease (WCLWD) in the southern province of Sri Lanka (Perera et al. 2012), areca palms with similar symptoms were noted in the vicinity of the WCLWD-affected plantations. Foliar yellowing of areca palms, the most conspicuous symptom, began from the inner whorl and spread to the outer parts of the crown. Chlorosis was observed on almost all leaves in the whorl. The association of a phytoplasma strain with this yellowing disease was investigated by molecular characterization based on the secA gene in conjunction with scanning electron microscopy (SEM). Symptomatic palms were selected from the vicinity of WCLWD-affected plantations in the Matara District. Symptomless, apparently healthy areca palms were selected from the Kandy District of the central province of the island. Total DNA was extracted from midrib of areca pinnae using the small scale DNA extraction method (Zhang et al. 1998). Total DNA derived from symptomatic and apparently healthy leaf samples were analyzed by primary PCR using a phytoplasma-specific universal primer pair, SecAfor1/SecArev3 (Hodgetts et al. 2008) in the primary PCR, and a 1/10 dilution of this amplicon used as the template to perform the nested PCR using RicesecAfor2/RiceseAcrev3 primers specific for phytoplasma of the 16SrXI and 16SrXIV groups (Bekele et al. 2011). Twelve of 15 symptomatic samples yielded an amplicon of 420 bp; no amplicon was generated by DNA templates from symptomless plants (n = 15). Analysis of these partial secA sequences (NCBI Accession No. KM978910) of this characteristic band of AYLD confirmed the association of a phytoplasma strain that shared 99% nucleotide homology with that of ‘Candidatus Phytoplasma cynodontis’ reference strain and 100% identity with WCLWD phytoplasma (NCBI Accession No. KM978909). Observations of transverse sections of midribs of pinnae of infected spear leaves by SEM revealed the presence of spherical, pleomorphic phytoplasma bodies ranging in diameter from 100 to 1000 nm. These appeared as separate or clustered particles, adhering to the inner surface of sieve tubes of diseased plants. The uneven distribution of phytoplasma bodies in sieve tubes as well as a developmental stage of the phytoplasma (i.e., those undergoing budding) was observed. Phytoplasma bodies were categorically absent in transverse sections of midrib of pinnae of healthy areca leaf samples. To our knowledge, this is the first report of AYLD in Sri Lanka as well as the detection of a 16SrXIV group phytoplasma strain associated with this disease. It is plausible that the same phytoplasma strain is associated with both AYLD and WCLWD. Thus, identification of areca palm as an alternative host of WCLWD phytoplasma will not only increase the complexity of the epidemiology of this disease, but will be more important in implementing control strategies for WCLWD.

Real-time PCR technique for detection of arecanut yellow leaf disease phytoplasma

The Yellow Leaf Disease, with phytoplasmal etiology, is a serious disease affecting arecanut palms and causing substantial yield loss. Phytoplasmas are cell wall less, unculterable, phloem limited plant pathogens generally detected using microscopy, serology and molecular techniques. Here we report a SYBR green based real time PCR approach for detection of arecanut yellow leaf disease phytoplasma. We designed efficient primers for SYBR green based real time PCR to overcome the problems in conventional PCR. Primers QPF2/QPR2, designed from highly conserved phytoplasma 16S rRNA gene was used to amplify DNA preparation from spindle leaf tissues of symptomatic palms using real time PCR. A unique melting peak at 82.3 ± 0.5 °C was observed for symptomatic arecanut samples. The PCR products were further purified, sequenced and analysed using BLASTn. The sequences showed 99 % nucleotide identity with Indian arecanut yellow leaf disease phytoplasma sequences in the database. Two representative sequences were also deposited in the Genbank database. The present study thus devised a platform for rapid and sensitive detection of phytoplasma associated with the arecanut yellow leaf disease.

Molecular confirmation and interrelationship of phytoplasmas associated with diseases of palms in South India

Suspected phytoplasma symptoms of yellowing of inner whorl of leaves and rotting of spear in oil palm, yellowing of outer whorl of leaves in arecanut and flaccidity, yellowing and necrosis of crown leaves in coconut were observed in Kerala and Karnataka states of India. Phytoplasma presence in symptomatic oil palm, arecanut and coconut was confirmed by nested PCR assays with phytoplasma specific universal primers. 16Sr DNA sequence analysis and phylogenetic relationship studies confirmed the presence of 16SrXI group phytoplasmas in spear rot disease of oil palm from Kollam and Wayanad districts and in yellow leaf disease of arecanut from Wayanad district of Kerala. However, 16SrXIV group phytoplasmas were identified from root (wilt) disease of coconut from Kollam district of Kerala and yellow leaf disease of arecanut from Sullia of Dakshina Kannada district of Karnataka. This is the first report of association of 16SrXIV group phytoplasma with root (wilt) disease of coconut and yellow leaf disease of arecanut. These studies indicated the possible involvement of more than one group of phytoplasmas (16SrXI and 16SrXIV) in palm diseases in South India.

Molecular characterization identifies 16SrXI-B group phytoplasma (‘Candidatus Phytoplasma oryzae’-related strain) associated with root wilt disease of coconut in India

The root wilt disease of coconut is a major threat to coconut cultivation in southern India. Here we report the species assignment and 16Sr sub group classification of phytoplasma associated with coconut root wilt disease. Leaf samples were collected from root wilt symptomatic palms in Kayankulam district of Kerala. The phytoplasma 16S rRNA gene was amplified using three sets of primers namely, 1F7/7R3-1F7/7R2, 3Fwd/3Rev-3Fwd/5Rev, and P1/P7-R16F2n/R16R2 producing amplicons of 490, 1300, and 1250bp respectively. Partial secA gene sequence of 480bp from root wilt disease phytoplasma was amplified using primers cocsf/cocsr. Sequence characterization and phylogenetic analysis of 16S rRNA and secA genes of root wilt disease phytoplasma grouped it with the rice yellow dwarf group phytoplasmas and identified coconut RWD phytoplasma as ‘Candidatus Phytoplasma oryzae’ related strain. Further, in silico restriction digestion study of phytoplasmal 16S rRNA gene region between primers R16F2n/R16R2 was performed for 16Sr group/sub group classification. The root wilt disease phytoplasma grouped with the 16SrXI group members. In the sub group classification it produced identical restriction profile as the sugarcane white leaf phytoplasma and arecanut yellow leaf disease phytoplasma, and hence, it was placed in the 16SrXI-B sub group.

First Report of Two Distinct Phytoplasma Species, 'Candidatus Phytoplasma cynodontis' and 'Candidatus Phytoplasma asteris,' Simultaneously Associated with Yellow Decline of Wodyetia bifurcata (Foxtail Palm) in Malaysia.

The foxtail palm (Wodyetia bifurcata), an Australian native species, is an adaptable and fast-growing landscape tree. The foxtail palm is most commonly used in landscaping in Malaysia. Coconut yellow decline (CYD) is the major disease of coconut associated with 16SrXIV phytoplasma group in Malaysia (1). Symptoms consistent with CYD, such as severe chlorosis, stunting, general decline, and death were observed in foxtail palms from the state of Selangor in Malaysia, indicating putative phytoplasma infection. Symptomatic trees loses their green and vivid appearance as a decorative and landscape ornament. To determine the presence of phytoplasma, samples were collected from the fronds of 12 symptomatic and four asymptomatic palms in September 2012, and total DNA was extracted using the CTAB method (3). Phytoplasma DNA was detected in eight symptomatic palms using nested PCR with universal phytoplasma 16S rDNA primer pairs, P1/P7 followed by R16F2n/R16R2 (2). Amplicons (1.2 kb in length) were generated from symptomatic foxtail palms but not from symptomless plants. Phytoplasma 16S rDNAs were cloned using a TOPO TA cloning kit (Invitrogen). Several white colonies from rDNA PCR products amplified from one sample with R16F2n/R16R2 were sequenced. Phytoplasma 16S rDNA gene sequences from single symptomatic foxtail palms showed 99% homology with a phytoplasma that causes Bermuda grass white leaf (AF248961) and coconut yellow decline (EU636906), which are both members of the 16SrXIV 'Candidatus Phytoplasma cynodontis' group. The sequences also showed 99% sequence identity with the onion yellows phytoplasma, OY-M strain, (NR074811), from the 'Candidatus Phytoplasma asteris' 16SrI-B subgroup. Sequences were deposited in the NCBI GenBank database (Accession Nos. KC751560 and KC751561). Restriction fragment length polymorphism (RFLP) analysis was done on nested PCR products produced with the primer pair R16F2n/R16R2. Amplified products were digested separately with AluI, HhaI, RsaI, and EcoRI restriction enzymes based on manufacturer's specifications. RFLP analysis of 16S rRNA gene sequences from symptomatic plants revealed two distinct profiles belonging to groups 16SrXIV and 16SrI with majority of the 16SrXIV group. RFLP results independently corroborated the findings from DNA sequencing. Additional virtual patterns were obtained by iPhyclassifier software (4). Actual and virtual patterns yielded identical profiles, similar to the reference patterns for the 16SrXIV-A and 16SrI-B subgroups. Both the sequence and RFLP results indicated that symptoms in infected foxtail palms were associated with two distinct phytoplasma species in Malaysia. These phytoplasmas, which are members of two different taxonomic groups, were found in symptomatic palms. Our results revealed that popular evergreen foxtail palms are susceptible to and severely affected by phytoplasma. To our knowledge, this is the first report of a mixed infection of a single host, Wodyetia bifurcata, by two different phytoplasma species, Candidatus Phytoplasma cynodontis and Candidatus Phytoplasma asteris, in Malaysia.

Evidence of 16SrXI group phytoplasma DNA in embryos of root wilt diseased coconut palms

The root wilt disease (RWD) is a major phytoplasma disease of coconut palms in South India. Phytoplasma belonging to the 16SrXI group has been associated with the disease. In our earlier studies we detected phytoplasma from leaves, inflorescence and roots of symptomatic palms in the nested PCR. In this work we examined the embryo from diseased palms for the presence of phytoplasma through semi-nested PCR assay with primers 1F7/7R3 - 1F7/7R2 specific for phytoplasma 16S rRNA gene. Out of 270 embryos collected in four rounds of sampling from two different locations, positive amplification was obtained for 45 (16.67 %) embryos. Sequencing and blastn analysis confirmed the presence of coconut root wilt phytoplasma. To check the potential seed transmission of phytoplasma, mature nuts from diseased palms were germinated in poly bags under disease free conditions and seedlings were sampled for DNA isolation and nested PCR analysis. But phytoplasma DNA could not be detected in any of the seedlings raised in poly bags.

Phytoplasma distribution in coconut palms affected by lethal yellowing disease

Lethal yellowing (LY), the most devastating disease affecting the coconut palm in America, is caused by phytoplasmas known to be distributed in different parts of infected plants. However, no comprehensive reports exist on the phytoplasma distribution. This study refers to the detection of LY phytoplasma DNA using PCR in different coconut plant parts, throughout the development of the disease. Sample analysis of positive palms taken at different stages of disease development (either symptomatic or symptomless) showed differences in the percentage of LY detection between plant parts. Some parts showed a very high level of LY DNA (stem, young leaves, inflorescences, stem apex and root apex), low levels were found in the intermediate leaves and roots without apex, whereas no LY phytoplasma DNA was detected in mature leaves. The detection percentage of LY phytoplasma DNA was lowest in symptomless-infected palms for all parts, except the stem, where phytoplasma accumulations were consistently detected. This pattern of detection among parts is consistent with the hypothesis that phytoplasmas move from photosynthate source tissues to sink tissues via the phloem mass flow process. The accumulations in the (lower) stem, prior to the appearance of symptoms, suggest that this part of the palm is where phytoplasmas first move from leaves after foliar feeding by vectors and in which they probably multiply and distribute to other palm parts, including roots. Embryos from infected palms were analysed by nested-PCR and 28% of 394 embryos were positive. Phytoplasma DNA was detected in embryos from fruit on any of the fruiting bunches regardless the age, but no pattern of quantitative distribution throughout the bunch developmental stages was observed. Germination of seeds from LY-positive symptomatic palms was 58% and from LY-negative symptomless palms were 71%. No phytoplasma was detected in seedlings tested from both symptomatic and non-symptomatic palms. Seedlings tested after 2 years did not develop LY symptoms or eventually died.

First Report of Fusarium Wilt Caused by Fusarium oxysporum f. sp. canariensis on Canary Island Date Palm in Texas and South Carolina.

Canary Island date palm (Phoenix canariensis) is native to the Canary Islands and widely grown throughout the world as an ornamental. At a home site in Austin, TX in May 2008 and a commercial site near Charleston, SC in December 2009, declining Canary Island date palms were observed. Symptoms included individual leaves with chlorotic or necrotic leaflets on one side of the leaf blade (one-sided wilt or death) and a distinct reddish brown stripe along the petiole and rachis. Cross-sections through the petiole or rachis exhibited discoloration of internal tissue. Fusarium oxysporum was isolated from the internal petiole or rachis tissue of each palm sample onto one-quarter-strength potato dextrose agar (PDA). Typical macroconidia in pale orange sporodochia, microconidia in false heads on short monophialides, and chlamydospores were observed (2). Macroconidia were mostly 3-septate, slightly curved, and ranged from 3.8 to 4.2 × 42.9 to 46.5 μm. Microconidia were single cell, oval to reniform, and ranged from 2.5 to 2.9 × 7.2 to 7.8 μm. Single-spore isolates grown on full-strength PDA (12-h light and 26°C) produced abundant white-to-pale lavender mycelia with a purple pigment in the agar. One isolate from each location (PLM-385B from Texas and PLM-511A from South Carolina) was selected for pathogenicity tests and molecular characterization. The translation elongation factor 1-α gene (EF-1α) was amplified in each isolate by PCR using the ef1 and ef2 primers (1). Products were sequenced and queried for similarity against the NCBI database and the FUSARIUM-ID database ( http://isolate.fusariumdb.org/index.php ) (1) using the BLAST search tool. In both databases, both isolates matched F. oxysporum f. sp. canariensis strain NRRL 26035 (GenBank Accession No. AF008485; FD_01211) at 100% sequence similarity. Sequences for PLM-385B and PLM-511A have been deposited in the NCBI database (GenBank Accession Nos. HM591537 and HM591538, respectively). Pathogenicity of these two isolates was tested on three-leaf Canary Island date palm seedlings. There were five replicate palms per isolate and control treatment. All potting mix was shaken from the roots and three groups of five seedlings were placed in small buckets. Twenty-five milliliters of a 106 conidia ml-1 suspension was pipetted down among the leaf bases and the excess drained onto the roots. Control palms received sterile water. Seedlings were covered with plastic for 48 h and then transplanted into separate growing containers. Ten weeks after inoculation, initial symptoms of a leaf wilt (off-color and folded over) were observed on some of the inoculated palms. After 4 months, all palms inoculated with PLM-511A were dead and three of the five palms inoculated with PLM-385B were dead. The pathogen was reisolated from diseased palms. All five control palms remained healthy. While the symptomatic palm in Texas had been in the home site approximately 2 years, which implied the palm could have been already infected when transplanted, the palm in South Carolina had been planted in 1990. To our knowledge, this is the first report of Fusarium wilt of Canary Island date palm in Texas and South Carolina. Previously in the United States, the disease had only been noted in California, Florida, and Nevada.

First Report of Bud Rot Caused by Phytophthora palmivora on African Oil Palm in Colombia.

A bud rot disease, referred to as "pudricion del cogollo" or PC (for its name in Spanish), is a major disease of oil palm in four production areas of Colombia. Even though the disease has been studied for more than 40 years in Central and South America, the causal agent remained unknown (1). Infection first develops in the palm heart (cogollo) above the meristematic zone. Initial external symptoms appear as necrotic lesions on the sides of the spear leaf (youngest, unexpanded leaf) and the sizes of the lesions remain static as tissues emerge, expand, and mature. Under favorable environmental conditions (temperature around 26°C and relative humidity above 80%), further rotting of the heart eventually destroys the bud. A baiting technique with papaya and cocoa fruits was successfully used to trap the causal agent from symptomatic spear leaf tissue collected from the provinces of Nariño and Santander (2), where the disease is severe. Small, triangular-shaped pieces were removed from healthy fruits that had been surface sterilized, and a corresponding piece of diseased oil palm tissue was inserted into the hole and sealed with the removed fruit tissue. The whole fruit was wrapped with plastic and incubated at 25°C. Once the fruit traps showed initial necrotic symptoms, fruit tissue from the advancing point of the lesions was plated on Phytophthora-selective media. Four isolates of Phytophtora palmivora, all A2 mating type, were obtained during this study and each presented similar white and depressed mycelium when grown on oatmeal agar (OMA) medium. Papillated, ellipsoidal sporangia with short pedicels had an average size of 37.1 (breadth) × 52.8 μm (length). Chlamydospores averaged 35.1 μm in diameter and were similar to those observed in diseased palm tissue. DNA from the Phytophthora isolates was used as a template for PCR using ITS1/ITS4 primers. BLASTn analysis of the ITS sequences (GenBank Accession No. GQ398157) showed 99.9% homology with P. palmivora. The sequences of the four isolates were identical. For pathogenicity testing, cultures were grown on OMA. Two milliliters of distilled water containing 40,000 sporangia were injected into the base of the spear leaf of 105 nursery palms; the same number of palms was injected with 2 ml of distillated water as controls. Initial PC symptoms were observed 3 to 4 days after inoculation on 85% of inoculated palms and 15% of these palms developed typical bud rot symptoms under favorable conditions. No symptoms were observed on the controls. The presence of Phytophthora was confirmed by light microscopy and P. palmivora was reisolated from symptomatic palms with the fruit-baiting technique. The presence of Phytophthora in the four Colombian growing areas was also confirmed using Agdia (Elkhart, IN) immunostrips followed by DNA extraction from the Immunostrip wick and ITS sequencing to confirm the species. To our knowledge, this is the first report of P. palmivora causing PC on oil palm in Colombia.

Molecular Detection of 16SrXI Group Phytoplasma Associated with Root (Wilt) Disease of Coconut (Cocos nucifera) in India.

Coconut palm (Cocos nucifera L.), a versatile tree crop with multifarious uses, is important for the livelihood security of millions of people in India. Root (wilt) disease (RWD) is a major production constraint causing an estimated yield loss of 968 million nuts in southern India. Affected palms show bending of leaflets (flaccidity), foliar yellowing, and marginal necrosis. Phytoplasmas have been observed to be associated with this disease by electron microscopy (EM) and transmission (3) but not characterized. Attempts made in the past decade to detect a phytoplasma associated with RWD through PCR using universal primers had inconsistent results so we designed two primer sets (1F7 [AGTGCTTAACACTGTCCTGCTA]/7R3 [TTGTAGCCCAGATCATAAGGGGCA], 3Fwd [ACCTGCCTTTAAGACGAGGA]/3Rev [AAAGGAGGTGATCCATCCCCACCT]) and seminested primer pair 1F7/7R2 (GACAAGGGTTGCGCTCGTTTT), 3Fwd/5Rev (ACCCCGAGAACGTATTCACCGCGA) from sequencing of a 1.8-kb fragment (GenBank No. FJ794816) amplified by primers P1/P7 from a diseased sample. These new primer pairs were used for the detection of phytoplasma from five symptomatic and five asymptomatic palms from Kasaragod (where disease is not endemic), 14 symptomatic palms from Kayamkulam (endemic area), and 10 palms from disease-free areas (Kidu, Karnataka) using PCR. DNA was extracted from 3 g of spindle leaf (two to three leaflets) midrib tissues using a modified phytoplasma enrichment protocol in which an addition of 5% polyvinylpolypyrrolidone (MW of 40,000) during tissue grinding was essential. PCR was performed for 35 cycles with an annealing temperature of 63°C to avoid nonspecific amplification. A 1.3-kb amplicon was seen in two of the five samples and the positive control sample (sugarcane grassy shoot DNA) using the seminested primer pair 3Fwd/3Rev-3Fwd/5Rev. The amplicons were cloned and sequenced and a representative sequence was deposited in GenBank (GQ850122). With the 1F7/7R3-1F7/7R2 seminested primers, a 493-bp product was obtained from 13 of 14 palms from Kayamkulam and all five diseased palms from Kasaragod. No amplification was seen from healthy palms. A BLAST search showed that the RWD phytoplasma 16S rRNA gene sequence has >96% nt identity with 16SrXI and 16SrXIV group phytoplasmas and 99% identity with sugarcane white leaf phytoplasma (AB052874), On the basis of the identity of the 16Sr RNA gene 3Fwd/5Rev region, RWD phytoplasma belongs to the 16SrXI group. A phylogenetic tree (neighbor-joining method) also revealed clustering of the coconut phytoplasma with the 16SrXI group phytoplasmas and virtual restriction fragment length polymorphism analysis (4) also placed it into group 16SrXI. Other phytoplasmas infecting coconut are found in groups 16SrIV (1) and 16SrXIV (2). Our RWD phytoplasma sequence does not match an earlier reported Kerala (wilt) coconut phytoplasma sequence (AY158660) and the latter sequence does not have similarity with any known phytoplasma sequences in the database. To our knowledge, this is first report of the association of 16SrXI group phytoplasma with the root wilt disease of coconut in India. These findings could be used for the early detection of root wilt disease phytoplasma in breeding materials and to develop a DNA-based diagnostic kit.

Molecular Characterization of a Phytoplasma Associated with Coconut Yellow Decline (CYD) in Malaysia

Problem statement: Molecular methods have been used to detect phytoplasma in Malayan Red Dwarf (MRD) ecotype of coconut for the first time in Malaysia. Detect phytoplasma from coconut showing yellowing symptoms by nested PCR and Classify phytoplasma associated with disease of coconut palms, based on analysis of 16S rRNA gene operon sequences and virtual RFLP. Approach: Twenty MRD symptomatic palms were tested. Leaf spear, inflorescence and wood shavings from trunks of coconut palms showing yellowing symptoms were harvested from Serdang located in Selangor state. PCR assays and sequence analysis were carried out. Results: Nested PCR with primer pairs R16F2n/R16R2 and fU5/rU3 resulted in amplification of products of approximately 1.2 kb and 890 bp respectively, from 8 out of 20 MRD symptomatic palms tested. Sequence analysis of the 16S rDNA PCR products determined that the phytoplasma strain associated with Coconut Yellow Decline (CYD) in MRD ecotype belongs to the 'Candidatus Phytoplasma cynodontis' (16SrXIV) group of phytoplasmas. In addition, nested R16F2n/R16R2 PCR products from 6 spear leaves and 2 inflorescences from MRD palms showed high sequence similarity to the 16S rRNA gene from coconut chloroplasts, with a similar size (approximately 1.3 kb) and a further 5 R16F2n/R16R2 PCR products from MRD inflorescences showed high sequence similarities to Bacillus spp. 16S rRNA gene sequences. Conclusion: These results indicate that sequencing is a reliable method for the detection. Furthermore, trunk borings are the most reliable source of DNA for phytoplasma detection in coconuts using 16S rRNA gene primers, since there is less co-amplification of PCR products from other organisms when compared to spear leaves and inflorescences, nor from the spear leaves and inflorescences of MRD palms when primers fU5/rU3 were used in nested PCR.

Detection and Characterization of a Lethal Yellowing (16SrIV) Group Phytoplasma in Canary Island Date Palms Affected by Lethal Decline in Texas.

Polymerase chain reaction (PCR) assays were used to detect phytoplasmas in Canary Island date (Phoenix canariensis) palms displaying symptoms similar to lethal yellowing (LY) disease in Corpus Christi, TX. An rDNA product (1.8 kb) was amplified consistently from 10 of 11 palms by PCR employing phytoplasma universal rRNA primer pair P1/P7. Also, AluI endonu-clease digests and sequencing of P1/P7 products revealed that nontarget Bacillus megaterium-related rDNA sequences of similar size were co-amplified along with phytoplasma rDNA from 10 palms. A 1,402-bp product was obtained from all 11 symptomatic palms when initial P1/P7 products were reamplified by PCR employing nested LY phytoplasma group-specific 16S rRNA primer pair LY16Sf/LY16Sr. Restriction fragment length polymorphism (RFLP) analysis of nested PCR products revealed that palm-infecting phytoplasmas were uniform and most similar to strains composing the coconut lethal yellowing phytoplasma (16SrIV) group. Sequence analysis of 16S rDNA determined the Texas Phoenix palm decline (TPD) phytoplasma to be phylogenetically closest to the Carludovica palmata leaf yellowing (CPY) phytoplasma. rDNA profiles of strains TPD and CPY obtained with AluI were co-identical and distinct from other known 16SrIV group phytoplasmas. On this basis, both strains were classified as members of a new subgroup, 16SrIV-D.

Specific Identification of Coconut Tinangaja Viroid for Differential Field Diagnosis of Viroids in Coconut Palm

ABSTRACT Tinangaja is a widespread lethal disease of putative viroid etiology affecting coconut palm on the island of Guam. Determination of its distribution and mode of spread requires a simple and reliable diagnostic procedure that is specific for the associated coconut tinangaja viroid (CTiVd). A method of extracting tissue followed by analytical agarose gel electrophoresis for CTiVd detection has been developed and used to identify the viroid in leaf samples of suspect symptomatic palms growing in the field. Two-dimensional polyacrylamide gel electrophoresis showed that the viroid band contained circular molecules that are typical for viroids. Confirmation of the identity of CTiVd and detection of low levels of viroid below the threshold of detection by agarose gel electrophoresis was achieved either by diagnostic oligonucleotide-probe (DOP) hybridization assay or by reverse-transcription polymerase chain reaction (RT-PCR) with the oligonucleotide probe as one of the two PCR primers. RT-PCR was not substantially more sensitive than DOP-hybridization assay. This procedure also was applicable to coconut cadang-cadang viroid (CCCVd), and oligonucleotide probes designed to be specific for either CTiVd or CCCVd distinguished between these two viroids in coconut leaf extracts. This strategy provides a rapid and specific indexing procedure for the two characterized viroids of coconut palm and will be applicable to further studies on the viroid-like sequences previously reported in tropical monocotyledons.

Detection of the mycoplasma‐like organism associated with lethal yellowing disease of palms in Florida by polymerase chain reaction

DNA amplification by polymerase chain reaction (PCR) was used specifically to detect the mycoplasma‐like organism (MLO) associated with lethal yellowing disease of palms in Florida. For PCR, a pair of oligonucleotide primers was synthesized according to partial sequences of a cloned 1·3 kbp fragment of lethal yellowing MLO‐specific genomic DNA isolated from a diseased windmill palm (Trachycarpus fortunei). A DNA product of about 1 kbp was specifically amplified by PCR in reaction mixtures containing template DNA derived from either heart, inflorescence or leaf tissues of lethal yellowing‐affected palms. PCR performed for 35 cycles with as little as 5 pg of DNA template, in some instances, was sufficient consistently to amplify the same lethal yellowing MLO DNA product from hearts of 11 species comprising 30 symptomatic palms. Similar reliable and reproducible detection of the lethal yellowing MLO in palm inflorescence spikelets was also achieved after 35 cycles of PCR. When template DNA for PCR was derived from tissues of the the most immature emerging leaf, a 40‐cycle reaction was sufficient for consistent foliar detection of the pathogen in all coconut palms including palms with earliest visible symptoms of disease.