SV40-transformed Cell Line Research Articles

Simian virus 40-, but not human papillomavirus-, transformation of prostatic epithelial cells results in loss of growth-inhibition by 1,25-dihydroxyvitamin D-3

In addition to its well known calcemic actions, 1,25-dihydroxyvitamin D-3 [1,25(OH)(2)D] exhibits differentiating and antiproliferative effects in several types of cancer cells. 1,25(OH)(2)D receptors (VDR) as well as 1,25(OH)(2)D-mediated growth-inhibition have been demonstrated in human prostate cancer cell lines. In order to further develop model systems for the study of 1,25(OH)(2)D action and to elucidate the mechanism of growth-inhibition, we studied several human prostate cell lines immortalized with either simian virus 40 (SV40) or human papillomavirus type 18 (HPV). The SV40-transformed cell lines P69SV40-T and P153SV40-T were not growth-inhibited by 1,25(OH)(2)D at concentrations as high as 100 nM, whereas the HPV-transformed cells PZ-HPV-7 and CA-HPV-10 were growth-inhibited. All cell lines expressed VDR, and VDR mRNA was demonstrated by Northern blot analysis. All cells exhibited induction of 24-hydroxylase mRNA, a 1,25(OH)(2)D responsive gene, after 1,25(OH)(2)D treatment. In an attempt to understand the apparent dissociation of 1,25(OH)(2)D actions in the SV40-transformed cells, we turned to the human prostate cancer cell line DU 145. These cells, like the SV40-transformed cells, are not growth-inhibited but demonstrate induction of 24-hydroxylase mRNA after 1,25(OH)(2)D treatment. DU 145 cells contain a mutated retinoblastoma gene (Rb) which contributes to their uncontrolled growth, analogous to the disruption of Rb by SV40 and HPV. We compared DU,145 cells to DU 145 cells transfected with normal Rb (DU 145/Rb). Similar to DU 145, DU 145/Rb cells were not growth-inhibited by 1,25(OH)(2)D, while 24-hydroxylase mRNA was induced. These results suggest that divergent pathways mediate the growth-inhibitory effect of 1,25(OH)(2)D and its induction of 24-hydroxylase. It also appears that the antiproliferative effect of 1,25(OH)(2)D is mediated by an Rb-independent mechanism.

Failure to confirm presence of SV40 sequences in human tumours

THE MONKEY polyomavirus, simian virus 40 (SV40), is a potent tumour-inducing virus in laboratory animals. Although SV40 has not been associated with human disease [l, 21, DNA sequences similar to those of SV40 have been found recently in ependymomas and choroid plexus tumours of chidren using a polymerase chain reaction (PCR) technique [3]. Our interest in the possibility that these sequences may be involved in the oncogenesis of other malignancies prompted us to reproduce and further investigate these data. DNA from ependymomas was provided by H. Budka (Institute of Neuropathology) and an SV40-transformed rat fibroblast cell line by Ch. Czerni (Institute for Cancer Research). DNA was isolated from paraffin-embedded tissue and cell homogenates using standard methods. As DNA in paraffinembedded tissue can be degraded, isolation of intact DNA was proven by amplification of [{-globin sequences. To achieve high sensitivity for the amplification of SV40 DNA, we used a nested PCR protocol with outer primers: SVO for S’TGATGAATGGGAGCAGTGGTGGAA 3’; SVO.rev 5’ CCCACCTGGCAAACTTTCCTCAAT 3’, amplifying a 490 bp fragment, followed by a second PCR withinner primers SV.for3 and SV.rev, as used by Bergsagel and associates [3]. The products were analysed on agarose gels and stained with ethidium bromide. Figure 1 shows dilution experiments of DNA

Retinoic acid enhances plasminogen activation on the cell surface

The importance of cell-associated plasminogen activation in the extracellular matrix degradation processes is becoming increasingly evident. To elucidate the modulators of net plasminogen activation on the cell surface, we have recently established an assay system. Using this system, we examined the effects of several candidate modulators on cell surface plasminogen activator activity in the human fibrosarcoma cell line HT-1080 and the SV40-transformed human lung fibroblast cell line WI-38 VA 13 2RA. Although the majority of the candidates had no effect or a selective effect on either cell line, only retinoic acid markedly enhanced cell surface plasminogen activator activity in both HT-1080 and WI-38 VA13 2RA cells in a time-dependent manner. The effect of retinoic acid was neutralized by actinomycin D. The enhanced activity was inhibited by anti-uPA IgG and by pretreatment with phosphatidylinositol-specific phospholipase C. These findings suggest that retinoic acid increases the amount of receptor-bound uPA via de novo synthesis, and that it plays an important role in modulating cell-associated plasminogen activation.

Construction of 110 Cosmid Markers and a 4.5-Mb YAC Contig on Human Chromosome 8p12-q11

Microcell hybrids containing various regions of human chromosome 8 were formed by microcell-mediated transfer of neo-tagged chromosome 8 into the cells derived from severe combined immunodeficiency (SCID) mouse. Thus, 110 cosmid markers were isolated from SV40-transformed SCID fibroblast cell line (SCVA) containing a p12-q11.1 region of human chromosome 8 and were assigned to eight regions in 8p12-q11.1, using a microcell-hybrid panel. For positional cloning of a human gene that restores the DNA-repair defect in a mouse with SCID on 8p11.1-q11.1 (SCID region), we constructed a yeast artificial chromosome (YAC) contig of about 4.5 Mb. Overlapping YACs were further aligned by restriction mapping, using rare-cutting restriction endonucleases. The cosmids and YAC contig should facilitate isolation of the SCID gene and other genes, such as the Werner syndrome-responsible gene in or near this region.

ALTERED GROWTH-REGULATION OF PROSTATIC EPITHELIAL-CELLS BY HUMAN PAPILLOMAVIRUS-INDUCED TRANSFORMATION

Six lines of human papillomavirus (HPV)-transformed prostatic epithelial cells, clonally-derived from transfection of three different parental cell strains, were analyzed for their ability to respond to stimulatory and inhibitory factors known to regulate prostatic cell growth. The cell lines were tested in a serum-free medium that was developed specifically for analysis of low-density growth of prostatic cells in order to mitigate any effects of autocrine factors. This medium has been used previously to characterize the growth regulatory pathways of primary cultures of prostatic epithelial cells derived from normal, benign prostatic hyperplasia (BPH), or adenocarcinoma tissues, as well as an SV40-transformed cell line (pRNS-1-1) that was derived from the same parental cell strain as four of the HPV-transformed lines used in the present study. The responses of the HPV-transformed cell lines to three essential mitogens in the medium - epidermal growth factor (EGF), bovine pituitary extract (BPE) and insulin-like growth factor (IGF) - were similar to those of primary cultures and pRNS-1-1, except that two of the HPV-transformed cell lines were IGF-independent for growth. The presence or absence of cholera toxin (CT), which acts synergistically with peptide growth factors, only mildly affected the proliferation of HPV-transformed cells, which is also true for primary cultures and pRNS-1-1. However, while hydrocortisone (HC) also has only minimal effect on the growth of primary cultures and pRNS-1-1, four of the HPV-transformed lines were very dependent on HC for growth. With regard to growth-inhibitory factors, all of the cell lines (HPV- or SV40- transformed) were insensitive to tumor necrosis factor-alpha (TNFalpha), which is a common feature of transformed cells. However, the cell lines remained sensitive to the growth-inhibitory properties of retinoic acid (RA) and transforming growth factor-beta (TGF(beta)). The HPV-transformed cell lines were also inhibited by 1,25(OH)(2) vitamin D-3 [1,25(OH)(2)D-3], although pRNS-1-1 cells were not. Perhaps the most unexpected finding in our study was the apparent loss of responsiveness of all of the transformed lines to fibroblast growth factor (FGF). Alterations in FGF pathways have been described for prostatic cancer cell lines and changes in expression of FGF or receptors may be involved in prostatic carcinogenesis. Our study demonstrates that the availability of primary cultures, SV40- and HPV- transformed cell lines and a well-defined culture system will provide an opportunity to characterize the processes involved in malignant transformation of prostatic cells.

Quantitative cytofluorimetric determination of cell membrane‐associated large tumor antigen on SV40‐transformed cells

The aim of this study was to quantitate the number of cell membrane-located SV40 large tumor antigen (large T) molecules of SV40-transformed cell lines by cytofluorimetric analysis. Five different SV40-transformed cell lines were labelled by either a biotin- or a fluorescein-conjugated monoclonal antibody, PAb1605, which is specific for the large T carboxyterminus. The conjugated-antibody fluorescence signals of the stained large T molecules of transformed cells were measured via cytofluorimetry. Comparison of the fluorescence signals of calibrated beads bearing a known number of fluorescein molecules to the signals of conjugated PAb1605 antibodies bound on microbeads to a defined number of IgG binding sites made it possible to determine the number of antibody-accessible large T molecules per SV40-transformed cell. The numbers (x10(-4)) found per cell were 1.0 (ELONA, hamster), 3.0 (VLM, mouse), 3.5 (mKSA, mouse), 11 (C57SV, mouse), and 5.5 (SV80, human), respectively. Thus, the technique described allows a precise quantitation of surface-exposed, antibody-accessible viral antigen expression.

ANG II is a mitogen for a murine cell line isolated from medullary thick ascending limb of Henle's loop.

A murine SV40-transformed renal epithelial cell line derived from medullary thick ascending limb of Henle's loop (MTAL) was established and characterized by morphology, antigen expression, and biochemical criteria. These MTAL cells express a single class of high-affinity receptors for angiotensin II (ANG II) and transcripts for the AT1 subtype of ANG II receptors. ANG II, in a dose-dependent manner, induced proliferation of MTAL cells. This observation is in striking contrast to syngeneic proximal tubular cells in which it was previously shown that the peptide induced cellular hypertrophy and slightly inhibited proliferation [G. Wolf and E. G. Neilson. Am. J. Physiol. 259 (Renal Fluid Electrolyte Physiol. 28: F768-F777, 1990]. The AT1-receptor antagonist losartan (10(-6) M), but not an AT2-receptor antagonist, blocked the mitogenic effects of ANG II in MTAL cells. Coincubation of quiescent MTAL cells with ANG II and 5% fetal calf serum further increased proliferation compared with cells grown only in serum. In contrast to proximal tubular cells, ANG II failed to induce transforming growth factor-beta 1 mRNA and protein synthesis in MTAL cells. Our data collectively suggest that ANG II is a mitogen for MTAL cells in vitro. Therefore, epithelial cells derived from different parts of the nephron, even when transformed with SV40 virus and while under cell culture conditions, exhibit a distinct pattern of growth behavior after stimulation with ANG II.

Development and characterization of a human marrow stromal cell line that enhances osteoclast-like cell formation.

We established a human bone marrow stromal cell line (Saka) by infecting marrow adherent cells from semisolid marrow cultures with a recombinant simian virus-40 (SV40) virus. The cells expressed SV40 large tumor antigen, had a fibroblast-like shape, and expressed fibronectin and vimentin. They did not contain detectable alkaline phosphatase activity; express myeloid, lymphoid, or factor VIII-associated antigens; or develop adipocyte-like characteristics with dexamethasone treatment. Polymerase chain reaction analysis of Saka cell RNA detected expression of messenger RNAs for interleukin-6 (IL-6), IL-1 beta, granulocyte-macrophage colony-stimulating factor, macrophage colony-stimulating factor, stem cell factor, and the 1,25-dihydroxyvitamin D3 receptor. Coculture of Saka cells with human marrow mononuclear cells enhanced formation of osteoclast-like multinucleated cells (MNC) in long term human bone marrow cultures. These MNC expressed calcitonin receptors and formed resorption lacunae on dentine. In contrast, coculture of marrow mononuclear cells with other SV40-transformed human marrow stromal cell lines did not increase MNC formation. Conditioned medium from Saka cells or coculture of bone marrow and Saka cells separated by a Millipore membrane did not enhance MNC formation. Addition of a neutralizing antibody to IL-6 or IL-1 beta blocked the effects of Saka cells on MNC formation. These results suggest that marrow stromal cells enhance osteoclast formation in part through direct cell to cell contact and production of IL-6 and/or IL-1 beta.

Oxygen metabolites modulate sodium transport in gerbil middle ear epithelium: involvement of PGE2

The middle ear epithelium and respiratory epithelia share basic properties such as homeostasis of air-filled cavities and mucociliary clearance toward the pharynx. With the middle ear SV40-transformed (MESV) cell line, we used the short-circuit current (Isc) technique to investigate changes in ion transport induced by oxidants. Xanthine and xanthine oxidase on the basal side of the monolayers dramatically increased Isc up to 50%. This effect was not affected by superoxide dismutase or mannitol, but could be blunted by catalase or 1,3-dimethyl-2-thiourea. Increasing concentrations of H2O2 from 10(-5) to 5 x 10(-4) M produced a dose-dependent increase in Isc from 0.26 +/- 0.16 up to 4.21 +/- 0.43 microA/cm2 (P < 0.05, n = 5). Concentration of half-maximal stimulation (EC50) was 4.68 x 10(-5) M. This effect was inhibited by indomethacin and was related to a sodium transport, since the H2O2-induced increase in Isc could be prevented or abolished by 1) apical addition of benzamil (10(-6)M) and 2) substitution of sodium with N-methyl-glucamine. H2O2 exposure also induced indomethacin-sensitive increase in released prostaglandin (PG) E2 (EC50 = 5.62 x 10(-5) M) and in cAMP content (EC50 = 3.95 x 10(-5) M) with similar kinetics. These results suggest that exposure of MESV cells to oxidants stimulates the production of PGE2, which in turn increases the transepithelial sodium transport rate.

Spontaneous chromosomal aberrations in Fanconi anaemia, ataxia telangiectasia fibroblast and Bloom's syndrome lymphoblastoid cell lines as detected by conventional cytogenetic analysis and fluorescence in situ hybridisation (FISH) technique

Several primary and transformed human cell lines derived from cancer prone patients are employed routinely for biochemical and DNA repair studies. Since transformation leads to some chromosomal instability a cytogenetic analysis of spontaneous chromosome aberrations in fibroblast cell lines derived from patients with Fanconi anaemia (FA), ataxia telangiectasia (AT), and in lymphoblastoid cell lines derived from patients with Bloom's syndrome (BS), was undertaken. Unstable aberrations were analysed in Giemsa stained preparations and the chromosome painting technique was used for evaluating the frequencies of stable aberrations (translocations). In addition, the frequency of sister-chromatid exchanges (SCEs) was determined in differentially stained metaphases. The SV40-transformed fibroblasts from these cell lines have higher frequencies of unstable aberrations than the primary fibroblasts. In the four lymphoblastoid cell lines derived from BS patients higher frequencies of spontaneously occurring chromosomal aberrations in comparison to normal TK6wt cells were also evident. The frequency of spontaneously occurring chromosome translocations was determined with fluorescence in situ hybridisation (FISH) and using DNA libraries specific for chromosomes 1, 2, 3, 4, 7, 8, 11, 14, 19, 20 and X. The translocation levels were found to be elevated for primary FA fibroblasts and lymphoblastoid cells derived from BS patients in comparison with control cell lines, hetero- and homozygote BS cell lines not differing in this respect. The SV40-transformed cell lines showed very high frequencies of translocations independent of their origin and almost every cell contained at least one translocation. In addition, clonal translocations were found in transformed control TK6wt and AT cell lines for chromosomes 20 and 14, respectively. The spontaneous frequencies of SCEs were similar in transformed fibroblasts derived from normal individuals and AT patients, whereas in SV40-transformed FA cells these were higher (4-fold). Among cell lines derived from BS patients, heterozygote lines behaved like control, whereas in homozygote cell lines very high frequencies of SCEs (about 12-fold) were evident.

FISH analyses of a newly established thyroid tumor cell line showing a t(1;19)(p35 or p36.1;q13) reveal that the breakpoint lies between 19q13.3-13.4 and 19q13.4.

Translocations involving the long arm of human chromosome 19 are specific chromosomal alterations found in a subset of benign thyroid tumors. In the present communication we describe the establishment of an SV40-transformed cell line derived from a thyroid adenoma with a t(1;19)(p35 or p36.1;q13). Cytogenetic studies were carried out on this cell line, using a series of cosmids mapping along the long arm of chromosome 19. In situ hybridization with probes for RYR1, ATP1A3, BCKDHA, ERCC1, POLD1, and TRPT revealed that only TRPT mapped distal to the breakpoint of the translocation. The results indicated that the breakpoint is located between POLD1 and TRPT at the boundary between chromosome bands 19q13.3 and 19q13.4.

Selective Cytotoxicity of Transformed Cells but Not Normal Cells by a Sialoglycopeptide Growth Regulator in the Presence of Tumor Necrosis Factor

The tumor necrosis factor-α (TNF)-resistant, SV40-transformed, murine fibroblast cell lines, F5b and F5m, became sensitive to TNF-mediated cytolysis after treatment with a biologically active 18 kDa peptide fragment (SGP) derived from a 66-kDa parental cell surface sialoglycoprotein. Neither TNF nor the SGP alone exhibited cytotoxicity to the two SV40-transformed cell lines. However, Balb/c 3T3 cells, incubated with SGP alone or with SGP and TNF, were not killed. Therefore, SGP can selectively sensitize cells for TNFα-mediated cytotoxicity. This selective sensitization may be due to the previously documented ability of the SGP to selectively mediate cell cycle arrest.

Characterization of spontaneous and induced mutations in SV40-transformed normal and ataxia telangiectasia cell lines.

Spontaneous and induced mutations at the HPRT locus were analyzed in one normal (MRC5CV1) and one ataxia telangiectasia (AT5BIVA) SV40-transformed cell line derived from male donors. Multiplex PCR and Southern analyses revealed a high frequency of spontaneous deletion mutations that may be a consequence of the SV40 transformation. Four mutagens (ethyl methanesulfonate, bromodeoxyuridine, bleomycin, adriamycin), which differ in their types of primary DNA lesions, caused specific patterns of mutations. By using fluorescence in situ hybridization (FISH) techniques, we were able to show that more than 90% of the AT5BIVA cells contained two X chromosomes with HPRT alleles, while in more than 90% of the MRC5CV1 cells genomic hemizygosity for the HPRT gene was found. Taking into account these findings we found that the AT5BIVA cell line possesses spontaneous hypermutability as well as hypersensitivity and hypermutability to bleomycin (BLM) and adriamycin (AM). Both mutagens induced deletion mutations in both cell lines, but more complex mutations and larger deletions were found in AT5BIVA cells.

Heat shock-induced cell death in murine microvascular endothelial cells depends on priming with tumor necrosis factor-alpha or interferon-gamma.

We previously reported that sequential exposure of cultured porcine aortic endothelial cells to lipopolysaccharide (LPS) and then to inducers of the heat shock response resulted in lethal injury by programmed cell death. In these present experiments, we evaluated the ability of other mediators of sepsis to prime endothelial cells for subsequent injury upon heat shock induction. We used SVEC4-10 microvascular endothelial cells, a cloned SV40-transformed cell line derived from LPS-resistant C3H/HeJ mice. When these endothelial cells were treated first with tumor necrosis factor-alpha followed by induction of the heat shock response with either heat or sodium arsenite (As), a standard chemical inducer of the heat shock response in vitro, a tumor necrosis factor dose-dependent cytotoxicity was observed, similar to that which we had seen previously in porcine endothelial cells primed with LPS. Subsequent experiments found that priming with interferon-gamma produced a similar dose-dependent toxicity upon heat shock with either heat or As. The reducing agents dithiothreitol and n-acetylcysteine, which we have previously shown to inhibit heat shock-induced programmed cell death in LPS-primed porcine endothelial cells, were also effective in protecting against heat shock-induced death following cytokine-priming in this microvascular cell line, suggesting that the intracellular signaling pathways of these priming agents are somewhere convergent. These data suggest that both exogenous and endogenous mediators of inflammation can prime endothelial cells for subsequent injury upon induction of the heat shock response, and are consistent with the emerging concept of redundancy in inflammatory signaling.

Endogenous butyrylcholinesterase in SV40 transformed cell lines: COS-1, COS-7, MRC-5 SV40, and WI-38 VA13

Comparison of proteins expressed by SV40 transformed cell lines and untransformed cell lines is of interest because SV40 transformed cells are immortal, whereas untransformed cells senesce after about 50 doublings. In MRC-5 SV40 cells, only seven proteins have previously been reported to shift from undetectable to detectable after transformation by SV40 virus. We report that butyrylcholinesterase is an 8th protein in this category. Butyrylcholinesterase activity in transformed MRC-5 SV40 cells increased at least 150-fold over its undetectable level in MRC-5 parental cells. Other SV40 transformed cell lines, including COS-1, COS-7, and WI-38 VA13, also expressed endogenous butyrylcholinesterase, whereas the parental, untransformed cell lines, CV-1 and WI-38, had no detectable butyrylcholinesterase activity or mRNA. Infection of CV-1 cells by SV40 virus did not result in expression of butyrylcholinesterase, showing that the butyrylcholinesterase promoter was not activated by the large T antigen of SV40. We conclude that butyrylcholinesterase expression resulted from events related to cell immortalization and did not result from activation by the large T antigen.

Loss of apc protein expressed by human colonic epithelial cells and the appearance of a specific low‐molecular‐weight form is associated with apoptosis IN vitro

APC (adenomatous polyposis coli) protein is differentially expressed in the normal colonic crypt and believed to be involved in colonic cell maturation. In this work we investigated whether expression of the APC protein is associated with cell death in colonic epithelial cells. We have previously reported an in vitro system to study apoptosis. Briefly, cells attached to the flask have a low frequency of apoptosis (1-3%), whereas cells that detach from the flask and float in the medium have a high proportion of apoptotic cells (36-96% depending on the cell line). The full-length 300-kDa or truncated APC protein, normally expressed by the attached cells (detected using the FE9 antibody), was found to be lost in the floating apoptotic cells in 8/11 colon tumour cell lines examined. In addition, the APC antibody FE9 detected a 90-kDa protein in the floating apoptotic cells of all cell lines investigated, which was not present in attached cells. Furthermore, loss of full-length APC and gain of the 90-kDa protein was observed in the apoptotic cells of 2 cell lines derived from other tissues: the SV40-transformed fibroblast cell line CMSV40fib and the lymphoblastoid B-cell line BJA-B. In cells repeatedly frozen and thawed, believed to induce necrotic cell death, full-length or truncated APC was also lost, though a 95-kDa protein distinct from that in apoptotic cells was observed. Specific loss of full-length or truncated APC (resulting in a 90-kDa protein in apoptotic cells but a 95-kDa protein in necrotic cells) is therefore associated with cell death. Our findings suggest a possible role for APC in cell survival.

Distribution of apoptosis-mediating Fas antigen in human skin and effects of anti-Fas monoclonal antibody on human epidermal keratinocyte and squamous cell carcinoma cell lines.

Fast antigen is a cell surface protein that mediates apoptosis. Using immunohistological, flow cytometry and electron microscopic analyses, we investigated the expression of Fas antigen on various skin tissues, and on cultured SV40-transformed human epidermal keratinocyte cell line KJD and human skin squamous cell carcinoma cell line HSC. The Fas antigen was widely distributed in skin components such as the keratinocytes in the lower portion of the epidermis, epidermal dendritic cells, endothelial cells, fibroblasts, apocrine glands, eccrine sweat glands, sebaceous glands, some normal melanocytes and infiltrating lymphoid cells. It was also strongly expressed on the keratinocytes of lichenoid eruptions seen in lupus erythematosus and lichen planus, and on the spongiotic or acanthotic epidermis seen in chronic eczema, adult T-cell leukaemia/lymphoma (ATLL) and atopic dermatitis. Its expression was closely correlated with lymphoid infiltrating cells and it was strongly expressed in lymphoid neoplastic cells, particularly ATLL cells, and fibroblasts seen in dermatofibroma. However, the antigen was not detected on basal cell epithelioma cells, some malignant melanomas or any junctional naevi. The cell lines KJD and HSC strongly expressed the Fas antigen, and crosslinking of the Fas antigen by an anti-Fas monoclonal antibody induced apoptosis of these cell lines. These results indicate that the apoptosis-mediating Fas antigen may play an important role in normal skin turnover and cell differentiation, in immune regulation of skin tumours, and in the pathogenesis of various skin diseases.

SV40 large-T oncogene inhibits transcription of perlecan-related proteoglycans but stimulates hyaluronan synthesis in a temperature-sensitive renal-tubule principal cell line

We have analyzed the effects of SV40 large-T oncogene on proteoglycan (PG) synthesis in a temperature-sensitive SV40-transformed renal cell line. Cells shifted from permissive (33 degrees C) to restrictive (39.5 degrees C) temperature, acquired within 48 h the phenotype of principal cells of the renal collecting tubule. They then synthesized hyaluronan, a large-sized PG, small amounts of free GAG chains, and a major approximately 130-kDa heparan sulfate-PG. Sulfated PGs were localized in a basement membrane-like layer and possessed the same core protein (61-70 kDa) derived from perlecan. Expression of large-T oncogene at the permissive temperature induced dramatic alterations of the extracellular matrix, and a 4- and 12-fold reduction in cell-associated and medium-released sulfated PGs, due to a approximately 50% decrease in perlecan mRNA content and gene transcription. This contrasted with a 2-fold increase in actin gene transcription and a 10- and 2-fold rise in the hyaluronan content in cells and medium, respectively. These alterations did not occur in a control cell line (RC.SV3) derived from the same tubule segment but infected with wild-type SV40 strain. They are thus most likely related to the functional state of large-T oncogene and may take part in the early steps of transformation.

The genomic instability associated with integrated simian virus 40 DNA is dependent on the origin of replication and early control region.

DNA rearrangements in the form of deletions and duplications are found within and near integrated simian virus 40 (SV40) DNA in nonpermissive cell lines. We have found that rearrangements also occur frequently with integrated pSV2neo plasmid DNA. pSV2neo contains the entire SV40 control region, including the origin of replication, both promoters, and the enhancer sequences. Linearized plasmid DNA was electroporated into X1, an SV40-transformed mouse cell line that expresses SV40 large T antigen (T Ag) and shows very frequent rearrangements at the SV40 locus, and into LMtk-, a spontaneously transformed mouse cell line that contains no SV40 DNA. Stability was analyzed by subcloning G-418-resistant clones and examining specific DNA fragments for alterations in size. Five independent X1 clones containing pSV2neo DNA were unstable at both the neo locus and the T Ag locus. By contrast, four X1 clones containing mutants of pSV2neo with small deletions in the SV40 core origin and three X1 clones containing a different neo plasmid lacking SV40 sequences were stable at the neo locus, although they were still unstable at the T Ag locus. Surprisingly, five independent LMtk- clones containing pSV2neo DNA were unstable at the neo locus. LMtk- clones containing origin deletion mutants were more stable but were not as stable as the X1 clones containing the same plasmid DNA. We conclude that the SV40 origin of replication and early control region are sufficient viral components for the genomic instability at sites of SV40 integration and that SV40 T Ag is not required.

Epithelial Cells Are an Important Source of Tenascin in Normal and Malignant Human Breast Tissue

The extracellular matrix glycoprotein tenascin is limited to the periductal matrix of normal breast tissue but is markedly increased in both malignant and fibroadenomatous proliferations. It has been hypothesized that the changes in tenascin expression in these tissues are the result of epithelial induction of tenascin expression by the underlying mesenchyme. We have used Western and Northern blotting techniques to examine tenascin expression by normal and malignant mammary epithelial cells in culture. Normal mammary epithelial cells express tenascin in culture and incorporate the protein into the underlying matrix. The SV40-transformed mammary epithelial cell line HBL100 and some established mammary carcinoma cell lines also express tenascin. In contrast to normal mammary epithelial cells, carcinoma cells incorporate very little tenascin into the underlying matrix. To examine the source of tenascin expression in vivo, we have used in situ hybridization to demonstrate that the epithelial cells are a significant source of tenascin in both normal and malignant breast tissues.