Strawberry Latent Ringspot Research Articles

First report of Tulip virus X in New Zealand

Strawberry mottle virus (SMoV) is a serious pathogen of strawberries ( Fragaria × ananassa ) and is transmitted by aphids in a semi-persistent manner. Severe strains of SMoV may reduce yield by up to 30% and losses can be up to 80% in mixed infections with other viruses (Thompson & Jelkmann, 2003; Martin & Tzanetakis, 2006). In May 2007, leaf mottling was observed on indicator plants of Fragaria vesca ‘EMK’ and ‘UC4’, and F. virginiana ‘UC12’ held in an open-shade house near Christchurch, New Zealand. No virus particles were seen using electron microscopy on crude sap preparations from mottled leaves, nor were symptoms observed when healthy plants of Chenopodium amaranticolor , C. quinoa , Cucumis sativus , Gomphrena globosa , Nicotiana benthamiana , N. clevelandii , N. occidentalis and N. sylvestris were mechanically inoculated with plant sap. RNA was extracted from affected strawberry plants and tested by RT-PCR using published SMoV-specific primers and cycling conditions (Thompson et al ., 2003). PCR amplicons of the expected size (219 bp) were obtained and an amplicon from F. vesca was sequenced (GenBank Acc. No. EU440731). A blast search in GenBank confirmed SMoV (98% nt identity with AJ311876). The plants also tested positive for SMoV using real-time RT-PCR (Ratti et al ., 2006). In July 2007, 35 plants of commercial cultivars of F. × ananassa were collected at random from 10 locations throughout New Zealand and the crowns and leaves were tested for SMoV using conventional and real-time RT-PCR. Indicator plants of F. virginiana ‘UC11’ and ‘UC12’ held in a glasshouse in Auckland were also tested. All commercial cultivars were uninfected but the indicator plants from Auckland tested positive for SMoV with both PCR methods. All plants were also tested by RT-PCR for Raspberry ringspot virus , Strawberry latent ringspot virus , Strawberry vein banding virus , Tomato ringspot virus and Tomato black ring virus and were found to be uninfected. Strawberry mottle virus (SMoV) occurs in many areas where strawberries are grown; this is the first report of the virus in New Zealand. The SMoVinfected indicator plants have been grown in New Zealand for at least 10 years. Despite the indicators in Christchurch being held in an open shade house, and the presence of at least two aphid species that can vector the virus in New Zealand ( Aphis gossypii and Chaetosiphon fragaefolii ), the virus does not appear to have become widely distributed within commercial strawberry cultivars. However, it has been decided not to impose regulatory controls to eradicate or manage the disease and therefore the disease is likely to spread in the future.

Pathogen‐tested material of grapevine varieties and rootstocks

Pathogen‐tested material of grapevine varieties and rootstocks

Certification scheme for strawberry

Certification scheme for strawberry

Novel approaches to mitigate primer interaction and eliminate inhibitors in multiplex PCR, demonstrated using an assay for detection of three strawberry viruses

Multiplex PCR is an important technique for detecting a variety of pathogens simultaneously in a single assay. Previous research has focused on optimising the factors affecting reliable multiplex PCR, including primer design, PCR components and conditions, and inhibitors in samples. In this study, the interaction of primers to form complex secondary structures including visible dimers and invisible “primer clusters”, a novel form of primer secondary structure found during this research, were shown to be the most important factors affecting successful multiplex PCR. Approaches to mitigate primer interaction and eliminate inhibitors were tested, including: reduction of primer concentrations especially those with preferential amplification; decrease of PCR extension temperature; increase of extension time and PCR cycles; and addition of bovine serum albumin. Based on these approaches, a multiplex RT-PCR with sensitivity comparable to the simplex PCR for individual viruses was developed for the detection of Raspberry ringspot virus, Strawberry latent ringspot virus and Tomato bushy stunt virus. A plant internal amplification control was also included. These approaches may be useful as a guideline for the development of multiplex PCR protocols for the detection of other pathogens or organisms associated with plants, humans, animals and the environment.

Certification scheme forSambucus

Certification scheme for<i>Sambucus</i>

SURVEY OF GRAPEVINE VIRUSES IN CHILE

SUMMARY Grapevines from six Chilean regions were surveyed for virus diseases and tested for the presence of the most important viruses. ELISA testing of 2535 samples and confirmatory RT-PCR of some ELISA-negative samples from symptomatic and symptomless vines gave the following infection rates: 6.36% for Grapevine fanleaf virus (GFLV); 4.67% for Grapevine leafroll associated virus 1 (GLRaV-1); 16.05% for Grapevine leafroll associated virus 2 (GLRaV-2); 6.41% for Grapevine leafroll associated virus 3 (GLRaV-3); 0.26% for Grapevine leafroll associated virus 7 (GLRaV-7); 14.99% for Grapevine fleck virus (GFkV); 5.57% for Grapevine virus A (GVA) and 0.78% for Grapevine virus B (GVB). Strawberry latent ringspot virus (SLRSV) Tomato ringspot virus (ToRSV) and Arabis mosaic virus (ArMV) were not detected. Overall infection in the surveyed Chilean grapevines, considering ELISA and RT-PCR, was 32.35%. Virus infection ratio obtained from ELISA analysis in the six regions, varied between 21.19% (Region Metropolitana) and 74.26% (Coquimbo). RT-PCR was used for detection of the Red Globe strain of GLRaV-2 and Grapevine rupestris stem pitting associated virus (GRSPaV), and to confirm and extend ELISA results. GVB, GFkV, GRSPaV, GLRaV-2 RG and GLRaV-7 are new records for Chile.

Identification of the New Strain of Strawberry latent ringspot virus Isolated from Black Locust (Robinia pseudoacacia L.)

AbstractThree isolates of Strawberry latent ringspot virus (SLRSV) were obtained from black locust (Robinia pseudoacacia L.): SLRSV‐G2, SLRSV‐N31 and SLRSV‐W16. The isolates were identified by the host range, particle morphology, serological properties and virus‐specific reverse transcription polymerase chain reaction. The studies showed that two Polish isolates: SLRSV‐N31 and SLRSV‐W16 are almost identical, while the SLRSV‐G2 isolate is remarkably different. Phylogenetic analysis confirmed that SLRSV‐G2 is also distinct from others reported to date. Pairwise comparisons of SLRSV‐G2 with other isolates available in GenBank database showed only 76–79% nucleotide similarity. Therefore, SLRSV‐G2 is proposed as a new strain of SLRSV.

VIRUSES OF SWEET AND SOUR CHERRY IN SERBIA

SUMMARY One hundred twenty-five trees (each of a different cultivar) of sour and sweet cherry from two large varietal collections in Serbia were visually inspected for virus symptoms and tested for the presence of cherry viruses by ELISA, herbaceous host assays, graft-indexing on P. serrulata cv. Kwanzan, and RT-PCR. All samples were tested by ELISA for Prunus necrotic ring spot virus (PNRSV), Prune dwarf virus (PDV), Apple chlorotic leaf spot virus (ACLSV), Apple mosaic virus (ApMV), and Plum pox virus (PPV). The overall detection of PDV, PNRSV, and ACLSV was 63%. Additional ELISA tests were done on 80 trees for Arabis mosaic virus (ArMV), Cherry leaf roll virus (CLRV), Strawberry latent ring spot virus (SLRSV), Petunia asteroid mosaic virus (PetAMV), Raspberry ringspot virus (RpRSV), Tomato black ring virus (TBRV), Tobacco mosaic virus (TMV), and Tomato ringspot virus (ToRSV). In these tests, one tree tested positive for PetAMV. RT-PCR testing of 44 trees detected another five viruses: Cherry green ring mottle virus (CGRMV), Cherry necrotic rusty mottle virus (CNRMV), Cherry virus A (CVA), European rusty mottle associated virus (ERMaV) and Plum bark necrosis and stem pitting-associated virus (PBNSPaV), but not Cherry mottle leaf virus (CMLV). In graft-indexing tests on Kwanzan with all 125 trees, samples from 38 trees induced symptoms of necrotic crook disease (causal agent unknown). Viruses reported for the first time in Serbia were CGRMV, CNRMV, CVA, ERMaV, PBNSPaV, and PetAMV.

A virus between families: nucleotide sequence and evolution of Strawberry latent ringspot virus

Several clones of golden ginger mint ( Mentha × gracilis, ‘Variegata’) were found infected with Strawberry latent ringspot virus (SLRSV). The virus was purified and cloned and the complete nucleotide sequence of a mint isolate was obtained. RNA 1 consists of 7496 nucleotides excluding the poly-A tail and encodes a polyprotein with signature enzymatic motifs found in other picorna-like plant viruses. RNA 2 consists of 3842 nucleotides excluding the poly-A tail, encoding a polyprotein that is processed to a putative movement protein and the two coat proteins of the virus. A satellite RNA of 1117 nucleotides was associated with this isolate encoding for a putative protein of 31 kDa. Phylogenetic analysis revealed that SLRSV shares characteristics with members of the Cheravirus, Fabavirus, Comovirus and Sadwavirus genera indicative of the uniqueness of SLRSV. The close relationship of SLRSV with these genera led to the examination of aphid and beetle transmission of the virus with, however, negative results.

Characterization and Recent Advances in Detection of Strawberry Viruses.

Characterization and Recent Advances in Detection of Strawberry Viruses.

Preliminary evaluation of the status of olive‐infecting viruses in Syria

Field surveys of 80 commercial groves were made in autumn 2003 in six major Syrian olive‐growing regions. A total of 300 olive samples, representative of the main cultivars grown in the country, were collected. As ascertained by dsRNA analysis, 54 out of 125 samples (about 43%) showed visible bands in polyacrylamide gel electrophoresis. All samples were tested by RT‐PCR for the presence of the following viruses: Arabis mosaic virus (ArMV), Cherry leaf roll virus (CLRV), Cucumber mosaic virus (CMV), Olive latent ringspot virus (OLRSV), Olive latent virus 1 (OLV‐1), Olive latent virus 2 (OLV‐2), Olive leaf yellowing‐associated virus (OLYaV) and Strawberry latent ringspot virus (SLRSV). All these viruses, singly or in mixed infection, were detected in about 51% of the samples. CMV was the most prevalent (22.7%), followed by CLRV (15%), OLYaV (14.3%) and OLRSV (11.5%). Less represented were the remaining four viruses. Infection rates ranged from 44% in Dara’a region to 67% in Latakia and Hama.

Plant parasitic and vector nematodes associated with Asiatic and Oriental hybrid lilies

A survey for distribution and abundance of plant parasitic nematodes in fields grown to Lilium in Himachal Pradesh, India at four study sites viz. Nagrota (at 810 m a.s.l.), Palampur (at 1270 m a.s.l.), Sunder Nagar (at 1400 m a.s.l.) and Chail (at 2250 m a.s.l.) was carried out. Moderate (101–500/200 ml soil) to high (501–1000/200 ml soil) populations of phytonematodes including the vectors for plant viruses ( Aphelenchoides avenae, Criconemoides spp., Hoplolaimus spp., Longidorus spp., Paratylenchus spp., Pratylenchus spp., Rhabditis spp., Trichodorus spp., Tylenchoryhnchus spp., Tylenchulus spp. and Xiphinema diversicaudatum) were recorded. Mean population of nematodes was positively correlated with pH in all the study sites, negatively correlated with electrical conductivity (EC), percent organic matter (OM%), available potassium (K) and positively correlated with percent carbon (C%), available nitrogen (N) and available phosphorus (P) in all but one study site. The highest incidence of virus-vector nematodes viz. X. diversicaudatum, Longidorus spp. and Trichodorus spp. was recorded at Palampur. Only Strawberry latent ringspot nepovirus (SLRSV) was detected in Lilium cvs. Star Gazer Max and Galeili by Enzyme Linked Immunosorbent Assay (ELISA) and reverse transcription polymerase chain reaction (RT-PCR) and in X. diversicaudatum associated with the cultivars by RT-PCR. Cucumis sativus used as bait plants showed SLRSV symptoms after 15 days of nematode inoculation and further SLRSV was again detected by ELISA and RT-PCR in C. sativus plants confirming the transmission of SLRSV by X. diversicaudatum in Lilium.

Identification, detection and frequency of lily viruses in Northern India

In a survey of lily growing fields in various parts of Himachal Pradesh, India, three viruses, Cucumber mosaic (CMV), Lily symptomless (LSV) and Lily mottle virus (LMoV) lily strain, were found quite prevalent in Asiatic (12 cultivars) and Oriental hybrids (4 cultivars) of lily, Lilium longiflorum and L. tigrinum. Apart from these viruses, Strawberry latent ringspot virus (SLRSV) was also found to infect Oriental hybrid lily. The disease incidence on the basis of symptoms observed ranged between minimum (40.7%) in cv. Alaska and maximum (83.7%) in cv. America, both Asiatic hybrid lily types. These viruses were indexed by testing outer and inner scales of bulbs and the leaves at early and flowering stages using ELISA and reverse transcription polymerase chain reaction (RT-PCR). Mechanical and insect transmission, purification, electron microscopy and sequencing of the PCR fragments were carried out for these viruses. Cloning and sequence analysis confirmed the viruses as CMV-subgroup II, LSV and LMoV. There were 96–98% nucleotide and 93–97% amino acid homology with CMV subgroup II sequences, 97–99% nucleotide and 91–92% amino acid homology with LSV sequences and 92–99% nucleotide and 85–98% amino acid homology with LMoV sequences.

On the presence and distribution of olive viruses in Lebanon

A survey for viruses was carried out in 2003 in the main olive‐growing areas of Lebanon (South Lebanon, North Lebanon, Mount Lebanon and Bekaa). A total of 300 samples was collected in 31 different locations in 76 different commercial orchards and checked by RT‐PCR for the presence of Arabis mosaic virus (ArMV), Cherry leaf roll virus (CLRV), Strawberry latent ringspot virus (SLRV), Olive latent virus 1 (OLV‐1) and Olive leaf yellowing‐associated virus (OLYaV), using virus‐specific primers reported in the literature. About one third (31%) of the trees were infected. In particular, the closterovirus OLYaV was the most widespread, as it was detected in 23.7% of the samples, followed by the necrovirus OLV‐1 (8.3%), the two nepoviruses CLRV (2%) and ArMV (0.3%), and the sadwavirus SLRV (0.3%). A high variability was detected in the HSP70 gene of Lebanese and Italian OLYaV isolates, for at least nine different patterns were obtained when this genomic region was subjected to single‐strand conformation polymorphism (SSCP) analysis.

DISTRIBUTION OF OLIVE TREE VIRUSES IN ITALY AS REVEALED BY ONE-STEP RT-PCR

We have used a one-step RT-PCR protocol to detect and identify each of the eight viruses most commonly found in olive trees namely: Arabis mosaic virus (Ar- MV), Cherry leaf roll virus (CLRV), Cucumber mosaic virus (CMV), Olive leaf yellowing associated virus (OLYaV), Olive latent ring spot virus (OLRSV), Olive latent virus-1 (OLV-1), Olive latent virus-2 (OLV-2), and Strawberry latent ring spot virus (SLRSV). We have assayed 345 samples collected from olive fields in Italian areas in which national and local olive tree cultivars and selections are grown. The average percentage virus infection of olive trees was 32.8%. Among the eight viruses assayed, only OLYaV (20.9%), SLRSV (7.8%) and CLRV (4.9%) were detected. The most common virus was OLYaV, which was found at a high percentage in southern Italy. SLRSV was the main virus in central Italy whereas CLRV was detected in five samples from Latium, Umbria and Sicily and in all analyzed trees from Abruzzo.

Biological and serological procedures to detect three nepoviruses in fruit trees

Cherry leaf roll virus (CLRV), Myrobalan latent ringspot virus (MLRSV) and Strawberry latent ringspot virus (SLRSV) were transferred by budding to woody trees, hybrid Ishtara, peach cv. GF 305 and cv. Lesiberian. Three buffers with antioxidants and stabilisers: 0.01M phosphate with 1% caffeine; 0.007M phosphate-0.01M veronal with 0.01M cysteine hydrochloride and 0.007 EDTA; 0.015M phosphate with 1% nicotine and 0.066M phosphate buffer without additives were compared for their efficiency in mechanical transmission from woody sources to herbaceous hosts (Chenopodium quinoa and C. amaranticolor). 0.007M phosphate-0.01M veronal buffer with 0.01M cysteine hydrochloride, and 0.007 EDTA and 0.015M phosphate buffer with 1% nicotine were found to be the best buffers for the three nepoviruses. Both biological transmission to herbaceous assay hosts and detection by ELISA in the investigated tree are necessary to reliably detect the three nepoviruses. Biological detection is reliable from April to June, and in September and October. ELISA detection is also more difficult in July and August. The suitability of C. quinoa and C. amaranticolor to maintain CLRV, MLRSV and SLRSV was compared. C. amaranticolor plants were found to be more suitable for CLRV and SLRSV, infected plants grow over 6 months after mechanical inoculation by the nepoviruses. C. quinoa plants proved to be most suitable for maintenance of MLRSV, while C. amaranticolor is a symptomless host of MLRSV. Reinoculation with the nepoviruses is recommended in intervals of 4 to 6 months.

Validation of the specificity and sensitivity of species-specific primers that provide a reliable molecular diagnostic for Xiphinema diversicaudatum, X. index and X. vuittenezi

Xiphinema diversicaudatum and X. index are vector nematode species of economic importance in viticulture regions as they can transmit Arabis Mosaic, Grapevine Fanleaf and Strawberry Latent Ringspot viruses to grapevine. Wang et al. (2003) designed species-specific diagnostic primers from ribosomal genes for both these vector species as well as a vector and a non-vector species X. italiae and X. vuittenezi, respectively. Our study aimed to confirm the specificity and determine the sensitivity and reliability of the primers for the two vector species, X. diversicaudatumand X. indexwhen challenged with closely related longidorid species and general nematode communities typical of vineyard soil. With one exception, no PCR product was observed when the primers were tested against six Longidorus, one Paralongidorus and one Xiphinema non-target species. Occasionally (three out of eight replicate PCR reactions) a weak PCR product was noted when primers for X. index were tested with L. elongatus. Furthermore, when challenged with a range of non-target nematode species comprising the nematode community typical of viticulture soil, no PCR product was amplified. An experimental dilution series of extracted DNA rigorously demonstrated that DNA from an equivalent single specimen of the target virus-vector species, X. diversicaudatum and/or X. index, could be detected amongst 1000 equivalent non-targetX. vuittenezi. Also, extracted DNA from an equivalent single target specimen was detected when added to DNA extracted from the overall soil nematode community. The primers were assessed further by using serial mixtures of actual nematodes rather than extracted DNA to simulate field soil. Using this method, a single target nematode could be detected amongst 200 non-target specimens. Given their specificity, sensitivity and reliability, it appears that these diagnostic primers will be of great benefit to phytosanitary/quarantine services related to the viticulture industry.

BLACKBERRY YELLOW VEIN ASSOCIATED VIRUS: A NEW CRINIVIRUS FOUND IN BLACKBERRY

During the last three years blackberries in southern and southeastern U.S. have shown symptoms of vein clearing, yellow mottling and plant decline with considerable variation in symptoms with cultivars. We isolated dsRNA from symptomatic plants and identified high molecular weight bands similar to those isolated from plants infected with criniviruses. Paired extractions from virus-tested blackberries did not yield any dsRNA bands with molecular weight greater than 500 bp. Using degenerate primers developed against the crinivirus 1b protein in RTPCR resulted in an amplicon that when sequenced showed the virus was a member of the Crinivirus genus. We have also cloned the virus and sequenced clones containing regions of the minor coat protein of the virus. Phylogenetic analysis revealed that the new virus, designated as Blackberry yellow vein associated virus (BYVaV), is related most closely to Beet pseudo-yellows virus and Strawberry pallidosis associated virus, two criniviruses recently identified in strawberry. INTRODUCTION Symptoms of vein clearing, yellow mottling, ringspots and plant decline have been observed in blackberry in South Carolina, North Carolina and Arkansas over the past few years (Fig. 1). Initially the symptoms were thought to be caused by Tobacco ringspot virus (TRSV) as this virus is known to infect blackberry and similar symptoms attributed to TRSV infection have been reported (1). Symptomatic plants were tested for 14 viruses by ELISA including: Alfalfa mosaic, Arabis mosaic, Cucumber mosaic, Impatiens necrotic spot, Prunus necrotic ringspot, Raspberry bushy dwarf, Raspberry ringspot, Strawberry latent ringspot, Strawberry mild yellow edge, Tobacco ringspot, Tobacco streak, Tomato ringspot, and Tomato spotted wilt viruses as well as for Potyviruses using group specific antibodies. However, in ELISA tests very few plants that exhibited these symptoms tested positive for TRSV or any other virus. In this report we describe a crinivirus associated with the symptoms observed in blackberry and a reverse-transcritase polymerase chain reaction (RT-PCR) method for detecting this new virus. MATERIALS AND METHODS In an attempt to determine if there may be a new virus associated with these symptoms dsRNA was extracted from symptomatic and asymptomatic plants using a shortened version of the standard extraction method (2). After the dsRNA was bound to the cellulose powder in the presence of 16% ethanol in STE buffer, the samples were centrifuged for three minutes at 5,000 X g, the pellet was washed once with 50 ml of STE-EtOH and the cellulose repelleted by centrifugation. Two ml of STE was added to the final pellet and incubated at room temp for 5 min. The sample was then transferred to a microfuge tube and pellet at max rpm for 3 min. The supernatant was collected and nucleic acid precipitated by the addition of 2 ml of 95% EtOH with 5% 3 M sodium acetate. Samples were mixed then stored at -80C for 20 minutes before centrifugation in a microfuge at max speed for 30 minutes. Pellets were resuspend in 10 mM Tris-HCl containing 1 mM EDTA and analyzed by gel electrophoresis. Proc. X IS on Small Fruit Virus Diseases

First Report of Strawberry latent ringspot virus in a Mentha sp. from North America.

Yellow veinbanding symptoms have been observed in several mint clones at the U.S. Department of Agriculture, Agricultural Research Service, National Clonal Germplasm Repository (NCGR) mint collection in Corvallis, Oregon. The most dramatic symptoms are in a "variegated" clone of Mentha × gracilis Sole (NCGR Accession No. MEN-454), which is marketed widely in the nursery industry under cultivar names such as Golden Ginger Mint and Green and Gold. Tucker and Fairbrothers (2) proposed the name Mentha gentilis (= M. × gracilis) L. 'Variegata' for forms of this species with a graft transmissible variegation. Doublestranded RNA (dsRNA) was extracted from three mint clones with veinbanding symptoms of varying intensity. The dsRNA from MEN-454 was cloned, and sequences from several clones corresponded to RNA 2 of Strawberry latent ringspot virus (SLRSV), a tentative member of the family Sequiviridae. Sequences of additional cDNA clones suggested that two previously unknown viruses and the satellite RNA of SLRSV were also present in MEN-454. On the basis of the sequences of the SLRSV clones, primers F (5' CCTCTCCAACCTGCTAGACT 3') and R (5' AAGCGCATGAAGGTGTAACT 3') were developed and used in reverse transcription-polymerase chain reaction (RT-PCR) to amplify a 497-bp fragment of RNA 2 of SLRSV from MEN-454. No amplicons in RT-PCR tests or dsRNA was obtained from a clone of MEN-454 that was freed of the yellow vein symptom by heat therapy and apical meristem culture. The consensus sequence of cloned dsRNA and sequenced PCR products for SLRSV from MEN-454 has been deposited in GenBank (Accession No. AY 438666). Chenopodium quinoa, inoculated mechanically with leaf extracts from MEN-454, developed chlorosis and apical necrosis that were similar to symptoms reported for SLRSV infection (1). The presence of SLRSV in C. quinoa was confirmed using RT-PCR. Variegated M. × gracilis clones were obtained from wholesale and mail-order nurseries in Maryland, Ohio, and Nebraska. Samples were assayed using RT-PCR utilizing the F and R primers for presence of SLRSV. All samples tested positive for the virus using RT-PCR. Because of the presence of additional viruses, we cannot attribute yellow vein symptoms solely to SLRSV, however the presence of this virus in clones of M. × gracilis 'Variegata' from different regions throughout the United States demonstrates that SLRSV is distributed widely in the United States. To our knowledge, this is the first report of SLRSV in mint in North America.

First Report of Strawberry latent ringspot virus in Strawberry in the United States and Canada.

Strawberries in southern California have shown decline symptoms during the last 2 years. More than 70% of plants tested in California were infected with two newly identified criniviruses that infect strawberry (Strawberry pallidosis and Beet pseudo-yellows). Strawberry cultivars are usually symptomless when infected with one virus, and testing for other strawberry viruses is performed to identify any other viruses that may be involved in the symptomatology. Primers SLRSV F (5' CCTCTCCAACC-TGCTAGACT 3') and SLRSV R (5' AAGCGCATGAAGGTGTAACT 3') that amplify a 497-bp fragment of RNA 2 of Strawberry latent ringspot virus (SLRSV) were developed and utilized for reverse transcription-polymerase chain reaction (RT-PCR) detection. SLRSV belongs to the family Sequiviridae and is transmitted by nematodes of the genus Xiphinema. The virus has a broad host range (4) and is usually symptomless in strawberries. Strawberry plants from commercial fields in California, Oregon, Washington, and British Columbia, Canada were tested. SLRSV was identified in 17% of plants tested from California and 4% of plants tested from British Columbia, while all samples from Oregon and Washington tested negative. The fragment amplified (GenBank Accession No. AY461735, isolate from British Columbia, Canada) shares 84% nucleotide and 94% amino acid sequence identity with the previously published sequence of SLRSV from strawberry (GenBank Accession No. X77466) (3). The virus was transmitted mechanically from strawberry samples from Canada to Chenopodium quinoa, and the infected C. quinoa plants tested positive for SLRSV with RT-PCR, while no amplicons were obtained from noninoculated control plants. To our knowledge, this is the first report of SLRSV in strawberry in North America, although it has been previously reported in a single cherry tree in Ontario, Canada (1) and in an imported seed lot of parsley in California (2). The number of plants that tested positive as well as the geographic distribution of the virus indicates that the virus is widespread in California, but further testing is needed to identify its distribution in other states.