Strain KA1 Research Articles

Enhanced Electron Uptake and Methane Production by Corrosive Methanogens during Electromethanogenesis.

Electromethanogenesis is an interesting next-generation technology to produce methane from CO2 and electricity by using methanogens. Iron-corroding methanogens might be of special interest for that application due to their natural ability for electron uptake. Methanococcus maripaludis Mic1c10 and KA1 were tested in bioelectrochemical systems. Strain Mic1c10 showed a 120% higher current density and an 84% higher methane production rate (16.2 mmol m-2 d-2) than the non-corrosive strain Methanococcus maripaludis S2, which was identified earlier as the best methane producer under the same experimental conditions. Interestingly, strain KA1 also showed a 265% higher current density than strain S2. Deposits at the cathodes were detected and analyzed, which were not described earlier. A comparative genome analysis between the corrosive methanogen and the S2 strain enables new insights into proteins that are involved in enhanced electron transfer.

Structure and Chemical Reaction Mechanism of LigU, an Enzyme That Catalyzes an Allylic Isomerization in the Bacterial Degradation of Lignin.

LigU from Novosphingobium sp. strain KA1 catalyzes the isomerization of (4E)-oxalomesaconate (OMA) to (3Z)-2-keto-4-carboxy-3-hexenedioate (KCH) as part of the protocatechuate (PCA) 4,5-cleavage pathway during the degradation of lignin. The three-dimensional structure of the apo form of the wild-type enzyme was determined by X-ray crystallography, and the structure of the K66M mutant enzyme was determined in the presence of the substrate OMA. LigU is a homodimer requiring no cofactors or metal ions with a diaminopimelate epimerase structural fold, consisting of two domains with similar topologies. Each domain has a central α-helix surrounded by a β-barrel composed of antiparallel β-strands. The active site is at the cleft of the two domains. 1H nuclear magnetic resonance spectroscopy demonstrated that the enzyme catalyzes the exchange of the pro-S hydrogen at C5 of KCH with D2O during the isomerization reaction. Solvent-deuterium exchange experiments demonstrated that mutation of Lys-66 eliminated the isotope exchange at C5 and that mutation of C100 abolished exchange at C3. The positioning of these two residues in the active site of LigU is consistent with a reaction mechanism that is initiated by the abstraction of the pro-S hydrogen at C3 of OMA by the thiolate anion of Cys-100 and the donation of a proton at C5 of the proposed enolate anion intermediate by the side chain of Lys-66 to form the product KCH. The 1,3-proton transfer is suprafacial.

Biodegradation of high concentrations of petroleum compounds by using indigenous bacteria isolated from petroleum hydrocarbons-rich sludge: Effective scale-up from liquid medium to composting process

The scale-up of petroleum hydrocarbons-rich sludge (PHRS) bioremediation from liquid medium to a composting method bioaugmentated with two indigenous bacteria, capable of degrading high levels of crude oil, was surveyed. After isolating the strains (Sphingomonas olei strain KA1 and Acinetobacter radioresistens strain KA2) and determining their biomass production, emulsification index (E24), bacterial adhesion to hydrocarbon (BATH), and crude oil degradation in liquid medium, they were inoculated into the composting experiments. In liquid medium, the removal rate of crude oil were 67.25, 70.86, 61.77, 42.13, and 27.92%, respectively for the initial oil levels of 1, 2, 3, 4, and 5% after 7 days. Degradation of 10, 20, 30, 40 and 50 g kg−1 concentrations of total petroleum hydrocarbons (TPH) were also calculated to be 91.24, 87.23, 84.69, 74.08, and 60.14%, respectively after a composting duration of 12 weeks. The values of the rate constants (k) and half-lives (t1/2) of petroleum hydrocarbons degradation were 0.083–0.212 day−1 and 3.27–8.35 days for the first-order and 0.003–0.089 g kg−1day−1 and 1.12–6.67 days for the second-order model, respectively. This study verified the suitability of the isolated strains for PHRS bioremediation. Successful scale-up of PHRS bioremediation from a liquid medium to a composting process for degrading high amounts of TPH was also confirmed.

PbaR, an IclR Family Transcriptional Activator for the Regulation of the 3-Phenoxybenzoate 1′,2′-Dioxygenase Gene Cluster in Sphingobium wenxiniae JZ-1 T

The 3-phenoxybenzoate (3-PBA) 1',2'-dioxygenase gene cluster (pbaA1A2B cluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed in Sphingobium wenxiniae strain JZ-1(T) by its substrate 3-PBA. In this study, we identified a transcriptional activator of the pbaA1A2B cluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 in Sphingomonas sp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of the pbaA1A2B cluster in response to 3-PBA in strain JZ-1(T). However, PbaR does not regulate the reductase component gene pbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in the pbaA1A2B promoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the -10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1(T), and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators.

Iron-Corroding Methanogen Isolated from a Crude-Oil Storage Tank

Microbiologically influenced corrosion of steel in anaerobic environments has been attributed to hydrogenotrophic microorganisms. A sludge sample collected from the bottom plate of a crude-oil storage tank was used to inoculate a medium containing iron (Fe(0)) granules, which was then incubated anaerobically at 37 degrees C under an N(2)-CO(2) atmosphere to enrich for microorganisms capable of using iron as the sole source of electrons. A methanogen, designated strain KA1, was isolated from the enrichment culture. An analysis of its 16S rRNA gene sequence revealed that strain KA1 is a Methanococcus maripaludis strain. Strain KA1 produced methane and oxidized iron much faster than did the type strain of M. maripaludis, strain JJ(T), which produced methane at a rate expected from the abiotic H(2) production rate from iron. Scanning electron micrographs of iron coupons that had been immersed in either a KA1 culture, a JJ(T) culture, or an aseptic medium showed that only coupons from the KA1 culture had corroded substantially, and these were covered with crystalline deposits that consisted mainly of FeCO(3).

Novel marine carbazole-degrading bacteria

Eleven carbazole (CAR)-degrading bacterial strains were isolated from seawater collected off the coast of Japan using two different media. Seven isolates were shown to be most closely related to the genera Erythrobacter, Hyphomonas, Sphingosinicella, Caulobacter, and Lysobacter. Meanwhile, strains OC3, OC6S, OC9, and OC11S showed low similarity to known bacteria, the closest relative being Kordiimonas gwangyangensis GW14-5 (90% similarity). Southern hybridization analysis revealed that only five isolates carried car genes similar to those reported in Pseudomonas resinovorans CA10 (car(CA10)) or Sphingomonas sp. strain KA1 (car(KA1)). The isolates were subjected to GC-MS and the results indicated that these strains degrade CAR to anthranilic acid.

The Sphingomonas Plasmid pCAR3 Is Involved in Complete Mineralization of Carbazole

We determined the complete 254,797-bp nucleotide sequence of the plasmid pCAR3, a carbazole-degradative plasmid from Sphingomonas sp. strain KA1. A region of about 65 kb involved in replication and conjugative transfer showed similarity to a region of plasmid pNL1 isolated from the aromatic-degrading Novosphingobium aromaticivorans strain F199. The presence of many insertion sequences, transposons, repeat sequences, and their remnants suggest plasticity of this plasmid in genetic structure. Although pCAR3 is thought to carry clustered genes for conjugative transfer, a filter-mating assay between KA1 and a pCAR3-cured strain (KA1W) was unsuccessful, indicating that pCAR3 might be deficient in conjugative transfer. Several degradative genes were found on pCAR3, including two kinds of carbazole-degradative gene clusters (car-I and car-II), and genes for electron transfer components of initial oxygenase for carbazole (fdxI, fdrI, and fdrII). Putative genes were identified for the degradation of anthranilate (and), catechol (cat), 2-hydroxypenta-2,4-dienoate (carDFE), dibenzofuran/fluorene (dbf/fln), protocatechuate (lig), and phthalate (oph). It appears that pCAR3 may carry clustered genes (car-I, car-II, fdxI, fdrI, fdrII, and, and cat) for the degradation of carbazole into tricarboxylic acid cycle intermediates; KA1W completely lost the ability to grow on carbazole, and the carbazole-degradative genes listed above were all expressed when KA1 was grown on carbazole. Reverse transcription-PCR analysis also revealed that the transcription of car-I, car-II, and cat genes was induced by carbazole or its metabolic intermediate. Southern hybridization analyses with probes prepared from car-I, car-II, repA, parA, traI, and traD genes indicated that several Sphingomonas carbazole degraders have DNA regions similar to parts of pCAR3.

Plasmid pCAR3 Contains Multiple Gene Sets Involved in the Conversion of Carbazole to Anthranilate

The carbazole degradative car-I gene cluster (carAaIBaIBbICIAcI) of Sphingomonas sp. strain KA1 is located on the 254-kb circular plasmid pCAR3. Carbazole conversion to anthranilate is catalyzed by carbazole 1,9a-dioxygenase (CARDO; CarAaIAcI), meta-cleavage enzyme (CarBaIBbI), and hydrolase (CarCI). CARDO is a three-component dioxygenase, and CarAaI and CarAcI are its terminal oxygenase and ferredoxin components. The car-I gene cluster lacks the gene encoding the ferredoxin reductase component of CARDO. In the present study, based on the draft sequence of pCAR3, we found multiple carbazole degradation genes dispersed in four loci on pCAR3, including a second copy of the car gene cluster (carAaIIBaIIBbIICIIAcII) and the ferredoxin/reductase genes fdxI-fdrI and fdrII. Biotransformation experiments showed that FdrI (or FdrII) could drive the electron transfer chain from NAD(P)H to CarAaI (or CarAaII) with the aid of ferredoxin (CarAcI, CarAcII, or FdxI). Because this electron transfer chain showed phylogenetic relatedness to that consisting of putidaredoxin and putidaredoxin reductase of the P450cam monooxygenase system of Pseudomonas putida, CARDO systems of KA1 can be classified in the class IIA Rieske non-heme iron oxygenase system. Reverse transcription-PCR (RT-PCR) and quantitative RT-PCR analyses revealed that two car gene clusters constituted operons, and their expression was induced when KA1 was exposed to carbazole, although the fdxI-fdrI and fdrII genes were expressed constitutively. Both terminal oxygenases of KA1 showed roughly the same substrate specificity as that from the well-characterized carbazole degrader Pseudomonas resinovorans CA10, although slight differences were observed.

Characterization of novel carbazole catabolism genes from gram-positive carbazole degrader Nocardioides aromaticivorans IC177.

Nocardioides aromaticivorans IC177 is a gram-positive carbazole degrader. The genes encoding carbazole degradation (car genes) were cloned into a cosmid clone and sequenced partially to reveal 19 open reading frames. The car genes were clustered into the carAaCBaBbAcAd and carDFE gene clusters, encoding the enzymes responsible for the degradation of carbazole to anthranilate and 2-hydroxypenta-2,4-dienoate and of 2-hydroxypenta-2,4-dienoate to pyruvic acid and acetyl coenzyme A, respectively. The conserved amino acid motifs proposed to bind the Rieske-type [2Fe-2S] cluster and mononuclear iron, the Rieske-type [2Fe-2S] cluster, and flavin adenine dinucleotide were found in the deduced amino acid sequences of carAa, carAc, and carAd, respectively, which showed similarities with CarAa from Sphingomonas sp. strain KA1 (49% identity), CarAc from Pseudomonas resinovorans CA10 (31% identity), and AhdA4 from Sphingomonas sp. strain P2 (37% identity), respectively. Escherichia coli cells expressing CarAaAcAd exhibited major carbazole 1,9a-dioxygenase (CARDO) activity. These data showed that the IC177 CARDO is classified into class IIB, while gram-negative CARDOs are classified into class III or IIA, indicating that the respective CARDOs have diverse types of electron transfer components and high similarities of the terminal oxygenase. Reverse transcription-PCR (RT-PCR) experiments showed that the carAaCBaBbAcAd and carDFE gene clusters are operonic. The results of quantitative RT-PCR experiments indicated that transcription of both operons is induced by carbazole or its metabolite, whereas anthranilate is not an inducer. Biotransformation analysis showed that the IC177 CARDO exhibits significant activities for naphthalene, carbazole, and dibenzo-p-dioxin but less activity for dibenzofuran and biphenyl.

Diversity of carbazole-degrading bacteria having the car gene cluster: Isolation of a novel gram-positive carbazole-degrading bacterium

Twenty-seven carbazole-utilizing bacterial strains were isolated from environmental samples, and were classified into 14 groups by amplified ribosomal DNA restriction analysis. Southern hybridization analyses showed that 3 and 17 isolates possessed the car gene homologs of Pseudomonas resinovorans CA10 and Sphingomonas sp. strain KA1, respectively. Of the 17 isolates, 2 isolates also have the homolog of the carAa gene of Sphingomonas sp. strain CB3. While the genome of one isolate, a Gram-positive Nocardioides sp. strain IC177, showed no hybridization to any car gene probes, PCR and sequence analyses indicated that strain IC177 had tandemly linked carAa and carC gene homologs whose deduced amino acid sequences showed 51% and 36% identities with those of strain KA1.

Divergent structures of carbazole degradative car operons isolated from gram-negative bacteria.

Southern hybridization analysis of the genomes from the newly-isolated 10 carbazole (CAR)-utilizing bacteria revealed that 8 of the isolates carried gene clusters homologous to the CAR-catabolic car operon of Pseudomonas resinovorans strain CA10. Sequencing analysis showed that two car operons and the neighboring regions of Pseudomonas sp. strain K23 are nearly identical to that of strain CA10. In contrast to strains CA10 and K23, carEF genes did not exist downstream of the car gene cluster of Janthinobacterium sp. strain J3. In the car gene clusters, strains CA10, K23 and J3 have Rieske-type ferredoxin as a component of carbazole dioxygenase, although Sphingomonas sp. strain KA1 possesses a putidaredoxin-type ferredoxin. We confirmed that this putidaredoxin-type ferredoxin CarAc can function as an electron mediator to CarAa of strain KA1. In the upstream regions of the carJ3 and carKA1 gene clusters, ORFs whose deduced amino acid sequences showed homology to GntR-family transcriptional regulators were identified.

Rhizoremediation of dioxin-like compounds by a recombinant Rhizobium tropici strain expressing carbazole 1,9a-dioxygenase constitutively.

A recombinant Rhizobium strain, PBK3-IS, that constitutively expressed the oxygenase component of carbazole 1,9a-dioxygenase from Sphingomonas sp. strain KA1, was constructed. In the water-cultured siratro rhizospheres inoculated with strain PBK3-IS, 48% of the dibenzofuran was removed within 3 days (initial substrate, 25 microg). Similar results were obtained in soil-cultured siratro rhizospheres using sterile vermiculite. When non-sterile field soils were used instead of sterile vermiculite, the inoculated recombinant strain could grow on the siratro root in all soils tested, except for wet paddy field.

Sphingomonas sp. strain KA1, carrying a carbazole dioxygenase gene homologue, degrades chlorinated dibenzo- p-dioxins in soil

Hybridization analysis showed that a newly isolated carbazole (CAR)-degrading bacterium Sphingomonas sp. strain KA1 did not possess the gene encoding the terminal oxygenase component ( carAa) of CAR 1,9a-dioxygenase at high homology (more than 90% identity) to that of another CAR-degrader, Pseudomonas resinovorans strain CA10. However, PCR experiments using the primers for amplifying the internal fragment of the carAa gene (810 bp for strain CA10) showed that a PCR product of unexpected size (1100 bp) was amplified. Sequence analysis revealed that this DNA region contained the portion of two possible ORFs, which showed moderate homology to CarAa and CarBa from strain CA10 (61% and 40% identities at the amino acid level, respectively). Inoculation of strain KA1 into dioxin-contaminated model soil resulted in 96% and 70% degradation of 2-mono- and 2,3-dichlorinated dibenzo- p-dioxin, respectively, after 7-day incubation.

Sphingomonas sp. strain KA1, carrying a carbazole dioxygenase gene homologue, degrades chlorinated dibenzo-p-dioxins in soil.

Hybridization analysis showed that a newly isolated carbazole (CAR)-degrading bacterium Sphingomonas sp. strain KA1 did not possess the gene encoding the terminal oxygenase component (carAa) of CAR 1,9a-dioxygenase at high homology (more than 90% identity) to that of another CAR-degrader, Pseudomonas resinovorans strain CA10. However, PCR experiments using the primers for amplifying the internal fragment of the carAa gene (810 bp for strain CA10) showed that a PCR product of unexpected size (1100 bp) was amplified. Sequence analysis revealed that this DNA region contained the portion of two possible ORFs, which showed moderate homology to CarAa and CarBa from strain CA10 (61% and 40% identities at the amino acid level, respectively). Inoculation of strain KA1 into dioxin-contaminated model soil resulted in 96% and 70% degradation of 2-mono- and 2,3-dichlorinated dibenzo-p-dioxin, respectively, after 7-day incubation.

Optimization Studies for Bioconversion of Corn Steep Liquor to Ethanol by Saccharomyces cerevisiae Strain Ka-1 and Aan-2

Optimization Studies for Bioconversion of Corn Steep Liquor to Ethanol by Saccharomyces cerevisiae Strain Ka-1 and Aan-2