Spotted Wilt Research Articles

Rising orthotospovirus incidence in India: Challenges and advances in management

Orthotospoviruses (OV) have emerged as a significant agricultural threat in India, posing a severe risk to critical crops, including tomato, chilli, watermelon and groundnut. This review explores the rising incidence of OV, including Groundnut Bud Necrosis Orthotospovirus (GBNV), Watermelon Bud Necrosis Orthotospovirus (WBNV), Capsicum Chlorosis Orthotospovirus (CaCV), Peanut Yellow Spot Orthotospovirus (PYSV), Iris yellow spot Orthotospovirus (IYSV) and Tomato Spotted Wilt Orthotospovirus (TSWV), along with the challenges in their management. These viruses have led to severe yield losses, sometimes causing complete crop failure due to their wide host range and the polyphagous nature of thrips. This further complicates control efforts by facilitating rapid spread across diverse crops and regions. The review highlights the multifaceted challenges in managing OV and thrips, including the lack of durable host resistance, limited diagnostic capabilities, and difficulties in controlling thrips populations. Current management strategies, including cultural practices, chemical control, biological control and resistant genotype development, have shown limited efficacy in providing long-term solutions. Recent advancements in biotechnological approaches, such as RNA interference, are discussed as promising pathways for improved virus management. The review underscores the need for genome editing techniques, such as CRISPR/Cas9, which offer the capacity to develop virus-resistant plants by targeting essential viral or vector genes to disrupt transmission cycles. Additionally, using nanoparticles for targeted delivery of antiviral compounds and novel detection tools presents another innovative solution to effectively mitigate the impact of OV on Indian agriculture.

Development of Imidazo[1,2-a]pyridines Containing Sulfonyl Piperazines as Potential Antivirals against Tomato Spotted Wilt Virus.

Mesoionic structures have become important advancements in recent agrochemical design. However, their potential beyond serving as excellent insecticides remains unexplored with limited reports available. Herein, a series of imidazo[1,2-a]pyridine mesoionics were developed by structurally incorporating sulfonyl piperazine moieties into imidazo[1,2-a]pyridines. Many of the obtained derivatives demonstrated bioactivity against tomato spotted wilt virus (TSWV) in bioassays. In particular, compound Z40, identified via three-dimensional quantitative structure activity relation models, displayed encouraging protective performance (half-maximal effect concentration = 252 μg/mL) compared to the positive controls ningnanmycin (332 μg/mL) and vanisulfane (523 μg/mL). Through defense enzyme assays, real-time quantitative polymerase chain reaction, and proteomics analysis, Z40 was identified as a plant immunomodulator that promotes defense enzyme activity and the mediates oxidative phosphorylation pathway, enabling plants to resist TSWV. We expect this study to help expand the possibilities of mesoionic compounds.

Integrated Biological Experiments and Proteomic Analyses of Nicotiana tabacum Xylem Sap Revealed the Host Response to Tomato Spotted Wilt Orthotospovirus Infection

Integrated Biological Experiments and Proteomic Analyses of Nicotiana tabacum Xylem Sap Revealed the Host Response to Tomato Spotted Wilt Orthotospovirus Infection

Arctium lappa is a new Natural Host of Tomato Spotted Wilt Virus in Korea.

Burdock (Arctium lappa L., belongs to the family Asteraceae), is an edible plant and an oriental medicinal herb in Korea (Han and Koo, 1993). In July 2023, burdocks showing chlorotic ringspots and yellowing on the leaves were observed in nine of approximately 4,000 plants in a greenhouse in Daegu, South Korea. To determine the causal virus species, nine symptomatic leaves from each individual plant were collected and tested using commercially available immunostrips (Agdia, Elkhart, USA) for cucumber mosaic virus (CMV) and tomato spotted wilt virus (TSWV). Seven out of nine samples tested positive for TSWV only. TSWV in South Korea was first reported on sweet pepper from Yesan in 2004 (Kim et al., 2004) and has since spread to various crops. The first report of TSWV infecting burdock plants in the world was from Hawaii in 1995 (Bautista et al., 1995), but TSWV-infected burdock has not been reported in Korea. To further confirm the presence of TSWV, total RNA was extracted from TSWV-positive burdock leaves using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and used in reverse transcription-polymerase chain reaction (RT-PCR) assays with a specific primer set that amplifies 777 bp of nucleocapsid gene (N gene) of TSWV (Yoon et al., 2014). To obtain the complete genome sequence of this TSWV in the burdock plant, named TSWV-DG, fragments of L, M, and S segments were amplified and sequenced. The complete genome sequences of the L (8914 nt), M (4773 nt), and S (2946 nt) segments were obtained by overlapping RT-PCR amplicons. RT-PCR products were cloned into the pGEM-T Easy vector, and selected DNA clones were sequenced using Sanger method (Bioneer, Korea). The complete genome sequences were deposited to GenBank (LC790665, LC790666, and LC790667, respectively). BLASTn analysis showed that sequences of each TSWV-DG segment had maximum nucleotide identities of 99.5%, 99.5%, and 99.5% with TSWV-L, TSWV-M, and TSWV-S (OM154971, OM154970, and OM154969, respectively), which were isolated from water dropwort (Oenanthe crocata) in China (Qiu et al., 2023). To assess the biological activity of TSWV-DG, A. lappa and Nicotiana benthamiana were inoculated mechanically with sap from infected burdock leaves and maintained for visual inspection of virus symptoms at 25 ℃ at 3 weeks. TSWV-DG produced symptoms on the systemic leaves of A. lappa, that included chlorotic spots and yellowing, and on the leaves of N. benthamiana, that included chlorotic spots and mosaic patterns from 14 days-post-inoculation. Meanwhile, mock-inoculated A.lappa and N.benthamiana remained symptomless. The presence of TSWV on the inoculated leaves was subsequently confirmed through Immunostrip and RT-PCR analyses. TSWV may pose a significant threat to the production of A. lappa, which is cultivated as both leafy greens and root vegetables in Korea. Furthermore, A. lappa may not only be at risk of damage from TSWV infection but also act as a potential source of TSWV infection, thereby posing a risk of transmission to other key crops in Korea, such as pepper or potato (Yoon et al., 2014). This is the first report TSWV infecting burdock in South Korea.

Presence of Tomato Spotted Wilt Virus between cress and pepper intercropped in Kumluca district of Turkey

Presence of Tomato Spotted Wilt Virus between cress and pepper intercropped in Kumluca district of Turkey

Dual Guardians of Immunity: FoRab10 and FoRab29 in Frankliniella occidentalis Confer Resistance to Tomato Spotted Wilt Orthotospovirus.

Rab GTPase is critical for autophagy processes and is implicated in insect immunity against viruses. In this study, we aimed to investigate the role of FoRabs in the autophagic regulation of antiviral defense against tomato spotted wilt orthotospovirus (TSWV) in Frankliniella occidentalis. Transcriptome analysis revealed the downregulation of FoRabs in viruliferous nymph and adults of F. occidentalis in response to TSWV infection. Manipulation of autophagy levels with 3-MA and Rapa treatments resulted in a 5- to 15-fold increase and a 38-64% decrease in viral titers, respectively. Additionally, interference with FoRab10 in nymphs and FoRab29 in adults led to a 20-90% downregulation of autophagy-related genes, a decrease in ATG8-II (an autophagy marker protein), and an increase in the TSWV titers by 1.5- to 2.5-fold and 1.3- to 2.0-fold, respectively. In addition, the leaf disk and the living plant methods revealed increased transmission rates of 20.8-41.6 and 68.3-88.3%, respectively. In conclusion, FoRab10 and FoRab29 play a role in the autophagic regulation of the antiviral defense in F. occidentalis nymphs and adults against TSWV, respectively. These findings offer insights into the intricate immune mechanisms functional in F. occidentalis against TSWV, suggesting potential targeted strategies for F. occidentalis and TSWV management.

Twindemic Threats of Weeds Coinfected with Tomato Yellow Leaf Curl Virus and Tomato Spotted Wilt Virus as Viral Reservoirs in Tomato Greenhouses.

Tomato yellow leaf curl virus (TYLCV) and tomato spotted wilt virus (TSWV) are well-known examples of the begomovirus and orthotospovirus genera, respectively. These viruses cause significant economic damage to tomato crops worldwide. Weeds play an important role in the ongoing presence and spread of several plant viruses, such as TYLCV and TSWV, and are recognized as reservoirs for these infections. This work applies a comprehensive approach, encompassing field surveys and molecular techniques, to acquire an in-depth understanding of the interactions between viruses and their weed hosts. A total of 60 tomato samples exhibiting typical symptoms of TYLCV and TSWV were collected from a tomato greenhouse farm in Nonsan, South Korea. In addition, 130 samples of 16 different weed species in the immediate surroundings of the greenhouse were collected for viral detection. PCR and reverse transcription-PCR methodologies and specific primers for TYLCV and TSWV were used, which showed that 15 tomato samples were coinfected by both viruses. Interestingly, both viruses were also detected in perennial weeds, such as Rumex crispus, which highlights their function as viral reservoirs. Our study provides significant insights into the co-occurrence of TYLCV and TSWV in weed reservoirs, and their subsequent transmission under tomato greenhouse conditions. This project builds long-term strategies for integrated pest management to prevent and manage simultaneous virus outbreaks, known as twindemics, in agricultural systems.

Multigenic Hairpin Transgenes in Tomato Confer Resistance to Multiple Orthotospoviruses Including Sw-5 Resistance-Breaking Tomato Spotted Wilt Virus.

Tomato spotted wilt virus (TSWV) and related thrips-borne orthotospoviruses are a threat to food and ornamental crops. Orthotospoviruses have the capacity for rapid genetic change by genome segment reassortment and mutation. Genetic resistance is one of the most effective strategies for managing orthotospoviruses, but there are multiple examples of resistance gene breakdown. Our goal was to develop effective multigenic, broad-spectrum resistance to TSWV and other orthotospoviruses. The most conserved sequences for each open reading frame (ORF) of the TSWV genome were identified, and comparison with other orthotospoviruses revealed sequence conservation within virus clades; some overlapped with domains with well-documented biological functions. We made six hairpin constructs, each of which incorporated sequences matching portions of all five ORFs. Tomato plants expressing the hairpin transgene were challenged with TSWV by thrips and leaf-rub inoculation, and four constructs provided strong protection against TSWV in foliage and fruit. To determine if the hairpin constructs provided protection against other emerging orthotospoviruses, we challenged the plants with tomato chlorotic spot virus and resistance-breaking TSWV and found that the same constructs also provided resistance to these related viruses. Antiviral hairpin constructs are an effective way to protect plants from multiple orthotospoviruses and are an important strategy in the fight against resistance-breaking TSWV and emerging viruses. Targeting of all five viral ORFs is expected to increase the durability of resistance, and combining them with other resistance genes could further extend the utility of this disease control strategy. [Formula: see text] Copyright © 2024 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.

Comparison of Field Performance of Georgia-16HO and Florunner Cultivars in the Presence of Tomato Spotted Wilt

Field experiments were conducted at Tifton, Georgia from 2019 to 2020 to compare the effects of new peanut (Arachis hypogaea L.) cultivar ‘Georgia-16HO’ with the former industry standard cultivar ‘Florunner’, and in-furrow applications of phorate or imidacloprid insecticides on severity of tomato spotted wilt (TSW) caused by Tomato spotted wilt virus (TSWV), resultant yield, and crop value. Incidence of TSW was much lower for Georgia-16HO than for Florunner in both years, with differences more obvious in 2019 when the virus pressure was higher. Yield was greater for Georgia-16HO than Florunner in both years with greater differences when disease pressure was higher. Across all treatments, adjusted crop value for Georgia-16HO was ~$1450 /ha greater than for Florunner in 2019 and ~$839 /ha greater in 2020.

Advanced methods for insect nets: red-colored nets contribute to sustainable agriculture

Development of advanced pest control methods that do not rely on insecticides is an important issue for sustainable agriculture. Particularly with regards to micro pests that are not only highly resistant to various insecticides but also because we are running out of options for which insecticide to use against them, resulting in enormous economic damage worldwide. Here we report that the effectiveness of the conventional insect net can be greatly advanced by changing their color to red that helps significantly reduce pesticide use. We demonstrate the red effect using Onion thrips, Thrips tabaci a main vector of Iris Yellow Spot Virus (IYSV) and Tomato Spotted Wilt Virus (TSWV) that cause serious damage to various vegetables. New red nets succeeded in suppressing the invasion rates and damages (white spots on the leaves) in a Welsh onion greenhouse with minimum use of pesticides. We discuss how red nets are compatible with labor-saving, sustainable agriculture and the future potential of “optical pest control” based on insect color vision and its behavioral response.

Study on the automatic detection of pepper TSWV disease based on ResNet

This study focuses on the development of a binary classification model for Tomato Spotted Wilt Virus (TSWV) recognition in peppers. A diverse dataset is created for model training, which incorporates TSWV-infected pepper imagery with varying infection severity and regions of different sizes and resolution. The model is trained based on ResNet-18 architecture, resulting in excellent performance of metrics with scores reaching 0.990. Thus, the developed model may have applicational potential for pepper TSWV recognition in real-life conditions.

Incidence of Cymbidium Mosaic Virus (CYMV), Odontoglossum ring spot virus (ORSV), Tomato Spotted Wilt Virus (TSWV), Potex Virus and Poty virus on Dendrobium

Orchid plants collected from different nurseries were tested for Cymbidium Mosaic Virus (CYMV), Odontoglossum ring spot virus (ORSV), Tomato Spotted Wilt Virus (TSWV), Potex virus and Poty virus with Enzyme Linked Immunosorbent Assay (ELISA). Positive samples were tested for presence of Cymbidium Mosaic Virus and ORSV, Tomato Spotted Wilt Virus (TSWV), Potex Virus and Poty virus through transmission electron microscopy (TEM). In this comparative study, compared to other virus Cymbidium Mosaic Virus (CYMV) infected more, in Dendrobium orchids than Odontoglossum ring spot virus (ORSV), Tomato Spotted Wilt Virus (TSWV), Potex virus, Poty virus.

Pathological Features and Genetic Polymorphism Analysis of Tomato Spotted Wilt Virus in Infected Tomato Fruit.

An in-house tomato inbred line, YNAU335, was planted in a greenhouse in spring from 2014 to 2017, and showed immunity to tomato spotted wilt virus (TSWV). YNAU335 was infected with TSWV in the spring from 2018 to 2020, and disease was observed on the leaves, sepals, and fruits. In 2021 and 2022, YNAU335 was planted in spring in the same greenhouse, which was suspected of being infected with TSWV, and visible disease symptoms were observed on the fruits. Transmission electron microscopy, deep sequencing of small RNAs, and molecular mutation diagnosis were used to analyze the pathological features and genetic polymorphism of TSWV infecting tomato fruit. Typical TSWV virions were observed in the infected fruits, but not leaves from YNAU335 grown between 2021 and 2022, and cross-infection was very rarely observed. The number of mitochondria and chloroplasts increased, but the damage to the mitochondria was greater than that seen in the chloroplasts. Small RNA deep sequencing revealed the presence of multiple viral species in TSWV-infected and non-infected tomato samples grown between 2014-2022. Many virus species, including TSWV, which accounted for the largest proportion, were detected in the TSWV-infected tomato leaves and fruit. However, a variety of viruses other than TSWV were also detected in the non-infected tissues. The amino acids of TSWV nucleocapsid proteins (NPs) and movement proteins (MPs) from diseased fruits of YNAU335 picked in 2021-2022 were found to be very diverse. Compared with previously identified NPs and MPs from TSWV isolates, those found in this study could be divided into three types: non-resistance-breaking, resistance-breaking, and other isolates. The number of positive clones and a comparison with previously identified amino acid mutations suggested that mutation F at AA118 of the MP (GenBank OL310707) is likely the key to breaking the resistance to TSWV, and this mutation developed only in the infected fruit of YNAU335 grown in 2021 and 2022.

First Report of Tomato Spotted Wilt Virus infecting Lettuce in Yuma, Arizona.

Tomato spotted wilt virus (TSWV, family Tospoviridae, genus Orthotospovirus) is a thrips-vectored pathogen that infects lettuce (Lactuca sativa) and many vegetable crops (Kuo et al. 2014, Hasegawa et al. 2022). Another thrips-borne pathogen of lettuce, impatiens necrotic spot virus (INSV, Tospoviridae, Orthotospovirus), was first reported in 2021 in Yuma, Arizona (Hasegawa et al. 2022). Symptoms of both viruses in lettuce are similar and include necrotic spotting, leaf chlorosis and plant stunting (Kuo et al. 2014). Beginning February through April of 2022, lettuce displaying symptoms of orthotospovirus infection was collected from romaine lettuce (var. longifolia) fields in three regions of Yuma County. A total of 96 plants were collected (5 from Tacna on 2/21, 5 from Wellton on 2/21, 15 from Wellton on 3/23, 30 from Tacna on 4/4, 20 from Wellton on 4/4, and 21 from Yuma Valley on 4/4). The area of the fields ranged from 10 to 18 acres, and the percent disease incidence ranged from 0.8% (Tacna on 4/4) to 2.75% (Tacna on 2/21). Thrips vector were present in all fields were symptomatic plants were observed. One leaf disk per plant (8 mm in diameter) was sampled with a cork borer and grounded individually with a micro pestle in a 1.7 ml microcentrifuge tube with 150 ul of Tri-reagent (Molecular Research Center). Total RNA was extracted from each sample using the Zymo Direct-zol-96 kit (Zymo Research). Samples were diluted with water to a ratio of 1:10 after RNA extraction. RT-qPCR was performed in 20 ul reactions with 5 ul of input RNA using the PCR Biosystems qPCRBIO Probe 1-Step Go No-ROX for the cDNA/qPCR master mix. RT-qPCR assays were carried out in multiplex reactions using primers specific for TSWV and INSV, in addition to a lettuce internal control gene (LOC111918243), along with negative controls. Primer and probe sequence details are reported in supplemental Table 1. We used a cycle threshold (ct) < 40 to indicate a positive result for both INSV and TSWV (Chen et al. 2013; Boonham et al. 2002). RT-qPCR successfully amplified INSV in 90 out of 96 samples and TSWV in 8 out of 96 samples. These 8 samples tested positive for both TSWV and INSV, showing that INSV and TSWV co-infected lettuce plants. Thus overall, ∼ 95% of symptomatic plants were infected with INSV alone, and ∼ 8% were co-infected with TSWV and INSV. Amplicons of 4 samples testing positive for TSWV were sent for Sanger sequencing (Eurofins Genomics, Louisville, KY). All were identified as TSWV. One amplicon with TSWV was sequenced for INSV and double infection was confirmed. BLAST results from the NCBI nt database show 100% (138 bp) identity to TWSV (MW519211) for the 4 TWSV amplicons and 99.22% (137 bp) identity to INSV (KX790323) for the INSV amplicon. Sanger sequence data are in the GenBank (accession: OQ685940-OQ685944). Based on RT-qPCR results, all TSWV infected plants were also infected with INSV. INSV may have been introduced to Yuma by infected plants or thrips from lettuce transplants produced in California (Hasegawa et al. 2022). TSWV could have been introduced similarly. To our knowledge, this is the first report of TSWV infecting lettuce in Yuma and the first report of INSV and TSWV co-infecting lettuce. TSWV and INSV infections have remained low since their discovery in Yuma, in part due to effective cultural and chemical management by lettuce growers (Palumbo, 2022). However, an increase in disease incidence and severity in the future could have a significant negative impact on production of romaine lettuce in the region.

First Report of Resistance-Breaking Variants of Tomato Spotted Wilt Virus (TSWV) Infecting Tomatoes with the Sw-5 Tospovirus-Resistance Gene in North Carolina.

Widespread use of tomato cultivars with the Sw-5 resistance gene has led to the emergence of resistance-breaking (RB) strains of tomato spotted wilt virus across the globe. In June of 2022, tomato spotted wilt (TSW) symptoms were observed at two farms (A and B, within 15 miles of each other) in Rowan County, NC on several commercial TSW resistant tomato cultivars (all heterozygous for the Sw-5 gene). At farm A, ~10% of plants had symptomatic foliage with ~30% of fruit with symptoms, while at farm B, up to 50% of plants had symptomatic foliage with ~80% of fruit with symptoms. Visual symptoms included stunting, severe leaf curling and bronzing, necrotic lesions on leaves, petioles and stems, and concentric ring spots on fruit (Supplementary Fig. 1). TSWV ImmunoStrips (AgDia, Elkhart, IN) and reverse-transcription (RT)-PCR with NSm primers (di Rienzo et al 2018) confirmed the presence of TSWV in 12 symptomatic plants sampled across the two farms. Primers designed to detect Impatiens necrotic spot virus, groundnut ringspot virus, tomato chlorotic spot virus, tomato chlorosis virus, alfalfa mosaic virus, and tomato necrotic streak virus (ilarvirus, Badillo et al., 2016) failed to generate amplicons of the expected size from cDNA generated from these field samples. The amplicons from full-length NSm cDNA were sequenced from independent, single-leaflet isolates from the TSWV-positive plants (three from farm A, nine from farm B) with the expectation of finding an amino acid (aa) substitution associated with the Sw-5 RB phenotype identified previously in CA (C118Y, Batuman et al. 2017) or Spain (C118Y and T120N, Lopez et al. 2011). All three nucleotide sequences from farm A contained the NSm C118Y substitution reported in CA. All three sequences were 99% identical (including the C118Y mutation) to NCBI GenBank accession KU179600.1, a TSWV isolate collected from GA in 2014 with no cultivar information reported. The nine nucleotide sequences from farm B contained neither of the two previously reported aa substitutions associated with the RB phenotype. Instead, all contained a D122G substitution within a conserved region of the TSWV NSm protein reported to be involved in direct interaction with the Sw-5 protein (Zhu et al 2017). Likewise, Huang et al (2021) generated a D122A mutation in TSWV-NSm, resulting in failure to elicit a Sw-5 mediated hypersensitive response. Three NSm sequences retrieved from GenBank contained the D122G substitution (AY848921.1, HM015516.1, KU179582.1), however, this mutation was not implicated directly with RB phenotypes (Ciuffo et al., 2005; Lopez et al., 2011; Marshall, 2016). The RB phenotype was confirmed with the NC variants on 'Mountain Merit' (Sw-5) by two means of virus inoculation: mechanical, rub-inoculation with extracted sap from infected plants, and thrips transmission assays with lab colony-maintained, Frankliniella occidentalis, the western flower thrips. Symptomatic leaf tissue obtained from these inoculation assays tested positive for TSWV by DAS-ELISA (AgDia, Elkhart, IN) and RT-PCR with NSm primers, providing definitive evidence of the occurrence of RB-TSWV at both farms, and subsequent sequencing confirmed the C118Y and D122G substitutions. This report warrants further investigation of the putative origins, prevalence and epidemiological implications of RB-TSWV variants in NC tomato production, and the development of new sources of resistance to TSWV.

First report of tomato spotted wilt virus infecting water dropwort in China.

Water dropwort (Oenanthe javanica) is an aquatic perennial plant that has been cultivated in many regions in Asia for thousands of years. In China, it is an economically important vegetable that has been consumed as food, while also being used as a folk remedy to alleviate diseases (Liu et al., 2021). In 2021, during a disease survey of a greenhouse in Beijing, China, chlorotic spots were detected on many water dropwort plants (Fig. S1A). Twenty-seven water dropwort samples were collected for the extraction of total RNA using the TRIzol reagent (Invitrogen, USA). High-quality RNA samples from three water dropwort plants were combined and used as the template for constructing a single small RNA library (BGI-Shenzhen Company, China). The Velvet 1.0.5 software was used to assemble the clean reads (18 to 28 nt) into larger contigs, which were then compared with the nucleotide sequences in the National Center database using the BLASTn algorithm. Thirty-eight contigs matched sequences in the tomato spotted wilt virus (TSWV) genome. No other viruses were detected. Twenty-seven leaf samples were analyzed in an enzyme-linked immunosorbent assay (ELISA) with anti-TSWV antibody (Agdia, USA), which revealed 17 positive reaction. Two sets of primer pairs targeting different parts of the S RNA (Table S1) was used to verify the TSWV infection on water dropwort by reverse transcription (RT)-PCR followed by Sanger sequencing (BGI-Shenzhen, China). The TSWV target sequences were amplified from 17 samples, which was consistent with the ELISA results. The sequenced 861-bp PCR product shared 99.8% nucleotide sequence identity with TSWV isolate MR-01 (MG593199), while the 441-bp amplicon shared a 99.2% nucleotide sequence identity with MR-01 (MG593199). To obtain the whole genome sequence of TSWV (S, M, and L RNA sequences), specific RT-PCR primers were designed (Table S1) and used to amplify their respective fragments from one representative sample (TSWV-water dropwort). The amplified products were inserted into PCE2TA/Blunt-Zero vector (Vazyme Biotech Co., Ltd, China) and then sequenced (BGI-Shenzhen, China). The S, M, and L RNA sequences were determined to be 2,952 nt (accession no. OM154969), 4,776 nt (accession no. OM154970), and 8,914 nt (accession no. OM154971), respectively. BLASTn analysis demonstrated that the whole genome sequence was highly conserved. The nucleotide identities between this isolate and other TSWV isolates ranged from 98.6% to 99.6% (S RNA), 98.9% to 99.2% (M RNA), and 97.3% to 98.7% (L RNA). Using MEGA 7.0, the phylogenetic relationships of TSWV were determined on the basis of the S, M, and L RNA full-length sequences (Kumar et al., 2016). In the S RNA derived phylogenetic tree, the water dropwort isolate was closely related to the MR-01 isolate from the USA (MG593199). In the M RNA and L RNA derived phylogenetic trees, the water dropwort isolate formed a branch with only a TSWV isolate from eggplant. Additionally, the M and L RNA sequences were most similar to sequences in TSWV isolates from China and Korea, respectively (Fig. S1B). To the best of our knowledge, this is the first report of water dropwort as a natural host for TSWV in China and the second report worldwide since the first finding in the Korea (Kil et al. 2020). TSWV has caused serious problems on many crops in the world, and the infection of TSWV on water dropwort in a greenhouse should not be looked lightly. Firstly, the virus can be passed on from generation to generation in infected water dropwort due to the vegetative propagation mode of the plant in production, thus threaten the production of this vegetable crop. In addition, infected water dropwort may serve as a reservoir for the virus, thus potentially posing a threat for causing TSWV spread in the affected greenhouses. The author(s) declare no conflict of interest. Funding: This research was supported by the Beijing Academy of Agriculture and Forestry Foundation, China (QNJJ202131, KJCX20200212, and KJCX20200113).

First Report of Tomato Spotted Wilt Virus in Oxypetalum coeruleum in Korea

&lt;i&gt;Oxypetalum coeruleum&lt;/i&gt;, commonly known as Tweedia, is a perennial herbaceous plant of the &lt;i&gt;Apocynaceae&lt;/i&gt; family native to southern Brazil and Uruguay. Tweedia plants are grown as one of the most popular ornamental flowers for floral arrangement in Korea. In May 2021, several tweedia plants in a single greenhouse in Gimje, Jeollabuk-do were found to show virus-like symptoms including necrotic rings, vein-clearing, chlorotic mottle, and mosaic on the leaves, and necrosis on the stems. Here, we have identified tomato spotted wilt virus (TSWV) in symptomatic tweedia leaves by applying high-throughput RNA sequencing. In the result, a single infection by TSWV was verified without mixed infections of different virus species. To confirm the presence of TSWV, a reverse transcription polymerase chain reaction was performed with a specific primer set to the N gene of TSWV. The complete genomic sequence of L, M, and S segments of TSWV ’Oxy’ isolate were determined and deposited in GenBank under accession numbers LC671525, LC671638, and LC671639, respectively. In the phylogenetic tree analysis by maximum likelihood method, ’Oxy’ isolate showed a high relationship with TSWV ’Gumi’ isolate from &lt;i&gt;Gerbera jamesonii&lt;/i&gt; in Gyeongsangbuk-do, Korea; for all three RNA segments. To our knowledge, this is the first report of TSWV infection of &lt;i&gt;O. coeruleum&lt;/i&gt; in Korea.

First report of a resistance-breaking strain of tomato spotted wilt orthotospovirus infecting Capsicum annuum with the Tsw resistance gene in Texas.

Since the first report of the 'spotted wilt' disease of tomato published in 1915 in Australia, tomato spotted wilt orthotospovirus (TSWV) has become a pandemic virus with an estimated economic impact of over $1 billion annually (Brittlebank 1919; German et al. 1992). TSWV strains capable of disrupting Tsw-mediated single gene resistance in pepper (i.e., resistance-breaking or RB strains) have been previously reported in multiple countries (Crescenzi et al., 2013; Deligoz et al. 2014; Margaria et al. 2004; Sharman and Persley 2006; Yoon et al. 2021), but only in California (Macedo et al. 2019) and Louisiana (Black et al. 1996) in the US. In August 2021, severe tospovirus-like disease symptoms (stunting; leaf, stem, and petiole necrosis; and concentric rings on leaves and fruits) were documented in TSWV-resistant cultivars of sweet pepper (Capsicum annuum L.) containing the Tsw gene in Bushland, TX. In the next season in August 2022, leaf samples from 214 TSWV-resistant pepper plants (with or without disease symptoms) from seven cultivars were tested with a TaqMan probe-based qPCR assay targeting coat protein (CP) of the TSWV (TSWV-F: AGAGCATAATGAAGGTTATTAAGCAAAGTGA and TSWV-R: GCCTGACCCTGATCAAGCTATC; TaqMan probe: CAGTGGCTCCAATCCT). Across all cultivars, 85 samples tested positive for TSWV. Of these, 39 showed characteristic TSW symptoms with disease incidence ranging from 10-30% depending on the cultivar. The remaining 46 samples were asymptomatic with no apparent hypersensitive response in leaves. To further confirm the RB status of TSWV strain/s in the field samples, leaves from six TSWV resistant plants from three different pepper cultivars were pooled together and used to mechanically inoculate five non-infected three-week-old pepper plants from nine cultivars: seven TSWV resistant (Tsw), one moderately resistant, and one susceptible, with three replications. Tsw expression in two representative plants from each resistant cultivar was confirmed using SYBR Green based one-step qRT-PCR with primers specified in the South Korea Patent # KR102000469B1 were used with two plants from susceptible cultivar as a negative control. Field plants that tested negative for TSWV in PCR analysis were used as a mock inoculation control and tissues from tomato plants infected with wild-type TSWV strain/s (previously isolated from non-resistant tomato plants) were used as a wild-type control. Three weeks post-inoculation, characteristic orthotospovirus symptoms were observed in plants inoculated with the putative RB isolate, in that TSW incidence ranged between 10-50% in seven resistant cultivars, 70% in a moderately resistant cultivar, and 90% in a susceptible cultivar. On the contrary, no disease incidence was observed in resistant and moderately resistant plants, whereas 50% incidence was observed in susceptible plants in the wild-type control. Hypersensitive response was observed in the local leaves of mechanically inoculated resistant plants that tested negative in PCR approximately 5-7 days post inoculation. All symptomatic and 30-100% asymptomatic TSWV-inoculated plants with RB or wild-type strain/s tested positive for TSWV in probe-based qPCR analysis confirming that none of the tested cultivars was immune to TSWV infection. All mock-inoculated plants tested negative in the qPCR analysis. Both nucleotide and amino acid sequences of complete TSWV silencing suppressor protein (NSs) recovered from six plants originally used in the mechanical inoculation (NCBI accession OP548104) and inoculated resistant plants (NCBI accession OP548113) showed 99% homology with the NSs sequences of New Mexico pepper isolates KU179589 and APG79491, respectively. The NSs point mutation T to A at 104 amino acid position responsible for resistance breaking in pepper in Hungarian TSWV isolates (NCBI accessions KJ649609 & KJ649608 (Almasi et al., 2017) was absent in the NSs sequences from all samples. Besides novel point mutations, genetic reassortment as previously reported in S. Korean TSWV RB pepper isolates (Kwon et al., 2021) and in other orthotospoviruses such as tomato chlorotic spot virus and groundnut ringspot virus (Webster et al., 2011) could be a potential RB mechanism in the Bushland TSWV RB isolates. A comprehensive genomic analysis of these isolates is required to determine the fundamental evolutionary mechanisms that enable the disruption of Tsw-mediated gene resistance. Taken together, these results indicate that at least one, but potentially multiple new strains of TSWV capable of disrupting Tsw-mediated resistance and producing moderate to severe symptoms in an array of commercial resistant pepper cultivars have emerged and pose a significant threat to pepper production in Texas.

Antagonism of tomato spotted wilt virus against tomato yellow leaf curl virus in Nicotiana benthamiana detected by transcriptome analysis.

Tomato spot wilt virus (TSWV) and tomato yellow leaf curl virus (TYLCV) are highly harmful viruses in agricultural production, which can cause serious economic losses to crops and even devastating consequences for vegetable yield in some countries and regions. Although the two viruses belong to different families and have different transmission vectors, they share most hosts. This study aimed to examine the transcriptomic expression of single and mixed inoculations of TSWV and TYLCV, leading to antagonism using high-throughput RNA sequencing. We confirmed the single and mixed infections of these viruses in Nicotiana benthamiana (N. benthamiana) by artificial inoculation. And the expression changes of related genes and their biological functions and pathways during the mixed infection of TSWV and TYLCV were analyzed by comparative transcriptome. Basically, similar symptoms were observed in the plants singly infected with TSWV and co-infected with TYLCV; the symptoms of TYLCV in the co-infected plants were not obvious compared with single TYLCV infections. When inoculated with TYLCV, the accumulation of the virus significantly reduced in single and mixed infections with TSWV; the TSWV accumulated slightly less in co-infection with TYLCV, whereas this reduction was much smaller than that of TYLCV. The results suggested that TSWV had an antagonistic effect on the accumulation of TYLCV in N. benthamiana. It mainly focused on the changes in unique differentially expressed genes (DEGs) caused by the co-infection of TSWV and TYLCV. The eight pathways enriched by upregulated DEGs mainly included amino acid biosynthesis, citrate cycle (or tricarboxylic acid cycle, TCA cycle), and so on. However, only pentose phosphate pathway (PPP) and peptidoglycan biosynthesis could be downregulated in the Kyoto Encyclopedia of Genes and Genomes pathway in which peptidoglycan biosynthesis was involved in upregulated and downregulated pathways. The antagonistic effect of TSWV on TYLCV in N.benthamiana and the change trends and specific pathways of DEGs in this process were found. Our study provided new insights into the host regulation and competition between viruses in response to TSWV and TYLCV mixed infection.

Seed Transmission of Tomato Spotted Wilt Orthotospovirus in Peppers.

Tomato spotted wilt orthotospovirus (TSWV) severely damaged agricultural production in many places around the world. It is generally believed that TSWV transmits among plants via their insect vector. In this study, we provide evidence on the seed-borne transmission of TSWV in pepper (Capsicum annuum L.) plants. RT-PCR, RT-qPCR, and transmission electron microscopy data demonstrate the seed transmission ability of TSWV in peppers. Endosperm, but not the embryo, is the abundant virus-containing seed organ. TSWV can also be detected in the second generation of newly germinated seedlings from virus-containing seed germination experiments. Our data are useful for researchers, certification agencies, the seed industry, and policy makers when considering the importance of TSWV in vegetable production all over the world.