Sex Determining Region Y-box Research Articles

The effects of centipedegrass extract on hair growth via promotion of anagen inductive activity.

To investigate the CGE on hair growth and to explore the mechanism that is involved in the acceleration of anagen induction, we investigated the effects of CGE studied on cell proliferation and molecular mechanism in human hair dermal papilla cells (hDPCs) and keratinocytes (HaCaT cells). Additionally, hair growth evaluation was carried out following topical treatment of the dorsal skin of telogen C57BL/6 mice with CGE for 14 days. As result, CGE increased cell viability and ALP activity in hDPCs. Moreover, CGE increased the expression of catenin beta 1 (CTNNB1), ALP, sex-determining region Y-box 2 (SOX2), insulin-like growth factor 1 (IGF1), and vascular endothelial growth factor A (VEGFA) genes in hDPCs. CGE increased the expression of proteins such as ALP, β-catenin, and phosphorylation of glycogen synthase kinase 3β (pGSK3β), and protein kinase B (pAKT) in hDPCs. Furthermore, CGE induced the proliferation of HaCaT cells and up-regulated AKT-ERK-GSKβ-β-catenin signaling in HaCaT cells. Additionally, the anagen induction effects of CGE were confirmed on the telogen-anagen transition mice model. these findings demonstrated that CGE promoted the entering the growth phase of hair follicle via activation of β-catenin signaling pathways in vivo. Thus, this study suggests that CGE might be a potential therapeutic reagent for hair growth.

Cadmium disrupts mouse embryonic stem cell differentiation into ovarian granulosa cells through epigenetic mechanisms

Cadmium (Cd) can influence germ cell development, and epigenetic events may be involved. However, there is no study on whether Cd can influence germ cells differentiation into ovarian granulosa cells (GCs), and more insight into the molecular mechanism of the effect of Cd on germ cell development from mouse embryonic stem (ES) cells into ovarian granulosa cells and investigation of appropriate epigenetic factors are of great importance. In this study, mouse ES cell differentiation into GCs was established in an in vitro model. Subsequently, different Cd concentrations of 0, 0.1, 0.3, and 1 and then 3.0, and 10.0 μmol/L were cultured in this in vitro model. We demonstrated that Cd treatment can interrupt ES cell differentiation into GCs by morphology and ultrastructure observation. Four specific markers (octamer-binding transcription factor 4 (OCT4), sex-determining region Y-box 2 (SOX2), Nanog homeobox (Nanog), and Anti-müllerian hormone type II receptor (Amhr2)) were significantly changed as measured by quantitative real-time-PCR or Western blot (p < 0.05). Cd also significantly changed the DNA methylation of GC sites on the CpG island of Nanog according to the sequential mass ARRAYR methylation method (p < 0.05). The MeRIP-qPCR method was used to detect the levels of N6-methyladenosine (m6A) methylation modification of long noncoding RNA (lncRNA) 1281 and indicated that they were decreased (p < 0.05). Microarray chip analysis, miRNA screening, and bioinformatics were used to further explore the roles of marker regulation-related miRNAs, and 27 miRNAs were putatively related to Cd-interrupted differentiation in ES cells. These data indicated that Cd can interrupt ES cell differentiation into GCs and affect germ cell development, and the underlying mechanism may involve epigenetic mechanisms.

In Silico Analysis of Sox2 Gene for Pluripotency Detection at Mouse Embryonic Fibroblast and induced Pluripotent Stem Cell (iPSC)

Stem cells are cells that have not been specialized and have a specific characteristic compared to other cells. There are several transcription factors like Sox2, Oct4, c-Myc, and Nanog to maintain embryonic stem cells. In pluripotent stem cells, sex-determining region Y-box 2 (Sox2) is a critical transcriptional regulator, and for somatic cell reprogramming, which involves returning differentiated cells to a pluripotent embryonic state by reversing their epigenetic arrangement. This study aimed to design primers for detecting the Sox2 gene expressed in Mouse Embryonic Fibroblasts and induced Pluripotency Stem Cell as pluripotency detection in stem cell research. In silico analysis was carried out to detect ofx2gene by using several software such as BLAST to search sequence Sox2 gene from Homo sapiens and Mus musculus, Bioedit for sequence alignment, SnapGene for PCR in silico, and PrimerBlast for online primer design. Primer candidates successfully designed were then analyzed for their secondary structure using NetPrimer. The results showed that forward primer (5'- CTACAGCATGTCCTACTCGCA -3') and reverse primer (5'- ACTTGACCACAGAGCCCA -3') were selected primers for M. musculus. Also, forward primer (5’-CTACAGCATGTCCTACTCGCA-3') and reverse primer (5'- ACTT-GACCACCGAACCCA-3') for Homo sapiens. Detection by PCR in silico using templates from H. sapiens and M. musculus sequences showed that the primers could specifically amplify the Sox2 gene in each species. Nevertheless, laboratory experiments need to be carried out for preliminary validation that has been designed. These primers will be used to measure the gene expression of Sox2 in qRT-PCR to detect the stemness characteristic of stem cells.

LINC00662 Promotes Proliferation and Invasion and Inhibits Apoptosis of Glioma Cells Through miR-483-3p/SOX3 Axis.

LINC00662 plays a prominent role in the carcinogenesis and progression of diverse cancers. However, its biological functions in glioma are still unclear. LINC00662 expression in glioma tissue samples and cell lines was examined by quantitative real-time polymerase chain reaction. The correlation between LINC00662 expression and the clinical characteristics of 50 patients with glioma was analyzed. LINC00662 knockdown and overexpression cell lines were constructed, and the effects of LINC00662 on the proliferation, invasion, and apoptosis of glioma cells were evaluated by cell counting kit-8, 5-ethynyl-2'-deoxyuridine, Transwell, and flow cytometry assays, respectively. Besides, the relationships among LINC00662, miR-483-3p, and sex-determining region Y-box 3 (SOX3) were assessed by dual-luciferase reporter assay and RNA immunoprecipitation assay. Western blot was used to detect the regulatory effects of LINC00662 and miR-483-3p on SOX3 expression in glioma cells. LINC00662 expression level was elevated in glioma tissues and cell lines compared to that in normal tissues and cell lines. LINC00662 high expression was associated with the adverse prognosis of patients with glioma. Knockdown of LINC00662 repressed the proliferation and invasion of glioma cells, and promoted apoptosis. Additionally, it was revealed that LINC00662 acted as the molecular sponge of miR-483-3p, and SOX3 was verified as a direct target of miR-483-3p. The inhibition of miR-483-3p expression and SOX3 overexpression reversed the biological effects of LINC00662 knockdown on glioma cells. This study reports the key regulatory role of LINC00662/miR-483-3p/SOX3 axis in the tumorigenesis and progression of glioma, bringing novel insights into the underlying mechanisms of glioma.

EP459: Rare clinical gene variant of SOX9: Acampomelic campomelic dysplasia

eP459: Rare clinical gene variant of SOX9: Acampomelic campomelic dysplasia

CCAAT/Enhancer-Binding Protein Alpha Is a Novel Regulator of Vascular Smooth Muscle Cell Osteochondrogenic Transition and Vascular Calcification.

AimsVascular calcification is a common clinical complication of chronic kidney disease (CKD), atherosclerosis (AS), and diabetes, which is associated with increased cardiovascular morbidity and mortality in patients. The transdifferentiation of vascular smooth muscle cells (VSMCs) to an osteochondrogenic phenotype is a crucial step during vascular calcification. The transcription factor CCAAT/enhancer-binding protein alpha (C/EBPα) plays an important role in regulating cell proliferation and differentiation, but whether it regulates the calcification of arteries and VSMCs remains unclear. Therefore, this study aims to understand the role of C/EBPα in the regulation of vascular calcification.Methods and ResultsBoth mRNA and protein expression levels of C/EBPα were significantly increased in calcified arteries from mice treated with a high dose of vitamin D3 (vD3). Upregulation of C/EBPα was also observed in the high phosphate- and calcium-induced VSMC calcification process. The siRNA-mediated knockdown of C/EBPα significantly attenuated VSMC calcification in vitro. Moreover, C/EBPα depletion in VSMCs significantly reduced the mRNA expression of the osteochondrogenic genes, e.g., sex-determining region Y-box 9 (Sox9). C/EBPα overexpression can induce SOX9 overexpression. Similar changes in the protein expression of SOX9 were also observed in VSMCs after C/EBPα depletion or overexpression. In addition, silencing of Sox9 expression significantly inhibited the phosphate- and calcium-induced VSMC calcification in vitro.ConclusionFindings in this study indicate that C/EBPα is a key regulator of the osteochondrogenic transdifferentiation of VSMCs and vascular calcification, which may represent a novel therapeutic target for vascular calcification.

Sox9, Hopx, and survivin and tuft cell marker DCLK1 expression in normal canine intestine and in intestinal adenoma and adenocarcinoma.

Self-renewal of the intestinal epithelium originates from stem cells located at the crypt base. Upregulation of various stem cell markers in intestinal epithelial neoplasms indicates a potential role of stem cells in tumorigenesis. In this study, the immunoreactivity of potential intestinal stem cell markers (Sry box transcription factor 9 [Sox9], homeodomain-only protein [Hopx], survivin) and tuft cell marker doublecortin-like kinase 1 (DCLK1) in normal canine intestine and intestinal epithelial neoplasms was investigated. Formalin-fixed paraffin-embedded (FFPE) small and large intestine as well as intestinal neoplasms (55 colorectal adenomas [CRAs], 17 small intestinal adenocarcinomas [SICs], and 12 colorectal adenocarcinomas [CRCs]) were analyzed immunohistologically. Potential stem cell markers Sox9, Hopx, and survivin were detected in the crypts of normal canine small and large intestine. DCLK1+ tuft cells were present in decreasing numbers along the crypt-villus axis of the jejunum and rarely detectable in large intestine. In canine intestinal epithelial tumors, nuclear Sox9 immunoreactivity was detectable in 84.9% (CRA), 80% (CRC), and 77% of epithelial neoplastic cells (SIC). Hopx and survivin were expressed within cytoplasm and nuclei of neoplastic cells in benign and malignant tumors. DCLK1 showed a cytoplasmic reaction within neoplastic cells. The combined score of Hopx, DCLK1, and survivin varied among the examined cases. Overall, malignant tumors showed lower DCLK1 scores but higher Hopx scores in comparison with benign tumors. For survivin, no differences were detectable. In conclusion, stem cell markers Sox9, Hopx, and survivin were detectable at the crypt base and the immunoreactivity of Sox9, DCLK1, survivin, and Hopx was increased in canine intestinal adenomas and adenocarcinomas compared with normal mucosa.

Differences in stem cell marker and osteopontin expression in primary and recurrent glioblastoma

BackgroundDespite of a multimodal approach, recurrences can hardly be prevented in glioblastoma. This may be in part due to so called glioma stem cells. However, there is no established marker to identify these stem cells.MethodsPaired samples from glioma patients were analyzed by immunohistochemistry for expression of the following stem cell markers: CD133, Musashi, Nanog, Nestin, octamer-binding transcription factor 4 (Oct4), and sex determining region Y-box 2 (Sox2). In addition, the expression of osteopontin (OPN) was investigated. The relative number of positively stained cells was determined. By means of Kaplan–Meier analysis, a possible association with overall survival by marker expression was investigated.ResultsSixty tissue samples from 30 patients (17 male, 13 female) were available for analysis. For Nestin, Musashi and OPN a significant increase was seen. There was also an increase (not significant) for CD133 and Oct4. Patients with mutated Isocitrate Dehydrogenase-1/2 (IDH-1/2) status had a reduced expression for CD133 and Nestin in their recurrent tumors. Significant correlations were seen for CD133 and Nanog between OPN in the primary and recurrent tumor and between CD133 and Nestin in recurrent tumors. By confocal imaging we could demonstrate a co-expression of CD133 and Nestin within recurrent glioma cells. Patients with high CD133 expression had a worse prognosis (22.6 vs 41.1 months, p = 0.013). A similar trend was seen for elevated Nestin levels (24.9 vs 41.1 months, p = 0.08).ConclusionsMost of the evaluated markers showed an increased expression in their recurrent tumor. CD133 and Nestin were associated with survival and are candidate markers for further clinical investigation.

MiR-146a Inhibited Pancreatic Cancer Cell Proliferation by Targeting SOX7.

MicroRNAs (miRNAs) act as a kind of small and noncoding RNA, which have been implicated in the regulation of various pathobiological processes in cancer, including progression in pancreatic cancer and in other human cancers. Previous reports demonstrate that pancreatic cancer has been reported as one of the leading causes of cancer-related death, and some factors including oncogenic genes and environments are involved in tumorigenesis. In our study, we found microRNA-146a (miR-146a) was evidently downregulated in pancreatic cancer tissues and cells. Overexpression of miR-146a obviously reduced cell proliferation and tumorigenesis in vitro, as determined by MTT analysis, colony formation analysis, EdU analysis, and cell cycle experiments. Here, we found tumor suppressor sex-determining region Y-box 7 (SOX7) was the direct target of miR-146a. Overexpression of miR-146a decidedly inhibited SOX7 expression, which promotes cell proliferation and tumorigenesis. Knockdown of miR-146a increased SOX7 expression. Depression of miR-146a and SOX7 promoted cell proliferation and tumorigenesis in vitro, confirming miR-146a regulated pancreatic cancer cell proliferation by inhibiting SOX7. In summary, we found miR-146a reduced the cell proliferation of pancreatic cancer through targeting SOX7. In the present study, we demonstrated the function of miR-146a in pancreatic cancer and might provide a new target in the treatment of pancreatic cancer.

LncRNA LINC01315 silencing modulates cancer stem cell properties and epithelial-to-mesenchymal transition in colorectal cancer via miR-484/DLK1 axis

ABSTRACT Long non-coding RNA long intergenic non-protein coding RNA 01315 (LncRNA LINC01315) has been found to be implicated in various cancers, but its role and functions in colorectal cancer (CRC) remain to be addressed. Data on LINC01315 expression in CRC were gathered using bioinformatics analysis, and cancer stem cells (CSCs) were sorted by aldehyde dehydrogenase (ALDH) assay and flow cytometry. Migration, invasion, and stemness of CSCs isolated from CRC cells after transfection were determined by scratch, Transwell, and sphere-formation assays, respectively. Tumor xenograft model was constructed. Target genes and potential-binding sites were predicted using online databases and further confirmed via dual-luciferase reporter assay. Relative factors expressions were determined via quantitative real-time polymerase-chain reaction and Western blot as needed. LINC01315 was high-expressed in CRC and ALDH+ cells. LINC01315 silencing suppressed the migration, invasion, and sphere formation of CRC cells and tumor growth, and downregulated expressions of CSC molecules (ALDH, cluster of difference 44 (CD44), Prominin, and sex determining region Y-box 2 (SOX2)), Zinc Finger E-Box Binding Homeobox 1 (ZEB1) and Vimentin but upregulated E-Cadherin expression. MiR-484 could competitively bind with LINC01315, and LINC01315 silencing promoted miR-484 expression. The level of Delta Like Non-Canonical Notch Ligand 1 (DLK1), the target gene of miR-484, was enhanced by overexpressed LINC01315 yet was suppressed by LINC01315 silencing. Also, DLK1 silencing reversed the effects of downregulated miR-484 on migration, invasion, sphere formation, and CSC molecules expressions in CRC cells. LINC01315 silencing modulated CSC properties and epithelial-to-mesenchymal transition via miR-484/DLK1 axis.

SOX9 contributes to the progression of ductular reaction for the protection from chronic liver injury.

The transcription factor sex-determining region Y-box 9 (SOX9) is a biliary epithelial marker ectopically expressed in hepatocytes (SOX9 + hepatocytes). SOX9 + hepatocytes are believed to function in ductular reaction (DR), recognized as an essential phenomenon related to liver regeneration; however, the functional role of SOX9 and clinical implications of SOX9 + hepatocytes in DR progression are unclear. Human and mouse liver samples were subjected to immunohistochemical and gene functional analyses to investigate the functional role of SOX9 and the clinical significance of SOX9 + hepatocytes. SOX9 + hepatocytes were observed in a bile duct ligation (BDL) mouse model. Forced Sox9 expression in mouse hepatocytes by hydrodynamic injection converted them into cholangiocyte-like cells. DR progression was slower in liver epithelium-specific Sox9-knockout BDL mice than in wild-type BDL mice. SOX9 + hepatocytes were also observed in rare pediatric liver disease biliary atresia (BA). In patients with BA who underwent liver transplantation (LT), the median number of SOX9 + hepatocytes at LT was significantly lower than that at Kasai portoenterostomy (KP) performed prior to LT (P < 0.001). The high SOX9 + hepatocyte group at KP demonstrated significantly better native liver survival rates than the low SOX9 + hepatocyte group at a cut-off of 390 cells/mm2 (P = 0.019, log-rank test). Ectopic expression of SOX9 in hepatocytes of chronically injured livers may exert protective effects in DR progression. To our knowledge, this is the first study showing that SOX9 + hepatocyte count at KP can be a promising biomarker to predict native liver survival after KP in patients with BA.

Sestrin2 reduces cancer stemness via Wnt/\u03b2-catenin signaling in colorectal cancer

BackgroundColorectal cancer (CRC) is one of the most commonly diagnosed cancers in both men and women in China. In previous studies, Sestrin2 was demonstrated to have functions in CRC. However, the relationship between Sestrin2 and cancer stemness has not been reported.Methods and resultsTo investigate the contribution of Sestrin2 in CRC, we performed bioinformatics analysis of The Cancer Genome Atlas datasets and found that Sestrin2 was downregulated in CRC. Using a lentivirus vector, we verified that Sestrin2 suppressed CRC cell proliferation, migration, and colony formation. Furthermore, sphere formation, flow cytometry, quantitative PCR, and western blot analysis verified the influence of Sestrin2 on cancer stemness, including the expression of cluster of differentiation 44, octamer-binding transcription factor 4, sex-determining region Y-Box 2, CXC chemokine receptor 4, and the Wnt pathway downstream factors β-catenin and c-Myc. Consistently, the Wnt pathway activator BML-284 partially rescued the effects of Sestrin2 on the expression of proteins related to cancer stemness. Furthermore, in a mouse xenoplant model, tumors expressing Sestrin2 were significantly reduced in size with corresponding changes in cancer stemness.ConclusionsCollectively, our results suggest that Sestrin2 inhibits CRC cell progression by downregulating the Wnt signaling pathway. Thus, Sestrin2 may be a promising therapeutic target for CRC.

Probiotic supplementation alleviates absence seizures and anxiety- and depression-like behavior in WAG/Rij rat by increasing neurotrophic factors and decreasing proinflammatory cytokines

AimEpilepsy is one of the most common chronic brain disorders that affect millions of people worldwide. In the present study, we investigated the effects of probiotic supplementation on absence epilepsy and anxiety-and depression-like behavior in WAG/Rij rats. Material and methodFourteen male WAG/Rij rats (absence-epileptic) and seven male Wistar rats (nonepileptic) were used. The effects of probiotic VSL#3 (12.86 bn living bacteria/kg/day for 30 day/gavage) on absence seizures, and related psychiatric comorbidities were evaluated in WAG/Rij rats. Anxiety-like behavior was evaluated by the open-field test and depression-like behavior by the forced swimming test. In addition, the brain tissues of rats were evaluated histopathologically for nerve growth factor [NGF], brain-derived neurotrophic factor [BDNF], SRY sex-determining region Y-box 2 [SOX2] and biochemically for nitric oxide [NO], tumor necrosis factor-alpha [TNF-α] ,and Interleukin-6 [IL-6]. ResultsCompared to Wistar rats, WAG/Rij rats exhibited anxiety- and depression-like behavior, and had lower BDNF, NGF and SOX2 immunoreactivity, and higher TNF-α, IL-6 levels in brain tissue. VSL#3 supplementation reduced the duration and number of spike-wave discharges (SWDs) and exhibited anxiolytic or anti-depressive effect. VSL#3 supplement also increased the NGF immunoreactivity while decreasing IL-6, TNF-α and NO levels in WAG/Rij rat brain. ConclusionThe findings of the present study showed that neurotrophins, SOX2 deficiency, and pro-inflammatory cytokines may play a role in the pathogenesis of absence epilepsy. Our data support the hypothesis that the probiotics have anti-inflammatory effect. The present study is the first to show the positive effects of probiotic bacteria on absence seizures and anxiety- and depression-like behavior.

Response of human glioblastoma cells to hyperthermia: Cellular apoptosis and molecular events

Glioblastoma multiforme (GBM) also categorized as a grade IV astrocytoma, is an aggressive brain tumor which invades the surrounding brain tissue. Hyperthermia is known to be effective for chemo-radiotherapy to sensitize cancer cells to radiation as a treatment option for patients with GBM. The current study was performed in order to assess and compare the properties of the astrocyte and cancer stem cells isolated from glioblastoma exposed to hyperthermia. Astrocytes and cancer stem cells were isolated from human glioblastoma tissue. Glioblastoma tissues were digested and cultured in culture medium supplemented with B27, basic fibroblast growth factor and epidermal growth factor. The morphology and specific markers were evaluated in astrocyte and cancer stem cell of human glioblastoma through immunocytochemistry and quantitative real-time RT-PCR. The multipotentiality of cancer stem cells was presented using differentiation potential into neurons, oligodendrocytes, and astrocytes. For hyperthermia, cells were exposed to temperatures at 4246 °C for 1 h using a water bath. Cell survival rate by MTT assay and apoptosis using quantitative real-time RT-PCR and western blot were evaluated. Results demonstrated that there were two morphology types in cell culture including epithelioid morphology and fibroblastic morphology. Astrocytes were confirmed via expression of the Glial fibrillary acidic protein (GFAP) protein; whereas, cancer stem cells (CSCs) were round and floating in the culture medium. Immunocytochemical staining indicated that nestin, CD133 and SRY-box 2 (SOX2) antigens were positively expressed in primary neurospheres. Results indicated that cancer stem cells of glioblastoma are multipotent and are able to differentiate into neurons, oligodendrocytes, and astrocytes. The current study obtained evidence via apoptosis evaluation that CSCs are resistant to hyperthermia when compared to astrocytes isolated from glioblastoma. Furthermore, hyperthermia was demonstrated to decrease cell resistance, which may be effective for chemo-radiotherapy to sensitize cancer cells to radiation. Taken together, CSCs of glioblastoma could be used as a powerful tool for evaluating the tumorigenesis process in the brain and developing novel therapies for treatment of GBM.

Sox9/CXCL5 axis facilitates tumour cell growth and invasion in hepatocellular carcinoma.

High rates of metastasis and postsurgical recurrence contribute to the higher mortality of hepatocellular carcinoma (HCC), partly due to cancer stem cell (CSC)-dependent tumorigenesis and metastasis. Sex-determining region Y-box 9 (Sox9) has been previously characterized as a candidate CSC marker of HCC. Here, we observed that the increase of Sox9 significantly promoted HCC cell growth and invasion in cell cultures, whereas knockdown of Sox9 showed the opposite effects, suggesting that Sox9 may regulate the proliferation and invasion of hepatoma cells in an autocrine manner. RNA sequencing, together with functional assays and clinical analyses, identified CXCL5 as a key mediator downstream of Sox9 in HCC cells. Mechanistic studies revealed that Sox9 induced CXCL5 expression by directly binding to a promoter region. Using gain- and loss-of-function approaches, we demonstrated that the intrinsic effective role of Sox9 in hepatoma cell growth and invasion depended on CXCL5, and that blockade of CXCL5/CXCR2 signalling abolished Sox9-triggered HCC cell proliferation and migration. Furthermore, the Sox9/CXCL5 axis activated PI3K-AKT and ERK1/2 signalling which are implicated in regulating HCC cell proliferation and invasion. Finally, the Sox9/CXCL5 axis contributed to the infiltration of neutrophils and macrophages in both tumour and peritumoral tissues from the orthotopic xenograft model. In summary, our data identify the Sox9/CXCL5 axis as an endogenous factor in controlling HCC cell growth and invasion, thereby raising the possibility of pharmacologic intervention with CXCL5/CXCR2 pathway inhibitors in therapy for HCC patients with higher Sox9 expression.

Folic acid pretreatment and its sustained delivery for chondrogenic differentiation of MSCs

Dietary uptake of folic acid (FA) improves cartilage regeneration. In this work, we discovered that three days of FA treatment is highly effective for promoting chondrogenic differentiation of tonsil-derived mesenchymal stem cells (TMSCs). In a three-dimensional pellet culture, the levels of typical chondrogenic biomarkers, sulfated glycosaminoglycan, proteoglycan, type II collagen (COL II), SRY box transcription factor 9 (SOX 9), cartilage oligomeric matrix protein (COMP), and aggrecan (ACAN) increased significantly in proportion to FA concentration up to 30 μM. At the mRNA expression level, COL II, SOX 9, COMP, and ACAN increased 3.6–6.0-fold with FA treatment at 30 μM compared with the control system that did not receive FA treatment, and the levels with FA treatment were 1.6–2.5 times greater than those in the kartogenin-treated positive control system. FA treatment did not increase type I collagen α1 (COL I α1), an osteogenic biomarker which is a concern with most chondrogenic promoters. At the high FA concentration of 100 μM, significant decreases in chondrogenic biomarkers were observed, which might be related to DNA methylation. A thermogel system incorporating TMSCs and FA provided sustained release of FA over several days, similar to the FA treatment. The thermogel system confirmed the efficacy of FA in promoting chondrogenic promotion of TMSCs. The increased nuclear translocation of core-binding factor β subunit (CBFβ) and the runt-related transcription factor 1 (RUNX1) expression after FA treatment, together with molecular docking studies, suggest that the chondrogenic enhancement mechanism of FA is mediated by CBFβ and RUNX1.

Pralatrexate Sustainably Released from Polypeptide Thermogel Is Effective for Chondrogenic Differentiation of Mesenchymal Stem Cells.

Folic acid was reported to significantly improve chondrogenic differentiation of mesenchymal stem cells. In a similar mechanism of action, we investigated clinically approved antifolates by the U.S. Food and Drug Administration as chondrogenic-promoting compounds for tonsil-derived mesenchymal stem cells. A poly(ethylene glycol)-poly(l-alanine) thermogelling system was used as a three-dimensional cell culture matrix, where stem cells and antifolates could be incorporated simultaneously during a heat-induced in situ sol-to-gel transition. The antifolates could be supplied over several days by the sustained release of the drug from the thermogel. Initially, seven antifolates were prescreened based on cell viability and expression of a typical chondrogenic biomarker of type II collagen (COL II) at the mRNA level. Then, dapsone, pralatrexate, and trimethoprim were selected as candidate compounds in the second round screening, and detailed studies were carried out on the mRNA and protein expression of various chondrogenic biomarkers including COL II, SRY box transcription factor 9, and aggrecan. Three-dimensional cultures of stem cells in the thermogel in the absence of a chondrogenic promoter compound and in the presence of kartogenin (KGN) were performed as a negative control and positive control, respectively. The chondrogenic biomarkers were significantly increased in the selected antifolate-incorporating systems compared to the negative control system, without an increase in type I collagen (an osteogenic biomarker) expression. Pralatrexate was the best compound for inducing chondrogenic differentiation of the stem cells, even better than the positive control (KGN). Nuclear translocation of the core-binding factor β subunit (CBFβ) and enhanced nuclear runt-related transcription factor 1 (RUNX1) by antifolate treatment suggested that the chondrogenesis-enhancing mechanism is mediated by CBFβ and RUNX1. An in silico modeling study confirmed the mechanism by proving the high binding affinity of pralatrexate to a target protein of filamin A compared with other antifolate candidates. To conclude, pralatrexate was rediscovered as a lead compound, and the polypeptide thermogel incorporating pralatrexate and mesenchymal stem cells can be a very effective system in promoting chondrogenic differentiation of stem cells and might be used in injectable tissue engineering for cartilage repair.

N(6)-methyladenosine RNA methyltransferase like 3 inhibits extracellular matrix synthesis of endplate chondrocytes by downregulating sex-determining region Y-Box transcription factor 9 expression under tension

Tension stimulation is an important inducer of endplate cartilage degeneration, but the specific regulatory mechanism remains unclear. This study was the first to reveal the mechanism by which methyltransferase-like 3 (METTL3)-mediated N(6)-methyladenosine (m6A) modification affected the extracellular matrix anabolism by tension-induced endplate chondrocytes. We examined the differences in METTL3 expression and m6A methylation levels in human endplate chondrocytes and human cartilage endplate tissues under in vitro tension. The effect on endplate cartilage degeneration was evaluated by manipulating m6A methylation mediated by METTL3 in vivo and in vitro. The effect of METTL3-mediated m6A methylation on the stability of sex-determining region Y-box transcription factor 9 (SOX9) gene expression was determined experimentally. METTL3 expression and m6A methylation levels were significantly increased in degenerative human endplate cartilage tissue. Similarly, tension stimulation inhibited the ability of human endplate chondrocytes to synthesize extracellular matrix, which was accompanied by an increase in METTL3-mediated m6A methylation. The ability of endplate chondrocytes to resist tension was significantly enhanced by inhibiting METTL3 expression and subsequently downregulating m6A methylation in vitro and in vivo, thereby reducing intervertebral disc degeneration. Furthermore, METTL3 mediated SOX9 RNA methylation and disrupted SOX9 mRNA stability, thereby inhibiting the gene expression of the downstream collagen type II alpha 1 chain. Tension stimulation downregulated SOX9 expression through METTL3-mediated m6A methylation, thereby inhibiting the synthesis of extracellular matrix in endplate chondrocytes.

ROS Promote Hypoxia-Induced Keratinocyte Epithelial-Mesenchymal Transition by Inducing SOX2 Expression and Subsequent Activation of Wnt/β-Catenin.

We previously showed that wound-induced hypoxia is related to keratinocyte migration. The ability of keratinocytes within wound healing to undergo epithelial to mesenchymal transition (EMT) contributes significantly to the acquisition of migratory properties. However, the effect of hypoxia on keratinocyte EMT on wound healing and the potential mechanism are poorly documented. This study first demonstrated that reactive oxygen species (ROS) appear to be an essential signalling mediator in keratinocytes with increased EMT and migration subjected to hypoxic conditions. Next, we showed that the expression of sex-determining region Y-box 2 (SOX2), a stemness-associated molecule, is ROS-dependent under hypoxia and that SOX2 inhibition in keratinocytes dramatically prevented hypoxia-induced EMT and migration. In addition, β-catenin was found to be a potential molecular target of SOX2, and the activation of Wnt/β-catenin was required for hypoxia-induced EMT and migration. Using an in vitro skin culture model and an in vivo skin wound model, our study further reinforced the critical role of ROS in inducing EMT through SOX2 expression and subsequent activation of Wnt/β-catenin, allowing for rapid reepithelialization of the wound area. Taken together, our findings reveal a previously unknown mechanism by which hypoxia promotes wound healing by promoting reepithelialization through the production of ROS, inducing keratinocyte EMT and migration via the enhancement of SOX2 and activation of Wnt/β-catenin.

Zinc finger protein 852 is essential for the proliferation, drug sensitivity, and self-renewal of gastric cancer cells.

Exploring cellular and molecular mechanisms responsible for gastric cancer growth, survival, self-renewal, and metastasis helps develop efficacious therapeutic strategies. In this study, the expression and function of zinc finger protein 852 (ZNF852) in human gastric cancer cell lines were characterized. ZNF852 was upregulated in gastric cancer cell lines relative to normal gastric epithelial cell line GES-1. When the ZNF852 gene was ablated in gastric cancer cell line MGC-803 using the CRISPR/Cas9-encoding lentivirus, the proliferation of MGC-803 was suppressed. ZNF852 deficiency also resulted in the inhibition of MGC-803 sphere formation, along with decreases in SRY-box 2 (SOX2), octamer-binding transcription factor 4 (OCT4), and Nanog homeobox (NANOG), suggesting that ZNF852 sustains self-renewal of MGC-803 cells. Furthermore, ZNF852 deficiency increased oxaliplatin-induced MGC-803 cell death, implying the role of ZNF852 in drug sensitivity. Subcutaneous infusion of MGC-803 cells into nude mice illustrated the same effects of ZNF852 on the proliferation and self-renewal of gastric cancer cells. Similar effects of ANF852 were also seen in gastric cancer cell line SNU-1. Interestingly, ZNF852 deficiency caused downregulation of epidermal growth factor receptor (EGFR) on gastric cancer cells. In summary, this study uncovers the positive regulatory role of ZNF852 in gastric cancer growth and maintenance. ZNF852 could be a potential therapeutic target for inhibiting gastric cancer initiation or progression.