Specific PCR Products Research Articles

Development of specific molecular markers to distinguish and quantify broomrape species in a soil sample

Broomrapes (Orobanche and Phelipanche spp.) are destructive obligate plant parasites in Israel and in the Mediterranean basin. Conventional methods for parasitic weeds detection are difficult, since the parasite seeds are extremely small (dust-like seeds) and survive in the soil for several decades. Here, we report the development of specific molecular markers rbcL1 based on rbcL (large subunit of the ribulose-bisphosphate carboxylase) gene from Orobanche crenata and ITS100 based upon unique sequences in the internal transcribed spacer (ITS) regions of the nuclear ribosomal DNA of Phelipanche aegyptiaca. Genomic DNA was extracted from soil samples artificially infested with broomrape seeds or tissue of P. aegyptiaca, O. cumana and O. crenata and subjected to PCR analysis. rbcL1 marker, successfully differentiate between O. crenata and O. cumana, amplified a specific PCR products (1300 bp with O. crenata and 1000 bp with O. cumana). However, the rbcL1 marker failed to amplify soil samples with seeds or tissues of P. aegyptiaca or any soil-borne DNA. ITS100 marker and Real-Time PCR, allowed quantitative diagnostic of the parasite O. cumana in a soil sample; amplified a specific PCR products (100 bp). As expected the universal control primer (UCP-555) amplified a PCR product (555 bp), when genomic DNA extracted from soil samples with or without broomrape tissues. The development of an efficient, simple and robust molecular marker to detect and distinguish between broomrape species, has a significant insights on the assessment level of infestation and planning eradication program of the parasite in a field crop.

First Report of Cotton Leafroll Dwarf Virus in Upland Cotton (Gossypium hirsutum) in Mississippi

HomePlant DiseaseVol. 103, No. 7First Report of Cotton Leafroll Dwarf Virus in Upland Cotton (Gossypium hirsutum) in Mississippi PreviousNext DISEASE NOTESFirst Report of Cotton Leafroll Dwarf Virus in Upland Cotton (Gossypium hirsutum) in MississippiN. Aboughanem-Sabanadzovic, T. W. Allen, T. H. Wilkerson, K. N. Conner, E. J. Sikora, R. L. Nichols, and S. SabanadzovicN. Aboughanem-SabanadzovicDelta Research and Extension Center, Mississippi State University, Stoneville, MSSearch for more papers by this author, T. W. Allenhttp://orcid.org/0000-0003-2828-3420Mississippi State University, Delta Research and Extension Center, Stoneville, MSSearch for more papers by this author, T. H. WilkersonMississippi State University, Delta Research and Extension Center, Stoneville, MSSearch for more papers by this author, K. N. ConnerAlabama Cooperative Extension System, Auburn University, ALSearch for more papers by this author, E. J. SikoraAlabama Cooperative Extension System, Auburn University, ALSearch for more papers by this author, R. L. NicholsCotton Inc, Cary, NCSearch for more papers by this author, and S. Sabanadzovic†Corresponding author: S. Sabanadzovic; E-mail Address: ssabanadzovic@entomology.msstate.eduhttp://orcid.org/0000-0002-2995-2633Department of Biochemistry, Molecular Biology, Entomology and Plant Pathology, Mississippi State University, Mississippi State, MSSearch for more papers by this authorAffiliationsAuthors and Affiliations N. Aboughanem-Sabanadzovic1 T. W. Allen2 T. H. Wilkerson2 K. N. Conner3 E. J. Sikora3 R. L. Nichols4 S. Sabanadzovic5 † 1Delta Research and Extension Center, Mississippi State University, Stoneville, MS 2Mississippi State University, Delta Research and Extension Center, Stoneville, MS 3Alabama Cooperative Extension System, Auburn University, AL 4Cotton Inc, Cary, NC 5Department of Biochemistry, Molecular Biology, Entomology and Plant Pathology, Mississippi State University, Mississippi State, MS Published Online:10 May 2019https://doi.org/10.1094/PDIS-01-19-0017-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Cotton leafroll dwarf virus (CLRDV), associated with “cotton blue disease” known to occur in Africa, Asia-Pacific, and South America (Corrêa et al. 2005; Distéfano et al. 2010; Ray et al. 2016), has been recently reported from Alabama (Avelar et al. 2019), which prompted a survey of the Mississippi (MS) cotton production area during late October and early November 2018. During the survey, 60 samples of healthy-looking and CLRDV-suspect plants were collected from 17 counties and tested for the presence of the virus. Diseased plants expressed a range of symptoms including leaf curling, reddening and distortion, unusual secondary plant growth characterized by shortened internodes, and a general reduction in boll set. Cotton aphids (Aphis gossypii Glover) were also present on some of the collected plant material. Disease incidence in individual fields, estimated visually, ranged from <1% to >20% with the greater values occurring in southeast MS. Thirteen samples were initially tested at the Plant Disease Diagnostic Lab at Auburn University with a two-step RT-PCR protocol (Sharman et al. 2015), while the remainder were examined in the Plant Virology Lab at Mississippi State University with two independent single-tube RT-PCR tests originally designed in this study. To prepare samples for virus-specific tests, total RNAs were purified from petioles using the manufacturer’s protocol for the Qiagen Plant RNA Easy kit. A single-tube RT-PCR test was performed using a set of primers (CLRDV-CPF1 5′ ACGACGAAGACGAGGAGGTC′ and CLRDV-CPR1 5′ GAACCGGAGGATGTTGAAGAGG 3′) designed to amplify a 249-nt-long segment of the viral coat protein (CP) gene. A specific PCR product of predicted size was present in 38 samples collected from 13 counties indicating relatively high virus incidence (63%) and prevalence (76%). No visible bands were present in negative and water/blank controls. No discrepancies in results were observed when 10 randomly selected samples tested in one-tube tests with CP primers were verified by the protocol of Sharman et al. (2015) and with another set of primers designed in this study targeting a 770-nt-long portion of viral RdRp gene (CLRDV-RdRpF2 5′GGAGCCGCACAAACAAGCTAA 3′and CLRDV-RdRpR1 5′ AACAGGCGTTCAGGTAGTTGGA 3′). Both amplicons (249 bp and 770 bp) from six samples collected from four counties (Bolivar, Grenada, Tallahatchie, and Washington) were cloned and custom sequenced. Pair-wise and BLASTn analyses revealed that they share highly conserved nucleotide content (95 to 100%) with each other and with the recent record from Alabama (GenBank MH883236), as well as with CLRDV isolates from Brazil and Argentina available in the NCBI/GenBank (December 2018). Nucleotide sequences of two genomic regions (RdRp and CP) for six virus isolates from Mississippi have been deposited in GenBank under accession nos. MK512759 to MK512770. This is the first report of polerovirus infections of cotton in MS. Results from this study, along with recent report of the same virus from Alabama, call for multidisciplinary research to understand population structure, epidemiology and ecology of the virus, and its potential impact on the United States cotton industry.The author(s) declare no conflict of interest.

First report of Tomato leaf curl Joydebpur virus infecting French bean (Phaseolus vulgaris L.)

During 2016-2017 in Bhagalpur, Bihar, northern India, French bean plants developed curling and yellow mosaic of leaves and stunting. In eight of 12 symptomatic plants, PCR tests for Mungbean yellow mosaic India virus were positive. In the four PCR-negative symptomatic plants, rolling circle amplification (RCA) detected a ~ 2.7-kb DNA that was identified as genomic DNA of Tomato leaf curl Joydebpur virus. Also a ~ 1.4-kb specific PCR product was identified as Tomato leaf curl Joydebpur betasatellite. Whitefly-mediated transmission to chili was as efficient as that to French bean. Our findings provide evidence of a monopartite begomovirus in French bean.

Molecular characterization of Dobrava-Belgrade hantavirus in Serbia, 2007–2011

BackgroundHantaviruses are etiological agents of emerging zoonotic diseases worldwide, including hemorrhagic fever with renal syndrome (HFRS). A number of hantavirus species is known to be present in Europe. In Serbia, existing data on hantavirus presence and prevalence rely in serological findings. In this study, molecular analysis was performed in order to characterize HFRS causing hantaviruses in Serbia. MethodsSixty four serum samples of HFRS cases, previously found seropositive to anti-hantaviral antibodies, were included in the study. Partial hantaviral L and S segments were PCR amplified producing 390nt and 598nt amplicons, respectively, in parallel with human beta-actin mRNA as external reverse transcription positive control. Hantavirus specific PCR products were DNA sequenced in both direction and the obtained sequences phylogenetically confirmed and analyzed. ResultsPCR detection of hantavirus L and S genome segments was positive in 18/64 and 11/64 tested samples, respectively. Positive PCR results involved samples obtained from different locations, mostly from central and southern parts of Serbia. All the obtained sequences were identified as Dobrava-Belgrade virus (DOBV). In the phylogenetic analysis sequences from Serbia tended to cluster in distinctive, geographically related clusters. ConclusionsOur findings indicate DOBV as the main HFRS causing hantavirus in Serbia, the site of its initial isolation.

In vitro effect of the crude extract of a potato common scab streptomycete in Sinaloa, Mexico

A strain isolated from potato common scab superficial lesions in El Fuerte Valley in northern Sinaloa, Mexico, was identified by 16S rRNA and morphological methods. Moreover, the effects of the crude extract of strain V2 was evaluated on radish and potato. The isolate was similar to Streptomyces acidiscabies in its morphological properties; however, the 16S rRNA gene sequence of strain V2 was neither 100% identical to this species nor to the streptomycetes previously reported in Sinaloa, Mexico. Strain V2 did not amplify any specific PCR products for genes nec1 and tomA, which have been found and reported in S. acidiscabies. Strain V2 produced a PCR product for the txtAB operon, which is related to the production of thaxtomin. In vitro assays using crude thaxtomin extract and a spore suspension of the organism caused necrotic symptoms on radish and potato, which were highly virulent in potato. This study reports that Streptomyces sp. V2 has a toxigenic region (TR) that is associated with the thaxtomin gene cluster.

Translocation of a parthenogenesis gene candidate to an alternate carrier chromosome in apomictic Brachiaria humidicola

BackgroundThe apomictic reproductive mode of Brachiaria (syn. Urochloa) forage species allows breeders to faithfully propagate heterozygous genotypes through seed over multiple generations. In Brachiaria, reproductive mode segregates as single dominant locus, the apospory-specific genomic region (ASGR). The AGSR has been mapped to an area of reduced recombination on Brachiaria decumbens chromosome 5. A primer pair designed within ASGR-BABY BOOM-like (BBML), the candidate gene for the parthenogenesis component of apomixis in Pennisetum squamulatum, was diagnostic for reproductive mode in the closely related species B. ruziziensis, B. brizantha, and B. decumbens. In this study, we used a mapping population of the distantly related commercial species B. humidicola to map the ASGR and test for conservation of ASGR-BBML sequences across Brachiaria species.ResultsDense genetic maps were constructed for the maternal and paternal genomes of a hexaploid (2n = 6x = 36) B. humidicola F1 mapping population (n = 102) using genotyping-by-sequencing, simple sequence repeat, amplified fragment length polymorphism, and transcriptome derived single nucleotide polymorphism markers. Comparative genomics with Setaria italica provided confirmation for x = 6 as the base chromosome number of B. humidicola. High resolution molecular karyotyping indicated that the six homologous chromosomes of the sexual female parent paired at random, whereas preferential pairing of subgenomes was observed in the apomictic male parent. Furthermore, evidence for compensated aneuploidy was found in the apomictic parent, with only five homologous linkage groups identified for chromosome 5 and seven homologous linkage groups of chromosome 6. The ASGR mapped to B. humidicola chromosome 1, a region syntenic with chromosomes 1 and 7 of S. italica. The ASGR-BBML specific PCR product cosegregated with the ASGR in the F1 mapping population, despite its location on a different carrier chromosome than B. decumbens.ConclusionsThe first dense molecular maps of B. humidicola provide strong support for cytogenetic evidence indicating a base chromosome number of six in this species. Furthermore, these results show conservation of the ASGR across the Paniceae in different chromosomal backgrounds and support postulation of the ASGR-BBML as candidate genes for the parthenogenesis component of apomixis.

Study on cross-species transferability and DNA fingerprinting of Ashwagandha genotypes using SSR markers

Ashwagandha (Withania somnifera) commonly known as Indian Ginseng belonging to the family Solanaceae is a highly valuable medicinal herb used in the Indian traditional as well as modern system of medicine. Being a highly traded medicinal herb, proper identification and authentication of the raw material is essential for which the molecular characterization is required. As SSR markers are not reported in Ashwagandha, the transferability of SSRs from related species was studied. In this study, cross-species amplification of 85 SSR markers from eggplant (29), potato (17) and pepper/capsicum (39) were tested in 14 genotypes of ashwagandha. A set of 40 primers out of 85 produced specific and scorable PCR products. The results indicated that 48.35% of eggplant markers, 47.1% of potato and 47.36% of capsicum markers showed amplifications and were transferable to ashwagandha. The amplified primers were used for DNA fingerprinting of these genotypes. A total of 74 alleles were detected, out of which 70 primers showed 100% polymorphism among the genotypes. The number of alleles detected ranged from 1 to 6, with an average of 1.85 alleles per primer pair. The polymorphic information content (PIC) value ranged from 0.138 to 0.995 with an average of 0.639.

Prevalence and molecular variability of Apple chlorotic leaf spot virus capsid protein genes in Lithuania

Apple chlorotic leaf spot virus (ACLSV) is a most common pathogen of apples in the world. The occurrence, genetic diversity, recombination patterns and mutation of ACLSV CP in apple trees 80–120 years old from old homesteads and abandoned orchards in Lithuania were investigated. Using RT-PCR, 73.8% of samples tested positive for ACLSV. Specific PCR products to virus CP gene were sequenced and analysed from 39 RNA samples of apple trees collected in different geographic locations. Heterogenic infection of ACLSV in the same apple tree was detected in 11 samples. Fifty Lithuanian sequences of ACLSV with diversity in CP gene were submitted in NCBI and compared to 28 analogous sequences by other authors. The identity of virus CP gene among Lithuanian isolates ranged 81.6–99.7% at the nucleic and 88.6–100% at the amino acids level. ACLSV isolates significantly distinguished into two clusters and seven subclusters on phylogenetic tree. Isolates related to P205, A4, B6 and GC10a were identified in Lithuania, and relationship with Mo-5 and RC was not found. Two recombinant Lithuanian isolates of ACLSV distinguished to separate subcluster R-LT. Lithuanian isolates were characterized by combination of amino acids in conservative sites. The unique single or multiple mutations in CP gene among Lithuanian isolates were observed, and substitution in conservative sites 59, 75 and 79 was also identified. The high prevalence and diversity of latent infection in old apple trees was frequently determined due to the genomic mutation and rarely due to the recombination.

Detectingstr resistantgene from S. Typhimurium isolates By molecular technique

The present study usedPCR for identify genes encoding aminoglycoside-modifying enzymes in S.Typhimurium, these primers for detection str gene which responsible for resistance to streptomycin, and we found these nine isolates detected by these primers and produce specific PCR product is an250-bp fragment which was visualized by gel electrophoresis and ethidium bromide staining.,other studies also conducted for detection this gene in S. Typhimurium,use these specific primer for detection str gene during evolution of antibiotic resistance in S. Typhimurium strains.

Studying The Expression of Human TGFB1 Gene in Patients Carrying Breast Cancer

TGFB1 gene encodes a member of the transforming growth factor beta (TGFB) family of cytokines, that play multifunctional roles in regulation the proliferation, differentiation, and other functions in different cell types. Therefore, we collected thirty samples from Yarmouk hospital in Baghdad ,Iraq.Twenty- nine from women patients carrying Breast cancer and the last one was from healthy woman. and the samples that we have taken were embedded in paraffin wax, The extracted RNA from each samples was used to check the expression of TGFB1 gene via Real time PCR.We designed primers of TGFB1 gene on encoded sequence (Exon), to make sure generation a specific PCR product of TGFB1 gene by converting mRNA to cDNA then PCR Product , The expression of each samples was fluctuated between 0.1 fold to 0.2 fold compared with the control ( the healthy sample). The highest expression showed was samples 14 with 0.2 fold , and the lowest expression showed was samples 27 with approximately 0.1 fold that is similar relatively compared with control expression .The results indicate that tumor may affects on a TGFB1 gene and can increase the gene expression, and eventually can increase the TGFB1 protein that can be used for upregulation of the cells that carried the cancer.

Identification of Insertion Site by RESDA-PCR in Chlamydomonas Mutants Generated by AphVIII Random Insertional Mutagenesis.

Chlamydomonas reinhardtii is frequently used as a model organism to study fundamental processes in photosynthesis, metabolism, and flagellar biology. Versatile tool boxes have been developed for this alga ( Fuhrmann et al., 1999 ; Schroda et al., 2000 ; Schroda, 2006). Among them, forward genetic approach has been intensively used, mostly because of the high efficiency in the generation of hundreds of thousands of mutants by random insertional mutagenesis and the haploid nature therefore phenotypic analysis can be done in the first generation ( Cagnon et al., 2013 ; Tunçay et al., 2013 ). A major bottleneck in the application of high throughput methods in a forward genetic approach is the identification of the genetic lesion(s) responsible for the observed phenotype. In this protocol, we describe in detail an improved version of the restriction enzyme site-directed amplification PCR (RESDA-PCR) originally reported in (González- Ballester et al., 2005 ). The improvement includes optimization of primer combination, the choice of DNA polymerase, optimization of PCR cycle parameters, and application of direct sequencing of the PCR products. These modifications make it easier to get specific PCR products as well as speeding up subcloning steps to obtain sequencing data faster.

Studying The Expression of Human P53 Gene in Patients Carrying Breast Cancer.

The gene P53 can activate DNA repair proteins when DNA has sustained damage. So, it is an important factor in aging. Also, P53 gene can also be modified by mutagens (chemicals, radiation, or viruses), increasing the likelihood for uncontrolled cell division. For this importance, we collected thirty samples from Yarmouk hospital in Baghdad, Iraq.&#x0D; Twenty-nine from women patients carrying breast cancer and the last one was from healthy woman, and the samples that we have taken were embedded in paraffin wax. The extracted RNA from each samples was used to check the expression of a suppressor gene (P53) via Real time PCR. We designed primers of P53 gene on encoded sequence (Exon), to make sure generation a specific PCR product of P53 gene by converting mRNA to cDNA then PCR Product. The expression of each samples was fluctuated between 0.1 fold to 0.2 fold compared with the control (the healthy sample). The highest expression showed was samples 7 (0.2 fold), and the lowest expression showed was samples 27 (0.1 fold) that compared with control expression (sample 19). While the control expression was the highest (0.25 fold) among all samples. &#x0D; The results indicate that tumor may affects on a suppressor gene (P53) and can decrease the gene expression, and eventually can decrease the P53 suppressor protein that can be used it in the cell protection against cancer.

P136 The assay for simultaneous genotyping of 14 functional KIR genes by sequence-based typing

Aim The killer cell immunoglobulin-like receptors (KIRs) gene cluster consists of 14 functional genes and 2 pseudogenes. Identification of KIR alleles has functional and clinical significance. However, KIR sequencing-based typing (SBT) commercial kit is not available. High through-put simultaneously genotyping of 14 functional KIR genes by SBT has not been reported owing to the varied PCR annealing temperature or the varied fragment size of PCR amplicons and extension time. The aim of present study aimed to establish the through-put KIR SBT method. Methods We designed and synthesized a total of 112 pairs of KIR gene specific PCR primers and 230 sequencing primers for SBT test of 14 functional KIR genes. PCR amplification of all exons of each KIR gene was conducted by using 3–5 pairs KIR gene-specific PCR primers. All the KIR genes were amplified under the same PCR conditions: 95 °C 2 min; followed by 35 cycles of 15 s. at 95 °C, 15 s. at 68 °C, 3.5 min. at 72 °C; 7 min. at 72 °C;4 °C forever. The PCR product was run electrophoresis on the agarose gel to identify the presence or absence of KIR genes using our KIR-SBT PCR primers, as a parallel control, the presence and absence of KIR genes were also examined using the Inno-Train KIR-SSP commercial kit. Samples with the positive specific PCR products were then subjected to sequencing on an ABI 3730 DNA Sequencer. Sequence assembly and analysis were accomplished using the Assign 3.5 software (Conexio Genomics, Australia). Results All the 14 functional KIR genes can be amplified simultaneously under the same PCR condition and the PCR procedure can be finished in less than 3.5 h, which greatly facility the PCR procedure and make it less labour-consuming. The presence or absence of 14 functional KIR genes identified by our KIR-SBT PCR primers were completely in accordance with the results of KIR SSP commercial kit, indicating our KIR-SBT PCR primers could ensure specific amplification for each KIR gene. No background or noise was emerged in the obtained sequences. 306 samples from southern Hans were detected by our KIR SBT method, 115 alleles including 46 KIR novel alleles and 258 allelic KIR profiles were identified. Conclusions The through-put SBT method developed by us shows a broad prospective in transplantation, KIR-associated diseases and population studies.

Detection virulence factors of Klebsiella pneumonia from cattle by using PCR tec.

Identification of K. pneumoniae was avaluated using conventional microbiological characteristics and molecular assays .Milk specimens were collected from cattle suffered from clinical symptoms of mastitis from different farms of AL-Qadisyiah province.Out of 45 samples obtained, 20 isolates ( 44.4 %) were detected as K. pneumonia according to morphology of colonies and biochemical features.Molecular detection of Klebsiella pneumoniae based 16S rRNA gene for determination two virulence factor genes(rmpA,magA) by using specific primer.These genes potent the pathogenesis of Klebisella pneumonia. The primers were made in this study by using NCBI-GenBank and primer3 plus design online. The primer is made by company in Korea (Bioneer).Moleculer detection of isolates which give away specific PCR products of of 312bp for magA gene and 835bp for rmpA gene .The magA and rmpA genes were amplified in six (30%)and five(25%) isolates out of 20 isolates of Klebsiella pneumonia.

Development of T m -shift genotyping method for detection of cat-derived Giardia lamblia.

To develop T m -shift genotyping method for detection of cat-derived Giardia lamblia, two sets of primers with two GC-rich tails of unequal length attached to their 5'-end were designed according to two SNPs (BG434 and BG170) of β-giardin (bg) gene, and specific PCR products were identified by inspection of a melting curve on real-time PCR thermocycler. A series of experiments on the stability, sensitivity, and accuracy of T m -shift method was tested, and clinical samples were also detected. The results showed that two sets of primers based on SNP could distinguish accurately between assemblages A and F. Coefficient of variation of T m values of assemblage A and F was 0.14 and 0.07% in BG434 and 0.10 and 0.11% in BG170, respectively. The lowest detection concentration was 4.52×10-5 and 4.88×10-5ng/μL samples of assemblage A and F standard plasmids. The T m -shift genotyping results of ten DNA samples from the cat-derived G. lamblia were consistent with their known genotypes. The detection rate of clinical samples by T m -shift was higher than that by microscopy, and their genotyping results were in complete accordance with sequencing results. It is concluded that the T m -shift genotyping method is rapid, specific, and sensitive and may provide a new technological mean for molecular detection and epidemiological investigation of the cat-derived G. lamblia.

Detection of small number of Giardia in biological materials prepared from stray dogs.

Giardia lamblia is an intestinal protozoa with intermittent and low shedding especially in dogs, and the detection of Giardia is accompanied with problems such as sampling and diagnostic method. The objective of this study was to detection of Giardia in biological materials with low number of parasite using parasitological and molecular methods, and also to determine whether the examined stray dogs harbor known zoonotic genotype of Giardia. For this aim 85 fecal and duodenal samples were studied from which 1 was positive by Trichrome staining of stool, 4 were positive by staining of duodenal samples. The nested PCR analysis with primers derived from 18 SrRNA showed that the specific PCR product could be amplified in 4 stool and 4 duodenal samples. All positive samples in staining analysis were also positive in nested PCR. No amplification could be observed by nested PCR with primers derived from β giardin gene due to the single copy of gene. Interestingly, the extracted DNA from old fixed stained Giardia positive smears could be also amplified with primers derived from 18SrRNA gene. The sequence analysis of nested PCR products showed that they belong to the genotype D. In conclusion, it is to denote that the Trichrome or Giemsa methods were not suitable for the detection of small number of this parasite in stool and the nested PCR with primers derived from 18S rRNA gene can replace the traditional methods successfully. For detection of Giardia in stool, primers derived from β giardin will not be recommended.

Enrichment, Amplification, and Sequence-Based Typing of Salmonella enterica and Other Foodborne Pathogens

Detection of Salmonella enterica in foods typically involves microbiological enrichment, molecular-based assay, and subsequent isolation and identification of a pure culture. This is ideally followed by strain typing, which provides information critical to the investigation of outbreaks and the attribution of their sources. Pulsed-field gel electrophoresis is the "gold standard" for S. enterica strain typing, but its limitations have encouraged the search for alternative methods, including whole genome sequencing. Both methods typically require a pure culture, which adds to the cost and turnaround time. A more rapid and cost-effective method with sufficient discriminatory power would benefit food industries, regulatory agencies, and public health laboratories. To address this need, a novel enrichment, amplification, and sequence-based typing (EAST) approach was developed involving (i) overnight enrichment and total DNA preparation, (ii) amplification of polymorphic tandem repeat-containing loci with electrophoretic detection, and (iii) DNA sequencing and bioinformatic analysis to identify related strains. EAST requires 3 days or less and provides a strain resolution that exceeds serotyping and is comparable to pulsed-field gel electrophoresis. Evaluation with spiked ground turkey demonstrated its sensitivity (with a starting inoculum of ≤1 CFU/g) and specificity (with unique or nearly unique alleles relative to databases of >1,000 strains). In tests with unspiked retail chicken parts, 3 of 11 samples yielded S. enterica -specific PCR products. Sequence analysis of three distinct typing targets (SeMT1, SeCRISPR1, and SeCRISPR2) revealed consistent similarities to specific serotype Schwarzengrund, Montevideo, and Typhimurium strains. EAST provides a time-saving and cost-effective approach for detecting and typing foodborne S. enterica , and postenrichment steps can be commercially outsourced to facilitate its implementation. Initial studies with Listeria monocytogenes and Shiga toxigenic Escherichia coli suggest that EAST can be extended to these foodborne pathogens.

Specific PCR Identification between Peucedanum praeruptorum and Angelica decursiva and Identification between Them and Adulterant Using DNA Barcode.

Background:The traditional Chinese medicine (TCM) Qianhu and Zihuaqianhu are the dried roots of Peucedanum praeruptorum and Angelica decursiva, respectively. Since the plant sources of Qianhu and Zihuaqianhu are more complex, the chemical compositions of P. praeruptorum and A. decursiva are significantly different, and many adulterants exist because of the differences in traditional understanding and medication habits. Therefore, the rapid and accurate identification methods are required.Objective:The aim was to study the feasibility of using DNA barcoding to distinguish between Traditional Chinese medicine Qianhu (Peucedanum praeruptorum), Zihuaqianhu (Angelica decursiva), and common adulterants, based on internal transcribed spacer (ITS) sequences, as well as specific PCR identification between P. praeruptorum and A. decursiva.Materials and Methods:The ITS sequences of P. praeruptorum, A. decursiva, and adulterant were studied, and a phylogenetic tree was constructed. Based on the ITS barcode, the specific PCR primer pairs QH-CP19s/QH-CP19a and ZHQH-CP3s/ZHQH-CP3a were designed for P. praeruptorum and A. decursiva, respectively. The amplification conditions were optimized, and specific PCR products were obtained.Results:The results showed that the phylogenetic trees constructed using the BI and MP methods were consistent, and P. praeruptorum and A. decursiva sequence haplotypes formed their own monophyly. The experimental results showed that in PCR products, the target bands appeared in the genuine drug and not in the adulterant, which suggests the high specificity of the two primer pairs.Conclusion:The ITS sequence was ideal DNA barcode to identify P. praeruptorum, A. decursiva, and adulterant. The specific PCR is a quick and effective method to distinguish between P. praeruptorum and A. decursiva.SUMMARY Peucedanum praeruptorum and Angelica decursiva sequence haplotypes formed their own monophyly.The ITS sequence was ideal DNA barcode to identify P. praeruptorum, A. decursiva, and adulterant.Specific PCR is a quick and effective method to distinguish between P. praeruptorum and A. decursiva. Abbreviations used: TCM: The traditional Chinese medicine, P.: Peucedanum, A.: Angelica, ITS: The internal transcribed spacer, PCR: Polymerase chain reaction, NCBI: National Center for Biotechnology Information, NI: Number of individuals, HN: Haplotype number; GAN: Gen Bank accession numbers, L.: Ligusticum, O.: Ostericum, A.: Angelica, P.: Pimpinella, BI: Bayesian inference, MP: Maximum parsimony, AIC: Akaike Information Criterion, MCMC: Markov Chains Monte Carlo, TBR: Tree bisection-reconnection, LPP: Length of PCR product, PRP: PCR reaction procedure, SNP: Single nucleotide polymorphisms, PP: Posterior probability, BS: Bootstrap.Qun Zhao

Coat protein and movement protein based characterization of Lima bean yellow mosaic virus disease in Karnataka (India)

Yellow mosaic disease caused by a Begomovirus has become an important production constraint in lima bean cultivation in Karnataka. The begomovirus causes Lima bean Yellow Mosaic Virus (LYMV), was characterized by sequencing the CP and MP genes. Distinct viral gene specific PCR product corresponding to CP and MP gene ~1000 bp and ~900 bp was obtained. The PCR product were sequenced and compared with the reference Begomoviruses sequences from the NCBI blast database. LYMV (GKVK isolate) shared highest nucleotide identity (98%) with Horsegram yellow mosaic virus (HgYMV) of French bean isolate (Accession No. AM932425.1). Phylogenetic analysis of CP and MP gene sequences of LYMV-GKVK isolate showed that LYMV-GKVK clustered with isolates of HgYMV Horsegram and French bean isolates of Tamil Nadu, Srilanka, Karnataka. Based on Nucleotide Identity begomovirus infecting lima bean at Bangalore is to be considered as strain of HgYMV. The disease was also successfully transmitted to French bean and Horsegram when experimentally transmitted using whitefly vector. Therefore, the begomovirus causing yellow mosaic disease of lima bean is considered as strain of HgYMV. Lima bean is infected by Mungbean Yellow Mosaic India Virus (MYMIV) according to earlier reports whereas our study the reports the infection of HgYMV on Lima bean from Karnataka. Thus it is concluded that Lima bean is infected by both MYMIV and HgYMV in different geographical locations.

Development of a Detection System for Epigenetic Modifications By Enzyme Fused Zinc Finger Protein

INTRODUCTION Epigenetic modifications such as DNA methylation and histone modifications play an important role in gene regulation. Recently, it has been reported that aberrant modifications are related to diseases such as cancer. Therefore, these modifications are regarded as new biomarkers (1). To detect these modifications, usually, quantitative polymerase chain reaction (qPCR) is performed after protein-based precipitation. qPCR is a powerful and simple method to quantify DNA, but this method is not able to distinguish between specific PCR products and nonspecific products. Therefore, to utilize these modifications as a biomarker, more accurate detection method is required. To achieve that, we focused on zinc finger protein (ZF), a well-known DNA binding protein, because it can bind to double stranded DNA with sequence specifically. In addition, to detect DNA methylation level, we have to treat DNA with bisulfite and perform sequencing. Although this method is a standard method to detect the level, it is time consuming and laborious. To detect the level more simply and rapidly, we focused on Methyl CpG-binding domain (MBD). Using MBD, we can separate methylated DNA without bisulfite treatment in shorter time period. Thus we report simple and rapid detection system for epigenetic modifications using ZF and MBD (2,3). METHOD 0. Design of detection system using enzyme fused ZF Our detection method comprises following three steps:1. Methyl CpG-binding domain (MBD) or histone modification antibodies based DNA collection, 2. PCR amplification of the target genomic region, which includes a zinc finger recognition site and 3. Detection of the PCR products by enzyme fused zinc finger protein (Fig.). As reporter enzymes, we chose luciferase and glucose dehydrogenase. We constructed a homogenous detection system combining Bioluminescence Resonance Energy Transfer (BRET) with luciferase fused zinc finger protein (ZF-Luc). We also constructed a simple electrochemical detection system using glucose dehydrogenase fused zinc finger protein (ZF-GDH). 1. Electrochemical detection of DNA methylation using ZF-GDH We detected DNA methylation levels in androgen receptor (AR) promoter regions of human genomic DNA using ZF-GDH. First, we checked genomic DNA copy number dependency. We used highly methylated genomic DNA (Du145) and lowly methylated genomic DNA (LNCaP). These genomic DNA was purified and diluted to certain copy numbers (102 to 106copies), and detected. Next, we tried to detect methylation level in 106copies of genomic DNA. Genomic DNA from LNCaP, Du145, PC3 and TSU-PR1 cells were analyzed and we compared with the results obtained by a conventional method: bisulfite sequencing. 2. Homogeneous detection of histone modifications using ZF-Luc For detection of histone modification, we targeted H3K4me3 at GAPDH promoter region using ZF-Luc. This promoter region is reportedly associated with H3K4me3 in HeLa cells. We then analyzed histone modifications at the AR promoter region. The ARpromoter region is reportedly hypermethylated in Du145 cells and hypomethylated in LNCaP cells. RESULTS AND DISCUSSION 1. As we expected, copy number dependent signal increase was observed only when we detected highly methylated DNA. This result means that we can detect methylated DNA specifically. The methylation level detected by our method was correlated with the result obtained by the conventional method. This shows that the methylation levels of target genomic regions can be correctly determined without bisulfite treatment and sequencing. Importantly we could detect methylation level in 106copies of genomic DNA because it is enough sensitive for a real diagnositics. 2. As the result of histone modifications detection at GAPDH, we detected high luciferase activity from the H3K4me3 sample but not the H3K9me3 sample. Also for ARregion, indeed, we detected high luciferase activity from the s3 sample for Du145 cells and the H3K4me3 sample for LNCaP cells. These results are correlated with reported results and demonstrate that histone modifications were correctly detected by our homogeneous detection method. CONCLUSION We developed a detection system for DNA methylation and histone modification using enzyme fused zinc finger proteins and demonstrated that the DNA methylation levels and histone modification levels can be determined by this system. We believe that DNA methylation levels and histone modification levels can be detected simultaneously by our system and it would be a useful system for the diagnosis of diseases that have a significant impact on human health. REFERENCES 1. Gal-Yam, E. N.; Saito, Y.; Egger, G.; Jones, P. A., (2008), Annu. Rev. Med. 59, 267−280. 2. Hiraoka, D., Yoshida, W., Abe, K., Wakeda, H., Hata, K., & Ikebukuro, K. (2012). Anal. Chem., 84(19) 3. Yoshida, W., Kezuka, A., Abe, K., Wakeda, H., Nakabayashi, K., Hata, K., & Ikebukuro, K. (2013). Anal. Chem., 85(13) Figure 1