Splicing Factor Mutations Research Articles

The spectrum of pre-mRNA splicing in autism.

Disruptions in spatiotemporal gene expression can result in atypical brain function. Specifically, autism spectrum disorder (ASD) is characterized by abnormalities in pre-mRNA splicing. Abnormal splicing patterns have been identified in the brains of individuals with ASD, and mutations in splicing factors have been found to contribute to neurodevelopmental delays associated with ASD. Here we review studies that shed light on the importance of splicing observed in ASD and that explored the intricate relationship between splicing factors and ASD, revealing how disruptions in pre-mRNA splicing may underlie ASD pathogenesis. We provide an overview of the research regarding all splicing factors associated with ASD and place a special emphasis on five specific splicing factors-HNRNPH2, NOVA2, WBP4, SRRM2, and RBFOX1-known to impact the splicing of ASD-related genes. In the discussion of the molecular mechanisms influenced by these splicing factors, we lay the groundwork for a deeper understanding of ASD's complex etiology. Finally, we discuss the potential benefit of unraveling the connection between splicing and ASD for the development of more precise diagnostic tools and targeted therapeutic interventions. This article is categorized under: RNA in Disease and Development > RNA in Disease RNA Evolution and Genomics > RNA and Ribonucleoprotein Evolution RNA Evolution and Genomics > Computational Analyses of RNA RNA-Based Catalysis > RNA Catalysis in Splicing and Translation.

AEP promotes aberrant RNA splicing through DDX3X cleavage in solid tumors.

Aberrant alternative splicing (AS) events have been identified in a variety of cancers. Although somatic mutations of splicing factors and dysregulation of RNA-binding proteins (RBPs) have been linked to AS and tumor malignancy, it remains unclear how upstream mechanisms contribute to cancer development via alternative gene splicing. In this issue of the JCI, Wenrui Zhang and colleagues identified the role of asparagine endopeptidase (AEP), an intracellular cysteine endopeptidase, in promoting solid tumor-associated RNA splicing. The authors demonstrated that tumor environmental factors such as oxygen and nutrient deprivation induce the activity of AEP in a HIF1A-dependent manner. The activated AEP, in turn, cleaves an RNA helicase DDX3X to promote its nuclear retention. The authors further showed that this DDX3X nuclear fraction engages with splicing machinery to induce AS events in several cancer cells. These findings suggest that targeting an AEP-dependent aberrant RNA splicing cascade may facilitate therapeutics for solid tumors.

Abstract C075: Altered RNA splicing causes pancreatic cancer and exposes a therapeutic vulnerability

Abstract Recently we reported that pancreatic ductal adenocarcinomas (PDACs) are exquisitely susceptible to a range of anti-RNA splicing therapies. Thus, altered RNA splicing is a non-mutational dependency of PDACs and represents a novel therapeutic target. However, how these alterations drive tumorigenesis and determine therapeutic responses remains unknown. Using unbiased and quantitative methods to evaluate the effects of all somatic mutations on cancer, we found that mutations in RNA splicing factors SF3B1 and RBM10 (~15% of cases) were among the most significant and mutually exclusive to mutations in p53, suggesting that mutations in these splicing factors act as “second-hit” driver mutations in PDAC. To test this hypothesis, we engineered mice to co-express KrasG12D with either Sf3b1 K700E mutation or Rbm10 loss in acinar cells. Importantly, mice harboring KrasG12D and Sf3b1K700E or Rbm10 loss developed autochthonous PDACs in mice. Mechanistically, we found that both mutant splicing factors, in PDACs from mice and patients, induce alterations in exon processing in common mRNAs. Of these target mRNAs, ~67% were found to be degraded by nonsense-mediated mRNA decay (NMD)- a surveillance process that eliminates mRNAs that harbor sudden stops from splicing alterations. Interestingly, NMD-inducing splicing changes by both SF3B1K700E and RBM10 loss mapped to chromosomes 7 and 11 (chromosomes 17 and 19 in patients, respectively), which are home to several tumor-suppressor genes, including p53. This suggests that mutant splicing factors decrease the expression of specific tumor suppressors by promoting altered RNA splicing and downstream RNA degradation for PDAC pathogenesis. Supporting these findings, it was previously reported that loss of p53 in PDAC, the most common “second-hit” mutation in PDAC, leads to deletions in chromosomes 7 and 11 for PDAC pathogenesis (Nature 2022). Given that 70% of PDACs carry mutations in p53, interestingly however, PDACs with mutant splicing factors have wild-type (WT) p53. We determined that SF3B1K700E and RBM10 loss promote increased degradation of p53 compared to WT counterparts but stabilize p53 protein upon DNA damage and RNA splicing perturbations. Forced expression of gain-of-function mutant p53 in PDACs with either SF3B1K700E or RBM10 loss led to synthetic lethality, explaining the mutual exclusivity found in patient samples (described above). Lastly, splicing factor mutant PDACs are more sensitive to Gemcitabine than 5FU, and combination of Gemcitabine with splicing factor modulator, H3B-8800 (in phase 2 clinical trials) synergized to selectively kill mutant splicing cells. Animal testing of this combination therapy is ongoing using patient-derived organoids implanted in the pancreata of immunocompromised mice. These studies uncover novel driver mutations of PDAC that can bypass the effect of WT p53 and highlights a common mechanism of PDAC pathogenesis that depends on decreased expression of tumor suppressors, irrespective of second-hit mutations, exposing a therapeutic vulnerability to splicing modulators. Citation Format: Natasha Pinto Medici, Diana Martinez Saucedo, Danny Lee, Li-Ting Ku, Robert Tseng, Xinning Shan, Tianyi Chu, Pablo Perez-Piñera, Vincent Cannataro, Jeffrey Townsend, Christine Iacobuzio-Donahue, Marie Robert, Omar Abdel-Wahab, Steven D. Leach, Luisa Escobar-Hoyos. Altered RNA splicing causes pancreatic cancer and exposes a therapeutic vulnerability [abstract]. In: Proceedings of the AACR Special Conference in Cancer Research: Pancreatic Cancer; 2023 Sep 27-30; Boston, Massachusetts. Philadelphia (PA): AACR; Cancer Res 2024;84(2 Suppl):Abstract nr C075.

Multi-gene measurable residual disease assessed by digital polymerase chain reaction has clinical and biological utility in acute myeloid leukemia patients receiving venetoclax/azacitidine.

Venetoclax with azacitidine (ven/aza) is a lower-intensity therapeutic regimen that has been shown to improve outcomes in elderly patients with acute myeloid leukemia (AML). Measurable residual disease (MRD) using flow cytometry is a valuable tool for the prediction of relapse in AML using conventional therapies and ven/aza; however, the prognostic value for broadscale molecular MRD after ven/aza treatment is less clear. We aimed to determine the utility of retrospective assessment using multi-gene molecular MRD by droplet digital polymerase chain reaction (ddPCR). We found this approach correlates with outcomes in a cohort of patients receiving frontline ven/aza for AML. The predictive value of ddPCR MRD persisted when NPM1 mutations were removed from analysis, as well as after adjustment for the impact of stem cell transplant on outcomes. Late achievement of MRD negativity, including after SCT, was still associated with superior outcomes compared to persistently detectable MRD. We further explored the impact of ven/aza on the burden of different classes of mutations, and identified the persistence of splicing factor mutations, commonly associated with MDS, as a consistent finding after ven/aza treatment. These data add to our understanding of the effects of ven/aza on AML disease biology and provide details on molecular depth of remission that can guide prospective trials in the future.

Differential Isoforms Signature of Splicing Factor Mutant Myeloid Neoplasia

Exclusivity of splicing factor (SF) mutations is a near-dogma in myeloid neoplasia (MN). Such exclusivity is often reflected in morphopathologic features as in the case of SF3B1 mutations associated with ringed sideroblasts. Consequences of SF mutations are hard to reconcile given the central role of RNA splicing in normal physiology and the multitude of alternative splicing changes occurring upon mutations. Historically, distinct gene isoforms play key roles in hematopoiesis and might be tumor associated. We performed global transcript level expression analysis to identify SF specific differentially expressed isoforms associated with isoform disequilibrium. Such analysis prompted to the distinction between common and exclusive isoforms possibly discerning novel mechanistic insights in the pathogenesis of SF mutant MN. Of particular importance is the discovery of novel isoforms not expressed in normal condition. Total RNA isolated from 100 whole bone marrows of MN patients with six SF mutations ( DDX41, PRPF8, SF3B1, SRSF2, U2AF1, ZRSR2) and healthy subjects was subjected to RNASeq library prep (Kapa RNAHyperPrep Kit with rRNA depletion). Transcript abundance was generated using spliced alignment to the genome by STAR followed by Salmon-basedquantification. We then applied bootstrapping to capture variation in abundance estimates since transcript-level quantification is amenable to variation, in contrast with gene level, due to the difficulty of unique mapping of short read sequences. Differential isoform testing was done using edgeR accounting for overdispersion due to isoform uncertainty. Mutant samples were selected with VAF >15% for better estimation of isoforms vs clonality. Differential SF isoform usage was defined in comparison to healthy controls. In total, 1681 unique transcripts in 1418 unique genes (positively/negatively dysregulated) at a threshold of .05 P-value and absolute logfold change of 2.0 were selected. Among patients with SF mutations, patients carrying sole U2AF1 had the highest number of distinct isoforms (n=189), which accounted for about 20% of isoforms in the entire cohort of U2AF1 mutant patients. DDX41 mutations had the second highest (n=161), while ZRSR2 had the lowest number of distinct isoforms(n=48). We categorized the features in groups I1-I6 according to the number of SF sharing isoforms. I1 indicates the group of patients carrying isoforms which where distinct per each SF ( Fig1). U2AF1I1 included genes previously reported to be associated with U2AF1 ( e.g., GNAS) and genes restricted to neutrophil degranulation. DDX41I1 was enriched in innate immune response gene isoforms including HLA-DQA1 and SAMHD1 and known genes predisposing to myeloid and blood disorders ( e.g. CSF1R, RPL15). SRSF2 isoform signature was mainly characterized by upregulation of INF-gamma and beta, IFN-induced OAS1 and TLR response pathways ( e.g., IRAK2). Specific isoforms were shared between SFs. SF3B1 shared 35 isoforms with PRPF8 and 8 with SRSF2, including Stathmin1, a gene expressed in high proliferative MN phenotypes. Different isoforms in the same gene were also associated with different groups. For instance, DDX5 isoform-219 producing a 65-residues transcript was shared between PRPF8 and SF3B1 (I2) while isoform-234 producing 614-residues transcript was shared between PRPF8, DDX41, and ZRSR2 mutants (I3). Beside the unique isoform signature per each SF, we imputed any differential isoform changes in myeloid genes often associated with SF mutations. Isoforms for the TET triad were analyzed and resulted in a 110 residues transcript (TET2-208) significantly downregulated (FDR < .05) in all SF, except SRSF2. We then focused on the discovery of exclusive isoforms. In total, 115 unique transcripts (lncRNAs, 20; protein coding, 95) were expressed in all SF mutant patients but not expressed in healthy controls. GDF15 isoform-201 encoding a 308-residues transcript was detected in SF3B1, DDX41, and ZRSR2 mutants. LncRNAs have gained attention in regulating gene expression in MN. We found 9 novel lncRNA transcripts in DDX41, SF3B1, PRPF8, U2AF1 and ZRSR2 mutants, with one being common in all of them (ENSG00000273445 chromosome 2p11.2). In sum, our study focusing solely on transcript level analysis describes the first isoform landscape of SF mutant MN and launches the idea that isoform analysis might shed light on the diversity and uniqueness of SF mutations.

Survival Outcomes Associated with Molecular and Cytogenetic Alterations in AML Patients Treated with Hypomethylating Agent and Venetoclax

Molecular profiling has improved prognostication and helped identify novel therapeutic targets in AML. Nonetheless, it has also created a complex web of molecular profiles and cytogenetic abnormalities and in many cases it remains unclear which specific alterations primarily drive leukemogenesis. We sought to review our patients (pts) treated with a hypomethylating agent (HMA) + Venetoclax (Ven), to evaluate molecular and cytogenetic profiles with their associated outcomes. We identified 142 pts with AML treated with HMA + Ven at Northwell Health between January 2019 and December 2023. Through retrospective chart review, we obtained patient and disease characteristics, treatment regimens, clinical outcomes as well as molecular and cytogenetic profiling (using commercial AML panels) prior to the initiation of HMA + Ven. Bone marrow biopsy pathology reports were reviewed to identify the subtype of AML and grouped into De novo AML, AML with MDS related changes (AML-MRC) and therapy-related AML (t-AML). Median relapse free survival (mRFS) and median overall survival (mOS) in months (m) as defined by ELN 2022 (Dohner et al, Blood 2022), were estimated with Kaplan-Meier curves and compared utilizing log-rank testing. T-test was used to evaluate significant differences between categorical data. Of the 142 pts identified, the median age was 77. The majority of patients had adverse (n = 99) or intermediate risk (n = 31) genetics as defined by the 2022 ELN genetic risk classification. The overall response rate (ORR) was 42% with mOS of 9.6m. AML-MRC patients (n=80) had mOS of 9.1m and mRFS of 11.6m with 61 pts receiving HMA + Ven as frontline treatment. 47 pts with De novo AML had mOS of 13.4m and mRFS of 16.1m with 36 pts receiving HMA + Ven as frontline therapy. Only 15 pts had t-AML with mRFS of 12.3m and mOS of 8.8m with 10 pts receiving HMA + Ven as frontline therapy. There was no significant difference in mRFS or mOS between these groups, although there was a trend favoring De novo AML. 47 different molecular alterations were identified among the 142 patients. Figure 1 illustrates outcomes associated with the 16 most prevalent molecular alterations found in our AML population. Mutational burden was similar between AML types (2.7 vs 3.0 vs 2.4 mutations per pt). De novo AML was associated with an increased mutation burden in signaling molecules (60%) and transcription factors (47%) compared to AML-MRC (29%, 31%). AML-MRC had a higher occurrence of mutations in epigenetic regulatory genes (79%) and splicing factors (31%) compared to De novo AML (55%, 19%). Mutations in splicing factors were associated with a significant increase in both mRFS and mOS(p = 0.01) compared to pts without mutations. Pts with DNMT3A, NPM1 or SRSF2 mutations had the highest ORR to HMA + Ven (63%, 64% and 63% respectively). RUNX1, TP53, complex cytogenetics and del 7q were associated with worse ORR (46%, 36%, 46% and 42% respectively) as well as decreased mOS. SRSF2, mutated in both AML-MRC and De novo AML, not only had an elevated ORR, but improved mRFS and mOS. Contrarily, mRFS and mOS were not significantly improved despite the high ORR in DMT3A mutated pts. DNMT3A was mutated most often in AML-MRC and was associated with a higher rate of other epigenetic regulatory gene co-mutations. The same is true for patients with KMT2A mutations (ORR 50%, mOS 2.8m, mRFS 6.1m) which suggests ineffectiveness of HMA+ Ven in maintaining remissions with this alteration with possible early selection for resistant clones. RUNX1 mutations were associated with an improved mRFS (16.1m) despite lower mOS (8.8m). NPM1 mutations had the highest mRFS of 34.4m. The survival advantage may be secondary to the absence of adverse cytogenetics in 88% of these pts. IDH2 mutations was associated with a significantly improved mOS compared to unmutated IDH2; however this may be confounded by the use of an IDH2 inhibitor at relapse. Our review of molecular alterations in AML pts identified several molecular alterations such as SRSF2, DNMT3A, RUNX1 which we found to be associated with favorable responses when treated with HMA + Ven. In addition, we demonstrated that NPM1 mutation remains favorable in patients treated with HMA + Ven. Our findings help contribute to the ever-growing, complex molecular and genomic profiling of AML patients.

RNA Splicing Factor Mutations Drive Aberrant Canonical and Cryptic Circular RNA Biogenesis in Leukemia

RNA splicing factors (SFs) are recurrently mutated in liquid cancers. Mutations on SFs such as SF3B1, SRSF2, U2AF1, ZRSR2, and the U1 snRNA promote leukemogenesis by driving aberrant pre-mRNA splicing in critical pathways such as DNA damage response (DDR) and cell cycle regulation (CCR). Circular RNAs (circRNAs) are covalently closed RNAs that form via backsplicing ( Fig A). As a novel RNA species, circRNAs are now known to play diverse functional roles in cancer biology. Because backsplicing is a type of alternative splicing, we hypothesized that SF mutations also influence circRNA biogenesis in leukemia. To date, such causal links have not been clearly established. We first performed circRNA-seq on a panel of lymphoid and myeloid cell lines modeling the most common SF mutations ( SF3B1 K700E, SRSF2 P95H, U2AF1 S34F/Q157R, ZRSR2 KO, and U1 snRNA 3A>C). We observed that SF mutations tend to globally upregulate circRNAs with each mutant SF driving its own mutually exclusive set of circRNAs that we have termed SF mutation-associated circRNAs (SF-circRNAs). Each set of SF-circRNAs differs from each other along several features such as average lengths and selection of backsplicing exons. Additionally, while SF-circRNAs were generally mutation-specific, the majority of SF-circRNAs arose from commonly shared genes enriched for the DDR and CCR pathways. These results support a model in which SF mutations drive divergent splicing events convergent on a few pathways as a common mechanism in leukemias. Because SF3B1 is the most recurrently mutated SF in cancers, we concentrated on studying SF3B1 mutation-associated circRNAs (SF3B1-circRNAs). During linear RNA splicing, hotspot mutations on SF3B1 typically promote selection of cryptic 3' splice site (SS). Cryptic 3'SS are weak, inauthentic 3'SS proximal to the canonical site that can be activated for splicing by mutant SF3B1. Reasoning that cryptic 3'SS selection also occurs during backsplicing, we developed a pipeline called CrypticCIRC to call for these events. Through CrypticCIRC, we discovered the existence of cryptic circRNAs that account for nearly 1 in 10 of all SF3B1-circRNAs. Approximately 25% of cryptic circRNAs emanated from de novo 3'SS previously unannotated in the genome. Furthermore, we found that cryptic circRNAs were especially enriched on genes involved in the DDR and CCR pathways, furthering the notion that these pathways are preferentially targeted by SF mutations. Finally, by comparing with linear RNA splicing data, we also observed that some cryptic 3'SS may undergo either aberrant linear splicing or aberrant backsplicing but not both, indicating mutual exclusivity in cryptic splice site selection between linear and backsplicing. Finally, to mechanistically dissect SF-circRNA biology, we focused our study on one candidate circRNA, circZEB1. The parental ZEB1 gene, a master transcription and DDR factor, undergoes both aberrant canonical and cryptic backsplicing at exon 2 with exon 4 to give rise to two circZEB1 isoforms ( Fig B). In our full SF mutant panel, we found that the canonical and cryptic isoforms were consistently upregulated only in SF3B1 mutant cell lines (Nalm-6, K-562, HEK293T, HG-3, and MEC-1); We further confirmed circZeb1 upregulation in mouse models (CD19-Cre Sf3b1 K700E) where the canonical isoform is evolutionarily conserved. These results confirm circZEB1 as a true bona fide SF3B1-circRNA. Focusing on the function of this circRNA, we found that CasRx-mediated knockdown of canonical circZEB1 resulted in increased ZEB1 protein, but not mRNA, expression while overexpression of circZEB1 decreased ZEB1 protein levels. These results show that circZEB1 translationally regulates its parental gene. Finally, consistent with ZEB1's role in genome stability, we also observed a global reduction in γH2AX levels concomitant with circZEB1 ablation, highlighting DDR as a common pathway for SF-circRNAs ( Fig B). Altogether, we demonstrate that SF mutations drive widespread aberrant circRNA biogenesis mainly on DDR and CCR genes. We provide evidence for the existence of cryptic circRNAs as a novel class of circRNAs. We show that circZEB1 promotes DNA damage via regulating ZEB1 translation. Our results collectively highlight circRNAs as an additional regulatory modality alongside linear RNAs through which SF mutations exert function, supporting a unifying mechanism for the pan-cancer impact of SF mutations in leukemia.

Exploring Aging Dependent Adaptations of Splicing Factor Mutations in Clonal Hematopoiesis

Introduction: It has been shown that leukemia-associated mutations can be detected in the blood of healthy individuals and their clonal expansion in hematopoietic stem and progenitor cell (HSPC) populations is referred to as Clonal Hematopoiesis (CH). In one study, a population analysis of a cohort of 17,182 patients performed by Bick et al. [PMID7944936] selected without prior screening for hematological malignancies, indicated that advancing age is directly associated with an increase in CH. When the mutant clone accounts for 4% of the nucleated blood cells, it is then referred to as Clonal Hematopoiesis of Indeterminant Potential (CHIP). CHIP has been classified by the World Health Organization as a premalignant state and risk criteria for neoplastic development. CHIP is highly associated with adverse outcomes including auto-immune or auto-inflammatory conditions, cardiovascular disease, cytopenia, cancers in general, and other hematological neoplasms. The associated hematopoietic neoplasms include myelodysplastic syndromes (MDS), myeloproliferative disorders (MPD), and acute myeloid leukemia (AML). Population studies reveal splicing factor mutations to be among the most common mutations in CHIP and are highly correlated with age and show a high hazard ratio for risk of developing secondary neoplasms including AML. RNA splicing factors U2AF1, SRSF2, and SF3B1 make up core components of the spliceosome and are critical to prevent aberrant splicing. Mutations in these factors have widespread effects implicating a multitude of cellular processes. There are several established mutant splicing factor mouse models that can be utilized; however, many employ non-specific or leaky Cre drivers. Methods: To avoid non-specific and leaky Cre activation during aging, we used a Cre/lox-mediated U2af1(Q157R) conditional knock-in mouse model that does not contain an internal Cre driver. This mouse has a floxed wild-type U2af1 cDNA insert that expresses wild-type U2AF1 under normal circumstances. However, upon the exogenous addition of recombinant Cre the U2af1 cDNA is excised and the U2af1(Q157R) splicing factor mutation in exon 6 is expressed instead. This mouse model also possesses lox-stop-lox-YFP, leading to expression of YFP along with mutant U2AF1(Q157R) when Cre is introduced. We then isolated bone marrow from 6 week (young) and 6 months (aged) floxed Q157R/YFP mice and treated lineage-depleted bone marrow with recombinant Cre protein for two hours, followed by transplantation into mildly conditioned 6 week (young) and 18 month (old) wild-type mice. The percentage of YFP in the peripheral blood is quantified every 3 weeks. Full analyses, including RNA-seq, of the bone marrow progenitor populations after 3 months is in progress. Results and Discussion: Using the previously mentioned bone marrow transplant model our work shows that when a U2AF1 mutation is introduced into young and old recipient mice, there is significant preferential outgrowth when the donor mice are aged (Figure 1). This is indicated by an increase in the ratio of YFP, which represents the U2AF1(Q157R) mutant, to CD45.1 events, which represent an internal engraftment control. This would suggest that the expansion of U2AF1(Q157R) splicing mutant cells seen in clinical data may be the result of intrinsic factors from the aging cell population. Comprehensive analysis of the effects of alternative splicing in this model is ongoing, however, these data provide support for further investigation of the intrinsic effects of splicing factor mutations in an aged context.

Mutations in the RNA Splicing Factors U2AF1 and SRSF2 are Context-Dependent in Myeloproliferative Neoplasms

RNA splicing factor gene mutations are recurrently found in BCR::ABL1 negative myeloproliferative neoplasms (MPN). To understand the interactions between spliceosome gene mutations and MPN phenotypic driver mutations ( JAK2, CALR and MPL), we investigated their patterns of co-occurrence or mutual exclusivity in a cohort of 990 MPN patients with comprehensive molecular profiling and clinical information from the Hematologic Malignancies Data Repository (HMDR). As expected, MPN driver mutations ( JAK2, CALR and MPL) were mutually exclusive (N=658, N=168, N=53 respectively, Log2 OR≤-3.5 and Padj. ≤0.005 using pairwise Fisher's exact tests with Benjamin Hochberg multiple testing correction). Additionally, cases with co-occurring mutations in two RNA splicing factors, SF3B1, U2AF1 and SRSF2 (N=44, N=49, N=44) respectively were uncommon (2/135 splicing factor mutated cases) . We further found that U2AF1 and SRSF2 mutations co-occurred with JAK2 (log2 OR=1.7, Padj.=0.009) and MPL (log2 OR=2.1, Padj.=0.006) respectively, but rarely with CALR mutations (N=2 CALR-U2AF1 log2 OR=-2.3 Padj.=0.025, N=2 CALR-SRSF2 log2 OR=-2.2 Padj.=0.048). In contrast, CALR-SF3B1 mutations occurred at the expected frequency (Padj.=0.11). To explore the molecular settings where these mutations co-occur, we investigated the variant allele frequencies (VAFs) of CALR, U2AF1, SRSF2 and concomitant mutations in the CALR-U2AF1 (N=2) and CALR-SRSF2 (N=2) patients. The VAFs for the mutations detected in the first patient with CALR-U2AF1 co-mutation were: CALR 0.26, U2AF1 0.45, and TET2 0.41. Since CALR and splicing factor mutations are typically heterozygous, this suggests the CALR mutation was sub-clonal to the U2AF1 mutation and that U2AF1 and TET2 mutations were likely present in the same cell. In the second CALR-U2AF1 co-mutant case, VAFs were: CALR 0.31, U2AF1 0.27, and TP53 0.16. It is possible that in this case, the CALR and U2AF1 mutations may have occurred in independent clones or may have occurred in the same cell in the absence of other pathogenic mutations. For the two CALR-SRSF2 patients, data from three samples revealed VAFs of 0.23-0.46 for CALR and 0.21-0.58 for SRSF2 mutations. Considering their typical heterozygous occurrence, we inferred those individual cells harbored both CALR and SRSF2 mutations. Notably, in samples with high VAFs (>0.37) for both CALR and SRSF2 in two separate patients, additional high VAF pathogenic mutations were observed: 0.35 for ASXL1 and 0.46 for RUNX1 respectively. As ASXL1 and RUNX1 mutations also typically occur in a heterozygous manner, we hypothesized that when CALR and SRSF2 mutations are present in the same cell, another pathogenic co-mutation may be required for survival of the clone. To test our hypothesis, we FACS-sorted single lineage negative CD34 positive bone marrow cells from the first CALR- SRSF2 co-mutant case into 96 wells plates containing methylcellulose and hematopoietic growth factors (CFU-GEMM). DNA was harvested from single-cell colonies and genotyped for the following mutations using polymerase chain reaction (PCR) followed by gel electrophoresis and Sanger sequencing: CALR c.1154_1155insTTGTC p.K385fs*, SRSF2 c.284G>T p.P95H, ASXL1 c.1926_1927insG p.G642fs*, EZH2 c.2188_2212delAAAAAACAGCTCTTCGCCAGTCTGG p.F729fs*. Bulk NGS VAFs were 0.46, 0.38, 0.35, and 0.17, respectively. Out of 73 colonies analyzed, 71 colonies had the CALR insertion 5 mutation detected (see figure). Among these 71 CALR-mutated colonies, SRSF2 was found to co-occur in 35 colonies. Interestingly, all 35 colonies were accompanied by an ASXL1 mutation, and 29 of them had an additional EZH2 mutation. These findings support our hypothesis that CALR and SRSF2 mutations may co-occur in the same cell in the presence of another pathogenic mutation. Our findings offer molecular insights into the context-dependent behavior of splicing factor mutations in MPN. While they can co-occur with JAK2 and MPL mutations, U2AF1 and SRSF2 mutations are largely mutually exclusive with CALR mutations. In addition, our findings generate two main biological hypotheses: (i) a synthetic lethal relationship may exist between CALR mutations and SRSF2 or U2AF1 mutations, and (ii) this synthetic lethality may be overcome by the presence of additional pathogenic mutation(s) in the cell. Validation studies are ongoing to address these hypotheses. AM and AEM contributed equally.

Regulation of Alternative Splicing in B-Cell ALL By DYRK1A

DYRK1A, located in the Down syndrome critical region of chromosome 21, is a serine and threonine kinase that controls multiple cellular processes including apoptosis, cell cycle, transcription and signal transduction. We previously demonstrated that DYRK1A is required for maturation of B cells and is a therapeutic target in B-cell ALL, including both DS and non-DS subtypes. Key substrates within the B-cell lineage include D-type cyclins, FOXO1, and STAT3. Given that several studies have reported that DYRK1A phosphorylates various splicing factors and participates in splicing of Tau in neuronal cells, we investigated the contribution of DYRK1A to splicing in malignant B cells. We first treated B-ALL cell lines with two DYRK1A inhibitors, EHT 1610 and GNF 2133 and performed RNA-sequencing to detect changes in alternative splicing (AS). GO analysis of AS events showed RNA binding proteins among top differentially spliced genes. Of note, mis-splicing of RBM39 was one of the top differentially AS events associated with DYRK1A inhibition; this event involves inclusion of a “poison” exon that contains a premature termination codon and leads to a transcript predicted to be degraded by nonsense-mediated mRNA decay (NMD). We confirmed NMD by knocking down an essential NMD factor, UPF1, which stabilized the NMD isoform. The NMD isoform was also detected in B-ALL patient samples treated with DYRK1A inhibitors and in NALM6 cells in which DYRK1A was inducibly degraded. RBM39 has been reported to be a therapeutic target in AML, where cells with splicing factor mutations are more sensitive to loss of RBM39 than cells lacking splicing factor mutations. To determine whether RBM39 is a therapeutic target in B-ALL, we silenced RMB39 with shRNAs in vitro and in vivo. Genetic knockdown of RBM39 impeded B-ALL cell growth both in vitro and in xenograft models. Furthermore, inducible silencing of RBM39 hampered B-ALL progression in vivo evidenced by a significant increase in survival of mice engrafted with human B-ALL cells. We also found that indisulam and its analogs, which lead to DCAF15-mediated degradation of RBM39, suppressed the growth of B-ALL cells in vitro and in vivo. Importantly, the anti-tumor effect of RBM39 disruption extended beyond DS-ALL to Ph-like B-ALL, which continues to be an area of unmet medical need. We next analyzed the contributions of splicing factors that are known DYRK1A substrates to AS of RBM39. Knockdown of SRSF1 and SRSF2 led to increased inclusion of the poison exon even in the absence of DYRK1A inhibition, indicating that they normally function to exclude the exon. By contrast, knockdown of SF3B1 led to a reduction of the NMD isoform in the presence of EHT1610. Surprisingly, phosphorylation of SF3B1 by DYRK1A was not essential for the change in RBM39 splicing, as cells engineered to harbor two SF3B1 T434A phospho-deficient mutant alleles, did not show aberrant splicing. These results indicate that SF3B1, SRSF1, and SRSF2 are not the key substrates that mediate the effect of DYRK1A on alternative splicing. Next, given that DYRK1A is known to phosphorylate the C-terminal domain (CTD) of RNA polymerase II (Pol II) on Ser2 and Ser5, we investigated the contribution of Pol II phosphorylation to RBM39 splicing. IP-MS revealed an interaction between RNA Pol II and SF3B1, consistent with previous reports of co-transcriptional splicing. We found that inhibition of DYRK1A disrupted the colocalization of SF3B1 and RNA Pol II as well as with RBM39 RNA. However, DYRK1A inhibition had a transient effect on Ser2 and Ser5 phosphorylation, suggesting that cells have alternative pathways for Ser2/5 phosphorylation. Combining DYRK1A inhibition with inhibition or loss of CDK9, which also phosphorylates the CTD of RNA Pol II, led to a persistent decrease in RNA Pol II phosphorylation, marked increased NMD isoform and a profound reduction in RBM39 protein. Finally, we found that combining the CDK9 inhibitor dinaciclib with EHT 1610 synergistically inhibited growth of B-ALL patient cells in vitro and in vivo shown by significantly improved survival. Ectopic expression of RBM39 partially rescued the growth inhibition upon dinaciclib and EHT 1610 treatment suggesting downregulation of RBM39 is the key event in drug targeting. Together, our results reveal that DYRK1A controls RNA splicing by regulating the SF3B1-RNA Pol II interaction and that RBM39 is a therapeutic target in B-ALL.

Different Mutations in SF3B1 Gene Have Specific Transcriptomic Characteristics in Myelodysplastic Neoplasms

Myelodysplastic neoplasms (MDS) are hematopoietic stem cell (HSC) disorders characterized by ineffective hematopoiesis, peripheral cytopenia, and increased tendency to leukemic transformation. Somatic mutations in spliceosome machinery occur in approx. 50% of MDS patients. Among these, up to 30% of MDS patients carry a mutation in SF3B1. According to the 2022 classification system, MDS-SF3B1 is now considered as separate MDS subtype. Mutated SF3B1 perturbs mitochondrial function, resulting in apoptosis and ineffective erythropoiesis. The most common mutation of SF3B1, K700E, accounts for 50% of the variants, with additional codons (such as 666 and 662) acting as hotspot sites. Different mutations seem to be associated with distinct clinicopathological features. However, the prognostic implication of different SF3B1 mutations in MDS remains controversial and needs further clarification. This study investigated differences in clinical and molecular features of MDS-SF3B1 with different types of SF3B1 mutations. To investigate a direct impact of different point mutations in SF3B1, the study was based on four isogenic NALM6 cell lines, the wildtype (wt) and three cell lines, each with different SF3B1 mutation (CRISPR/Cas9-edited K700E, K666N, and H662Q). To understand phenotypic manifestations of the mutations in the disease, we also analyzed clinical and transcriptional characteristics of 146 lower-risk MDS patients. Using RNA-seq in the cell lines and CD34+ BM patient cells (17 patients with no mutation, 11 patients with K700E SF3B1 mutation, 5 patients with K666N/E SF3B1 mutation), we investigated effects of different SF3B1 mutations on RNA splicing events and gene expression levels. Initially, outcome analysis confirmed the previously described observation that patients with a SF3B1 mutation have favorable outcomes compared to those with other splicing factor mutations. Further, the analysis showed that specific mutations in SF3B1 tend to lead to different prognoses; patients with K700E had longer survival compared to those with other SF3B1 mutations (mean progression-free survival was 64.8 vs. 29.1 months). Analysis of RNA splicing in NALM6 showed that K666N and H662Q mutations share similar characteristics whereas K700E mutation is more similar to wt-cells. Most significant changes were found in retained introns (RI); increased RI inclusion levels were detected in K666N/H662Q cells compared to K700E/wt cells. In patients, RI events were also strongly increased in K666N/E compared to K700E samples (Fig. 1). A significant overlap was identified between cell line and patient data; out of 173 genes with higher RI inclusion level in K666N-NALM6 cells, 77 genes had higher RI inclusion also in patients. Interestingly, 12 out of these 77 genes were related to mitochondrial functions (e.g., CREBZF, DDX1, MRPL23, MUTYH, and RAF1). RNA-seq data further showed significant alternations in gene expression levels in the four isogenic cell lines and also in patient samples with different mutations. Surprisingly, a more pronounced difference was detected in gene expression between patients with different SF3B1 mutations than between patients with no mutation and with any SF3B1 mutation (irrespective of its type), suggesting that specific SF3B1 mutations result in different phenotypes. Pathway analyses showed that deregulated genes in samples with K700E vs. other hotspot mutations were significantly enriched in electron transport, cell cycle, proliferation, quiescence, and HSC differentiation. Importantly, expression of multiple mitochondria-related genes was altered between K700E and K666N/H662Q NALM6 cells (334 genes, FDR < 0.01; Fig. 2), indicating different metabolic characteristics of the cells with non-K700E mutations. For example, several subunits of mitochondrial respiratory complexes I and IV were upregulated in K700E cells, pointing to differences in energetic metabolism. Altogether, our data support the hypothesis that only K700E mutation of SF3B1 may have a positive prognostic value and that other SF3B1 mutations may influence cells differently, specifically affecting their mitochondrial functions. Based on our results, we conclude that prognostic implication of different SF3B1 mutations in MDS will need additional refinements in future. Supported by AZV CR (NU20-03-00412), GA CR (20-19162S), and MH CZ-DRO (00023736).

Common Pathways for Acute Myeloid Leukemia Progression in Systemic Mastocytosis with Associated Hematologic Neoplasm

Background: Mastocytosis is a heterogenous disease of mast cell (MC) clonal proliferation with pathologic accumulation in organ systems such as but not limited to skin, bone marrow, gastrointestinal tract, liver and spleen. Mast cells are CD34+, CD117+ (stem cell factor, KIT) with greater than 90% of people with mastocytosis harboring KIT D816V activating mutations which allows for increased proliferation and accumulation of neoplastic mast cells leading to downstream mast cell activation and intolerable symptoms. Advanced systemic mastocytosis (advSM) is categorized into three major subtypes, aggressive SM, MC leukemia and SM with an associated hematologic neoplasm (SM-AHN). SM-AHN is the most common advSM subtype accounting for about 75% of advSM cases and typically includes myeloid neoplasms such as MDS, CMML, or MPN. In most pts with SM-AHN, clinical symptoms is driven by the MC component and the goal of treatment with KIT inhibitors is to decrease the MC burden, thus improving quality of life and overall survival (Nat Med refs), However, the median survival of SM-AHN remains poor at 2-3.5 years with many pts transforming to advanced myeloid neoplasms especially an acute myeloid leukemia (AML). The use of next generation sequencing has helped to prognosticate patients with AdvSM. Patients with advSM typically exhibit multiple somatic mutations other than KIT D816V We describe the molecular signature of patients with SM-AHN who transformed to AML. Commonly involved genes are TET2, SRSF2, ASXL1, RUNX1, and CBL with inferior OS and adverse clinical characteristic associated with SRSF2/ ASXL1/ RUNX1 (S/A/R). To better prognosticate, Jawhar and colleagues introduced the MARS score. This incorporated molecular findings in AdvSM to help estimate overall survival which identified 3 risk categories (low, intermediate, and high). The overall survival in low, intermediate and high were not reached, 4.3 years, and 1.9 respectively for patients with AdvSM. While mutational findings in the MARS score can help prognosticate overall survival in these patients, the molecular footprint of progression or transformation to acute myeloid leukemia has not been established. We describe the molecular signature of patients with SM-AHN who transformed to AML. Methods: We analyzed 10 pts with SM-AHN who transformed to AML from 2000-2022. Of those patients, 7 were found to have full next generation sequencing at the time of initial consultation and transformation. These data were collected and descriptive analysis was performed. Results: We identified 7 pts with SM-AHN who progressed to AML. At SM-AHN diagnosis all pts had at least 2 additional co-mutations with a maximum of 7 co-mutations along with KIT D817V. The most common co-mutations were splicing factor mutations ( SRSF2 and SF3B1), TET2, RASEZH2, CUX1 and CBL. Six of the seven received treatment for SM-AHN. These patients received treatment with multikinase inhibitors or hypomethylating agents. The acquired driver mutations were NPM1, FLT3-ITD, RUNX1, and RAS pathway. In patient 1, a new FLT3-ITD and RUNX1 was acquired with an increased VAF of a RAS pathway mutation ( PTPN1) which was originally present in the SM-AHN diagnosis. Patient 3 also developed a new RUNX1 mutation at AML transformation. Patients 4 and 5 had new NPM1 mutations and patients 6 and 7 had a new RAS pathway mutations . Patient 2 acquired new BCOR, RIT1 and CBL mutations. Upon transformation to AML, 5/7 patients had resolution or a decrease of greater than 10% of KIT D816V VAF. One of the seven had no change in KIT D816V VAF at the time of transformation, this was also the only patient to receive no prior therapy. Only 1/7 had a VAF increase of greater than 20% in KIT D817V at transformation. The MARS score was calculated at the time of diagnosis of SM-AHN which showed that only 4 of 7 had a high MARS score. Time from SM-AHN diagnosis to AML progression ranged from 4-31 months. Survival was calculated from time of SM-AHN diagnosis to death which ranged from 6-47 months. Conclusion: Acquisition of known AML driver mutations (RAS, RUNX1, NPM1, FLT3-ITD) are commonly found in SM-AHN patients at time of progression to AML. The MARS score calculated in our patients did not correlate with time to transition to AML.

Primary U2AF1 S34F Mutated Hematopoietic Cells Are Sensitive to Nonsense-Mediated RNA Decay Disruption In Vivo

Expression of mutant splicing factors alters RNA splicing in myeloid malignancies, including increased production of nonsense transcripts that rely on nonsense-mediated RNA decay (NMD) for clearance. Cell lines expressing spliceosome mutants are more sensitive to NMD inhibition than wild-type cells, and the differential sensitivity is partially dependent on R-loop formation. However, the impact of NMD disruption on the viability of primary hematopoietic cells with splicing factor mutations has not been tested in vivo. We engineered mouse MLL-AF9 acute myeloid leukemia (AML) cells to inducibly express a wild type ( U2AF1 WT) or mutant ( U2AF1 S34F) transgene of the U2AF1 splicing factor, and tested the effects of inhibiting the NMD pathway protein kinase, SMG1, in vivo. We injected U2AF1 WT and U2AF1 S34F mouse AML cells (B6, CD45.2) into congenic, irradiated secondary recipient mice (B6, CD45.1), induced transgene expression, and then treated the mice for 2 weeks with either a SMG1 inhibitor (SMG1i) at 60 mg/kg/day or vehicle. SMG1i treatment increased the overall survival (OS) of mice bearing U2AF1S34F AML cells (median OS of 53 days compared to 42 days for mice treated with vehicle; p =0.0003), but did not impact the OS of mice with U2AF1WT AML cells (median OS of 33 days for SMG1i-treated mice compared to median OS of 32 days for vehicle-treated mice, p=0.360). We extended these findings to a second cohort of mice, where we transplanted one primary U2AF1 S34F banked mouse AML sample into 48 secondary recipient mice. To allow direct comparison of isogenic cells with or without U2AF1 S34F expression, half the mice were treated with doxycycline to induce U2AF1 S34F expression, and half of the mice did not receive doxycycline. SMG1i treatment increased the OS of mice expressing the U2AF1S34F mutant allele (median OS of 66 days, compared to median OS of 54 days for mice treated with vehicle; p<0.0001), but had no impact on survival of mice bearing AML cells where U2AF1 S34F was not expressed (median OS of 50 days, compared to median OS of 52 days for mice treated with vehicle; p=0.95). To explore the underlying mechanism for the sensitivity of spliceosome mutant cells to NMD inhibition, we first examined the effects of SMG1i treatment on cell cycle progression and cell death in primary cells. We observed that primary U2AF1 S34F-expressing AML cells treated with SMG1i ex vivo (24 hours) had an increased fraction of cells in G2/M phase compared to U2AF1 WT-treated cells (mean 48% vs. 11% at 100nM, respectively, p<0.001). In addition, the fraction of Annexin V + cells was increased in U2AF1 S34F-expressing cells treated with SMG1i ex vivo compared to U2AF1 WT treated cells (mean fold-change at 500nM relative to DMSO 4.0 vs. 2.3, respectively, p=0.027). We then isolated primary mouse AML cells after 7 days of in vivo SMG1i treatment and analyzed R-loops (S9.6 antibody) and DNA damage (gH2AX) by immunofluorescence. SMG1i-treated U2AF1 S34F cells had a marked increase in R-loop levels compared to U2AF1 WT-treated cells (mean S9.6 nuclear intensity, 306.9 vs 182.6, respectively, p<0.0001). In addition, H2AX phosphorylation was increased in SMG1i-treated U2AF1 S34F compared to U2AF1 WT cells (mean gH2AX nuclear intensity, 136.7 vs 87.8, respectively p<0.0001).Thus, disrupting NMD in splicing factor mutant AML cells alters cell cycle progression and causes R-loop accumulation, DNA damage, and apoptotic cell death. The NMD pathway has been implicated in the regulation of the unfolded protein response (UPR) that controls protein homeostasis and impacts cell viability. We generated K562 cell lines expressing doxycycline-inducible U2AF1 S34F or U2AF1 WT constructs and confirmed increased sensitivity of U2AF1 S34F cells treated with SMG1i(IC50 128.1nM vs 578.5nM at 72 hours, respectively, p<0.0001). Next, we performed RNA-sequencing on U2AF1 WT and U2AF1 S34F cells that were treated with vehicle or SMG1i for 24 hours (n=3) and observed upregulation of endoplasmic reticulum and UPR pathway genes in SMG1i-treated U2AF1 S34F compared to U2AF1 WT cells (GSEA; FDR<0.01). Validation of these findings using primary mouse AML cells is ongoing, including the analysis of key regulators and protein biomarkers of the UPR pathway. The vulnerability of primary hematopoietic cancer cells with spliceosome mutations to NMD inhibition suggests the possibility for therapeutic targeting of NMD to treat myeloid malignancies with aberrant splicing.

Morphologic and Genetic Features of Unclassifiable Chronic Myeloid Neoplasms: Five-Year Experience of a Canadian Provincial Referral Center

Introduction: The challenge of diagnosing and definitively classifying myeloproliferative neoplasms (MPNs) and myelodysplastic/myeloproliferative neoplasms (MDS/MPNs) remains a conundrum in the field of hematology. While the World Health Organization has outlined diagnostic criteria for various categories, there remain cases that elude specific classification, falling under the umbrella of MPN, unclassifiable (MPN-U) and MDS/MPN, unclassifiable (MDS/MPN-U). In this study, we aimed to compare the morphological and genetic profiles of cases classified as MPN-U or MDS/MPN-U against more definitively classified cases (including chronic myelomonocytic leukemia (CMML), essential thrombocythemia (ET), MDS/MPN with ring sideroblasts and thrombocytosis (MDS/MPN-RS-T), and primary myelofibrosis (PMF), including prefibrotic PMF (pre-PMF)). Methods: Morphologically unclassifiable myeloid neoplasm cases referred for pathologist review to our laboratory in the largest tertiary care center in British Columbia, Canada were identified through pathology database query over a five-year period. Bone marrow materials were reviewed and reanalyzed with standardized collection of qualitative and semiquantitative data by two hematopathologists. Morphological parameters studied included the myeloid to erythroid ratio, bone marrow cellularity, lineage dysplasia, megakaryocyte histotopography, bone marrow blast frequency, fibrotic changes, and bone marrow vascularity, among others. Clinical data, cytogenetic findings, and results of a targeted sequencing panel assessing a set of approximately 50 genes recurrently mutated in myeloid malignancies were collected by electronic medical record review. A cohort of contemporarily collected myeloid neoplasms with definitive pathologic diagnoses was reviewed for comparison. Statistical analyses were performed using python3. Results: The cohort comprised 29 cases classified as MPN-U, 12 cases of MDS/MPN-U, and 5 cases each of ET, PMF, pre-PMF, CMML, and MDS/MPN-RS-T. MPN-U cases were further subcategorized based on the apparent reason for difficulty in classification, including: overlapping features with another MPN; late stage/overt fibrosis; early stage without fully-developed morphologic features; and coexisting atypical morphologic findings. MPN-U with overlapping features had highly variable reticulin fibrosis, while, as expected, late stage entities had a high degree of reticulin fibrosis and early stage entities showed less overt fibrosis (Figure, Left, demonstrating select morphologic features of evaluated chronic myeloid neoplasms). MPN-U as a whole appeared to show less prominent fibrosis-associated findings than MDS/MPN-U and to, in general, show a greater degree of neovascularization, similar to changes observed in cases with PMF. Splicing factor and epigenetic modifier mutations appeared to be overrepresented in MDS/MPN-U relative to MPN-U, notably excluding MPN-U with atypical morphologic features (Figure, Right, demonstrating the distribution of pathogenic variants identified in evaluated myeloid neoplasms; results are indicated as presence (1) or absence (0) of a variant for each gene). Notably, no CALR mutations were identified in the MDS/MPN-U category or early stage / atypical morphology MPN-U, though they were enriched in overtly fibrotic MPN-U entities. Discussion/Conclusion: In this cohort we observed, as expected, significant overlap in cases classified as MPN-U and MDS/MPN-U with better delineated entities, though patterns of morphologic change and mutational spectra suggest potential directions for further investigation of additional criteria that may guide accurate classification of these neoplasms. These findings reflect the heterogeneity of MPNs described in the literature and the complexity of their genetic underpinnings, particularly in the context of concurrent dyshematopoiesis; suggest enhanced bone marrow vascularization may be an informative differential diagnostic criterion in evaluation of these neoplasms, though further study is required; and emphasize the need for broader genetic testing and perhaps further subtyping of MPN-U cases for a more nuanced analytical approaches for these disorders.

Ubiquitin Ligase SCF-FBXO11 Controls a Network of RNA-Binding Proteins and Splicing in MDS

The F-Box protein FBXO11 is a substrate receptor of Skp-Cullin-F-Box (SCF) ubiquitin ligase complexes. Loss-of-function mutations in FBXO11 are associated with diffuse large B-cell lymphoma, and FBXO11 has been shown to regulate epigenetic drivers of erythroid cell maturation. In our prior study, we found that deletion of FBXO11 improved cell survival under cytokine deprivation in an MDS cell line. Furthermore, we had observed a striking decrease in FBXO11 protein levels in AML patient samples. However, how FBXO11 contributes to myeloid malignancies is unclear. Here, using RNA-sequencing, proteomics, and CRISPR-Cas9 screening, we reveal broad ubiquitylation of RNA-binding proteins (RBPs) and alternative splicing as a mechanism by which deregulation of FBXO11 enhances malignant cell function. In addition, we report the presence of mutations in the uncharacterized N-terminal extension of FBXO11 in both lymphoid and myeloid malignancies. We first observed that heterozygous deletion of FBXO11 increases colony-forming ability of MDS-AML cell lines in vitro whilea2-fold increase in expression results in decreased cell growth and apoptosis. In a transplant model with a retrovirally-driven Runx1 mutation, heterozygous deletion of Fbxo11 exacerbated neutropenia and shortened overall survival. However, depletion of FBXO11 in healthy human and murine HSPCs significantly impaired myeloid progenitor colony-formation, indicating a unique requirement for FBXO11 in myelopoiesis. Based on its tumor suppressive activity, we evaluated whole-exome sequencing data from patient samples of both lymphoid and myeloid malignancies for FBXO11 mutations. This analysis uncovered rare mutations in FBXO11 in myeloid malignancies and revealed a substantial cluster of previously unidentified mutations in the Q-rich, N-terminal extension of FBXO11. We found that this uncharacterized, extended protein isoform is predominantly expressed in both normal and malignant hematopoietic cells. In colony-forming assays, expression of the long isoform and several of the N-terminal mutations inhibited CD34+ progenitor function. On a cellular level, lack of this N-terminal extension in the short isoform resulted in aberrant subcellular localization of FBXO11 within the nucleus. To elucidate the mechanism of FBXO11 in myeloid malignancy, we performed immunoprecipitation of FBXO11 followed by proteomics to identify endogenous FBXO11 complexes in MDS-AML cells. We integrated these data with ubiquitin proteomics of WT and FBXO11-KO MDS cells to identify candidate substrates of SCF-FBXO11-mediated ubiquitylation. FBXO11 complexes are significantly enriched for RNA-binding proteins affecting mRNA splicing, a process commonly deregulated in MDS. FBXO11-KO MDS cells displayed broad depletion of ubiquitylation in a network of RBPs. As expected, targeting FBXO11 did not affect the level of transcripts of interacting proteins; however, there were variable changes in total protein levels indicative of post-transcriptional regulation. We then applied a focused CRISPR-Cas9-KO screen of candidate SCF-FBXO11 substrates in MDS-AML cells depleted of FBXO11. We observed significant bi-directional effects in colony-forming ability mediated by several of the FBXO11-regulated RBPs including TRIM28, HNRNPU, NPM1, and SYNCRIP. Though FBXO11 is significantly decreased in MDS compared to healthy controls, we saw no difference in FBXO11 expression between splicing factor WT and mutant samples, suggesting that the function of FBXO11 in regulating mRNA splicing in MDS is independent of these mutations. Compared to healthy controls, FBXO11-low MDS samples exhibited a greater number of alternative splicing events, predominantly in skipped or mutually-exclusive exons. To experimentally test whether FBXO11 indeed affects RNA splicing, we utilized a bichromatic splicing reporter assay in MDS-AML cells which showed that depletion of FBXO11 is sufficient to alter splicing of the reading frame in the cassette exon, read out as a shift from GFP to RFP. Finally, STRING protein network analysis revealed that the alternative splicing events occurring in FBXO11-low MDS patient samples affect key nodes in protein translation and metabolism. Collectively, our data support a model whereby the change in FBXO11-mediated ubiquitylation of RBPs drives alternative exon usage that exacerbates malignant cell function in MDS.

KPT-8602 Induced Hematopoietic Differentiation in U2AF1 S34F Mutant Cells and Myelodysplastic Syndromes Bone Marrow Stem and Progenitor Cells

Myelodysplastic syndromes (MDS) are a group of clonal bone marrow (BM) neoplasms characterized by ineffective hematopoiesis, cytopenia's, and a high risk of progression to acute myeloid leukemia. Current standard therapies include erythropoiesis stimulating agents for lower risk disease and DNMTi for higher risk MDS; however, less than half of patients respond and even the best responses are transient and non-curative. The majority of MDS patients harbor at least one of ~40 commonly found somatic gene mutations, most of which occur in splicing factor genes such as U2AF1, which also have non-canonical roles in nuclear export. KPT-8602 (Eltanexor) is a novel selective inhibitor of nuclear export (SINE) that acts by disrupting nuclear export of cargo relevant in MDS. We hypothesized that U2AF1 S34 F mutant cells would be selectively sensitive to treatment with KPT-8602. We created immortalized murine hematopoietic progenitor cells by retroviral transduction of stimulated bone marrow (BM) cells isolated from U2AF1 WT or U2AF1 S34F mice with a HOXB8_ER vector. Estrogen drives the hematopoietic transcription factor immortalizing the cells in a progenitor state, however, upon estrogen withdrawal the cells will differentiate and eventually die. This differentiation can be driven by treatment with specific growth factors such as erythropoietin (EPO) for erythroid differentiation or granulocyte macrophage colony stimulating factor (GM-CSF) for myeloid differentiation. KPT-8602 exposure induced differentiation and increased hematopoiesis in murine cell models and primary MDS samples. U2AF1 WT and U2AF1 S34F cells were plated in medium lacking estrogen and treated with GM-CSF (10nM) or EPO (1nM) with or without KPT-8602 (10nM) for 72h, then stained with Ly6C, CD11b, Ter119, and CD71 for flow cytometry analysis. In addition, we performed colony forming capacity assays in both the murine cells and primary MDS BM stem and progenitor cells and age-comparable healthy donors, with 14 day KPT-8602 exposure. Treatment with GM-CSF significantly increased the expression of Ly6C in both U2AF1 WT and U2AF1 S34F cells (WT fold change untreated vs GMCSF =1.9, p=0.03; S34F fold change untreated vs GMCSF =2.3, p<0.01). However, addition of KPT-8602 caused significantly more Ly6C expression than GM-CSF alone in the mutant cells (WT fold change GMCSF vs combination =3.1, p=0.06; S34F fold change GMCSF vs combination =4.0, p<0.01). There were no significant changes in CD11b expression with KPT-8602 treatment. We did not find a statistically significant increase in erythroid markers assessed by Ter-119 and CD71 after EPO treatment, however, KPT-8602 treatment alone showed a trend of increased expression of Ter-119 and CD71 in the mutant cells that fell just below statistical significance (Ter119 p=0.08 for WT, p=0.09 for S34F; CD71 p=0.21 for WT, p=0.06 for S34F). Additionally, we looked at selective toxicity of U2AF1 S34Fby WST-1 reagent and found no differences in toxicity between the WT or mutant cells with KPT-8602. However, U2AF1 WT and U2AF1 S34F progenitor cells showed an increase in colony forming capacity (n=1 with technical duplicates) when plated in the presence of KPT-8602 showing an average fold change in colony growth of 1.4 for U2AF1 WT and 1.3 for U2AF1 S34F underscoring the ability of KPT-8602 to induce differentiation. To confirm these results were not cell line artifacts, we next treated primary BM stem and progenitor cells from MDS patients (n=2) and healthy donors (n=4). MDS patient 1 (age 73y) was diagnosed with MDS-MLD-EB1 and harbored mutations in TP53, ASXL1, BCOR, TET2 and PPM1D. MDS patient 2 (age 79y) was diagnosed with MDS/MPN and harbored an SF3B1 mutation. Healthy donors (n=4) were all male and had a median age of 65y. Treatment with KPT-8602 (10nM) significantly increased burst and colony forming unit-erythroid (BFU-E/CFU-E) in MDS primary cells (p=0.02) with no significant increase in the healthy donors (p=0.57) (BFU-E/CFU-E fold increase was 1.1 for healthy donors and 3.5 for MDS). Collectively, these findings suggest that KPT-8602 promotes myeloid and erythroid differentiation and further validates the use of KPT-8602 as a therapeutic strategy for MDS. Future studies will fully elucidate the specific mechanisms by which KPT-8602 acts in the context of splicing factor mutations, and other commonly found MDS mutation types.

E7820, an Anti-Cancer Sulfonamide, in Combination with Venetoclax in Patients with Splicing Factor Mutant Myeloid Malignancies: A Phase II Clinical Trial

*JPB and NSC contributed equally. Background and Significance: Mutations in RNA splicing factor genes ( SF3B1, SRSF2 U2AF1 and ZRSR2)are common in patients with acute myeloid leukemia (AML) and myelodysplastic syndromes (MDS). We and others have previously shown that pharmacologic degradation of the RNA splicing factor RBM39 preferentially kills splicing factor mutant cells. These preclinical data provided the rationale for a recently completed phase II clinical trial (NCT05024994) of the oral RBM39 degrader E7820 in patients with relapsed or refractory splicing factor mutant MDS or AML. The safety and efficacy data of this trial have been presented previously (Bewersdorf et al ASH 2022). The generally favorable safety profile and correlative studies confirming target engagement and induction of mis-splicing events support the further exploration of E7820 in the context of combination therapies. Recent clinical data show that treatment with venetoclax can overcome the negative prognostic impact of splicing factor mutations in AML (Senapati et al, Blood 2023). Additionally, preclinical data from our laboratory show synergy between E7820 and venetoclax in SF3B1-mutant isogenic cell lines leading to enhanced RBM39 degradation and blunting of MCL-1 expression, a common cause of venetoclax resistance ( Figure 1). Dynamic BH3 profiling of E7820 in myeloid leukemia cell lines suggests an E7820 dose-dependent priming for BAD which implies forced reliance on BCL2. Furthermore, adding venetoclax to E7820 further increased mitochondrial priming. Preclinical animal modeling with patient-derived xenografts (PDX) is ongoing. Based on these preclinical data, we are amending the study to include a separate arm of E7820 in combination with venetoclax. Methods and Study Design: This is an investigator-initiated, phase II trial (NCT05024994) that is being conducted at Memorial Sloan Kettering Cancer Center and Sylvester Comprehensive Cancer Center at the University of Miami of adult (≥18 years) patients with relapsed or refractory AML, MDS, or chronic myelomonocytic leukemia (CMML). Patients must have a hotspot splicing factor mutation in SF3B1, SRSF2, U2AF1 or U2AF2 (with hotspot mutations as defined by OncoKB) or a nonsense or frameshift mutation in ZRSR2 detected within 6 months of study screening for enrollment. Patients are required to have adequate end-organ function and an Eastern Cooperative Oncology Group (ECOG) performance status of ≤3. Prior treatment with venetoclax is permitted. Patients enrolled in the new combination arm will receive E7820 100mg by mouth once daily + venetoclax orally once daily on days 1-28 of cycle 1 on days 1-21 of subsequent cycles. The study design is shown in Figure 2. As this combination has never been studied in human AML and MDS patients previously, the study will include a 6-patient safety run-in phase with an optional dose de-escalation of E7820 to 70mg orally once daily. The sample size is based on a Minimax Simon 2-stage design. Assuming a type I error rate of 0.05, power of 0.8, a response rate of 10% in the historical control group and 30% with E7820 + venetoclax, 15 patients will be enrolled in stage 1. If there are at least 2 responses among the first 15 patients, we will enroll another 10 patients. The null hypothesis will be rejected if there are at least 6 responses in the 25 patients. The primary endpoint of this trial is to evaluate the efficacy of E7820 + venetoclax in patients with relapsed/refractory myeloid malignancies with mutations in splicing factor genes as measured by the response rate within 6 cycles of therapy (AML: complete remission (CR) + complete remission with partial hematologic recovery (CRh); MDS: CR + CRh + CR with limited hematologic recovery (CR-L) + partial remission (PR); CMML: CR + PR). Secondary endpoints include overall and event-free survival. Correlative biomarker and pharmacodynamic parameters will be assessed as exploratory endpoints including effects on RBM39 protein levels, changes in global and key target splicing events, and evaluation of DCAF15 mRNA levels and response to therapy.

Impaired Early Spliceosome Complex Assembly Underlies Gene Body Elongation Transcription Defect in SF3B1K700E

Introduction: Recurrent mutations in splicing factors (SFs) such as SF3B1, U2AF1 and SRSF2 are common in clonal myeloid disorders. These mutations are typically hemizygous, exclusive to each other, and non-synonymous, pointing to neomorphic functions. Molecular mechanisms connecting the mutations to disease pathogenesis remain unclear. Previous studies predominantly focused on the well-established role of splicing factors in pre-mRNA splicing, seeking to explain how mutations in these SFs leading to changes in the abundance of key regulatory genes through their effects on alternative splicing. These studies are limited by inconsistent and relatively low isoform changes across mutations and independent datasets. They also don't explain the mutual exclusivity of these mutations. In this study, we explored a novel mechanism that link SF mutations to disease biology: dysregulation of RNA Polymerase II (Pol2) transcriptional kinetics arising from impaired spliceosome assembly. Methods: We generated inducible isogenic K562 cell lines that express single mutant alleles (SF3B1 K700E and U2AF1 S34F,and corresponding wild-type controls). A novel combinatory approach of AAV-intron trap with CRISPR/Cas9 (Boddu et al, Comms Biol, 2021) was utilized for gene editing. RNAPII transcription kinetics changes were assessed, at an early post-induction time point of 4 days (Fig1A), using ChIP-seq, and nascent-transcriptome assays (including GRO-seq and transient transcriptome-time lapse sequencing or TT-TL seq). Spliceosome assembly kinetics were assayed with non-denaturing gels. Co-transcriptional splicing efficiency (CoSE) was assessed using nascent long-read sequencing (LRS) (Reimer, Mol Cell 2021). Key findings in K562 cell lines were validated in CD34+ progenitor populations from MDS-derived patient samples (and healthy volunteer controls). Results: ChIP-seq for Pol 2 (both total (Fig1B) and elongation-specific Ser2P (Fig1C) showed a redistribution of Pol2 into gene-bodies, suggesting a failure of Pol2 elongation in SF3B1 K700E. This Pol2 redistribution was dependent on gene length and intron number (long, multi-intron genes most affected). GRO-seq confirmed the ChIP-seq results (Fig1D). Additionally, spike-in normalized TT-seq showed significantly reduced nascent transcription in gene bodies in SF3B1 K700E (Fig 1E), consistent with a gene-body elongation rate defect. A similar redistribution of Pol2 into gene bodies was noted by ChIP-seq and TT-seq in U2AF1S34F, pointing to a convergent transcriptional response among distinct SF mutations. Genome-wide CoSE was noted to be lower in SF3B1 K700Eindicating an associated splicing assembly defect (Fig1F). Changes to transcription due to SF3B1 mutations were similarly observed, using low-input Pol2 CUT&RUN, in CD34+ progenitor populations isolated from human MDS patient samples (Fig1G). Of pathologic relevance, this transcriptional dysregulation led to generation of R-loops, DNA damage, and S-phase arrest. Given close coordination of splicing and transcription, and role of SF3B1 and U2AF1 in early spliceosome formation, we speculated if mutant SF3B1 leads to defective assembly of early spliceosomes. Compared to wild-type protein, SF3B1 K700E was noted to have significantly impaired interactions with U2AF1, U2AF2, HTATSF1 (Fig1H). We then determined how spliceosome assembly kinetics of SF3B1 K700E differed from those of SF3B1 WTusing an in vitro splicing assay. The transition from E- to A- complex intermediates was reduced in SF3B1 K700E(Fig1I). Furthermore, disrupting the early pre-spliceosome assembly (through loss of DDX46 or HTATSF1 using both siRNA and inducible shRNA (Fig1J) knockdown systems) resulted in a transcriptional response similar to SF3B1 K700E. Based on recent cryo-EM structures of Pol II-U1 snRNP interactions (Zhang et al, Science, 2021), we speculate that the impaired transition to A/B complex in SF3B1 K700E prevents the release of U1 snRNP and release of Pol2, leading to intron-predominant defective Pol II elongation (Fig1K). Conclusion: Here, we found that SF3B1 and U2AF1 mutations impair Pol2 transcription elongation along gene bodies, leading to pathologic R-loops and replication stress. This elongation results from disrupted pre-spliceosome assembly due to impaired protein-protein interactions of mutant SF3B1.

Transcription Defects in SF3B1K700E Induce Targetable Alterations in the Chromatin Landscape

Introduction: Acquired mutations, most commonly in RNA splicing factors and epigenetic regulators are thought to be disease drivers of clonal myeloid disorders such as MDS and AML. Both MDS and AML are amenable to epigenetic therapies regardless of underlying mutational subtypes. This prompted our hypothesis that alterations to epigenetic and chromatin landscape is important in pathobiology of clonal myeloid disorders driven by splicing factor mutations. In this study, we demonstrate that SF3B1 mutations induce distinct changes to epigenetic landscape and chromatin organization by altering RNA Polymerase II (Pol2) transcription kinetics. Critically, such epigenetic changes are also targetable - inhibiting components in the H3K4me/Sin3/HDAC pathway reverses Pol2 transcription defects and downstream effects on chromatin organization and genomic integrity. Methods: We generated inducible isogenic K562 cell lines that express single mutant allele of SF3B1 K700Ecombining two genome editing approaches (AAV-intron trap with CRISPR/Cas9 (Boddu et al, Comms Biol, 2021)) (Fig1A). RNAPII transcription kinetics changes were assessed using ChIP-seq for Pol2 and nascent-transcriptome assays (including GRO-seq and transient transcriptome-time lapse sequencing (TT-TL-seq). Chromatin accessibility/nucleosome density and histone marks (H3K4me3, H3K27ac, H3K27me3) were assessed using ATAC-seq and low-input CUT&RUN, respectively. Key results were replicated in patient samples with SF3B1 mutations and in a Sf3b1K700E mouse model. Results: Combining genome-wide approaches (ChIP-seq (Fig1B), GRO-seq, and TT-TL seq (Fig1C)), we found that Pol2 in SF3B1 K700E redistributes into the gene body due to a primary gene-body elongation defect. This transcriptional dysregulation was reflected in downstream effects such as excess R-loops (S9.6 microscopy; Fig1D), transcription-replication conflicts (proximity ligation assay for PCNA-Pol2; Fig1E), and S-phase arrest (flow cytometry; Fig1F). Importantly, normalized Pol2 density at proximal-promoter (p-p) region was reduced in SF3B1 K700E (Fig1G). This correlated with a reduction in p-p H3K4me3 in SF3B1 K700E determined by Cut and Run (Fig1H). ATAC-seq showed a reduction in promoter accessibility (Fig1I) and increased nucleosome promoter density (Fig1J). ChIP-seq for CDK9, a component of p-TEFb pause release complex, showed higher occupancy at promoters in SF3B1 K700E (Fig1K), suggesting that premature promoter pause release of Pol2 is the major driver for the observed reduction in p-p Pol2 density. Consistent with the importance of p-p Pol2 in maintaining accessible chromatin states, our findings suggest that depletion of p-p Pol2 leads to nucleosome repositioning at promoters and loss of chromatin accessibility (Gilchrist et al, Cell, 2010). Given the extensive cross talk between chromatin and transcription, we speculated that modulating epigenetic regulators might improve Pol2 elongation defects and rescue cells from downstream effects. An unbiased shRNA rescue screen, targeting epigenetic regulators and chromatin modifier protein classes, enriched for proteins in the Sin3/HDAC pathway (ING2, HDAC2) (Fig1L). Conversely, knocking down (KD) for WDR5 (H3K4me3 writer complex) further worsened survival. HDAC2 and ING2 KD cells showed reduced R-loops and DNA damage, lower gene-body Pol2 ChIP densities (Fig1M), normalization of p-p H3K4me3 densities (Fig1N), and rescue from S-phase arrest. These effects of WDR5 and HDAC2/ING2 KD on survival in SF3B1-mutant isogenic cells was confirmed in both MDS patient samples (Fig1O)- and Sf3b1K700E murine models (Fig1P)- contexts, using in vitro colony assays. Conclusion: Our findings show that SF3B1 K700E-induced disruption of Pol2 elongation kinetics is reflected in reduced Pol2 density at proximal promoter sites and results in a corresponding reduction in chromatin accessibility and promoter H3K4me3. Through an unbiased shRNA screen, we identified epigenetic factors in the Sin3/HDAC/H3K4me pathway, which, when modulated, improved the transcription defects and their downstream effects. Our findings shed light on the mechanisms by which oncogenic mutant spliceosomes affect chromatin organization through their effects on Pol II transcription elongation and present a rationale for targeting the Sin3/HDAC complex as a potential therapeutic strategy.

Mutant p53 Drives the Development of Myelodysplastic Syndromes Via Dysregulating Pre-mRNA Splicing in Hematopoietic Stem and Progenitor Cells

Despite the clinical importance of TP53 mutations, to date there have been no studies on the functional impact of TP53 mutations on the initiation and progression of MDS. We found that heterozygous p53 mutant mice ( p53R248W/+) show extended survival and died within 15-20 months after birth. p53 mutant mice had hypercellular bone marrow and displayed cytopenia, thrombocytopenia, and anemia. Approximately 60% of p53R248W/+ mice developed MDS based upon pathological analysis of bone marrow (BM) and peripheral blood smears, while the remaining p53R248W/+ mice developed lymphoma and sarcoma. We further showed that mutant p53-driven MDS are transplantable. Thus, we have generated a mouse model of MDS that has some features of human MDS with TP53 mutations. To understand how mutant p53 drives MDS development, we performed RNA-seq studies to compare gene expression in hematopoietic stem and progenitor cells (HSPCs). GSEA analysis revealed that spliceosome genes were significantly downregulated in middle-aged p53 R248W/+ HSPCs compared to age-matched p53 +/+ HSPCs. We confirmed that the expression of splicing factors, such as Prpf3 and Prpf4, was significantly downregulated in middle-aged p53 R248W/+ HSPCs. We conducted alternative splicing analysis utilizing MISO (Mixture of Isoforms) algorithm to identify differences in exon inclusion ratio between WT and mutant HSPCs. We observed differential splicing of all classes of alternative splicing events, including Cassette Exons (CE), Competing 5′ and 3′ splice sites (A5' or A3'SS), Mutually Exclusive Exons (MXE), and Retained Introns (RI) in p53 R248W/+ cells compared to that of the WT HSPCs. Notably, we found that murine p53 mutant HSPCs exhibited aberrant splicing of key regulators of NFκBactivation, such as USP15. USP15 overexpression promotes NFκB expression through inhibiting its ubiquitination, whereas NFκB promotes USP15 expression. p53 mutant HSPCs tend to skip exon 7 and express high levels of short isoform of Usp15. The short isoform of Usp15, but not the long isoform of Usp15, activates NFκB in HSPCs, manifested by increased phosphorylation of p65. To determine the impact of mutant p53 on pre-mRNA splicing in human HSPCs, we ectopically expressed GFP or p53 R248W in human cord blood CD34 + cells and performed RNA-seq in transduced cells (GFP +). Human HSPCs expressing mutant p53 displayed alterations in pre-mRNA splicing compared to HSPCs expressing GFP. We found that human HSPCs expressing mutant p53 display aberrant splicing in key regulator of NFκB such as IKBKE (Inhibitor of nuclear factor kappa-B kinase subunit epsilon). Human HSPCs expressing mutant p53 tend to include exon 7 and express high levels of long isoform of IKBKE. The long isoform of IKBKE, but not the short isoform of IKBKE, activates NFκB in human HSPCs. Many proinflammatory cytokine genes are NFκB targets and we observed increased levels of pro-inflammatory cytokines, including IL-1β and IL-6, in the BM of middle-aged p53 mutant mice. Notably, we observed increased levels of IL-1β and IL-6 in the BM of MDS or AML patients with TP53 mutations. TP53 mutations co-occur with splicing factor mutations in MDS. To determine whether TP53 and SRSF2 mutations cooperate in pathogenesis of MDS, we have generated p53 R248W/+SRSF2 P95H/+ mice. We found that the survival of recipient mice repopulated with p53 R248W/+SRSF2 P95H/+ BM cells was significantly decreased compared to recipients repopulated with WT, p53 R248W/+, or SRSF2 P95H/+ BM cells. All recipient mice repopulated with p53 R248W/+SRSF2 P95H/+ BM cells died within 6 months and developed MDS or leukemia. Thus, we demonstrate that TP53 and SRSF2 mutations cooperate in MDS or leukemia development. In summary, we discovered that mutant p53 dysregulates pre-mRNA splicing in key regulators of inflammatory response during aging, thereby generating a chronic inflammatory microenvironment to drive MDS pathogenesis.