Species-specific Polymerase Chain Reaction Research Articles

Genetic Polymorphisms of Pfcrt K76T and Pfmdr1 N86Y among Asymptomatic School Children in Forest Communities of Ekondo Titi Subdivision along the Cameroon-Nigeria Border Area

Aims: The study sought to quantify Plasmodium infection and molecular markers for chloroquine resistance among asymptomatic school children.
 Study Design: The study was cross-sectional.
 Place and Duration of Study: The study was carried out in Ekondo Titi Subdivision near Cameroon's south-western border with Nigeria from March to May and from September to October 2014.
 Methodology: The prevalence of human Plasmodium species was determined by nested PCR (Polymerase Chain Reaction) using DNA from dried blood spot in six primary schools. A PCR/RFLP analysis (Restriction Fragment Length Polymorphism) was used to determine the prevalence of chloroquine resistance (CQR) associated pfcrt 76T and pfmdr 1 56Y point mutations in Plasmodium falciparum asymptomatic school children.
 Results: A nested PCR amplifying the 18S small-subunit ribosomal RNA (SSU rRNA) gene of Plasmodium in 205 samples confirmed 76.1% of the isolates as asymptomatic P. falciparum infections, with a substantial proportion 22% of P. malariae infection. Among these, 3.6% were single P. malariae infections and 15.1% were P. falciparum and P. malariae mixed infections. Mixed P. falciparum and P. ovale infections were 2.0%. Of the 156 Plasmodium falciparum, positive samples by species-specific PCR, 107 samples with P. falciparum mono-infection were analyzed for the presence of drug resistant alleles pfcrt 76T and pfmdr1- Y 86. The prevalence of pfcrt 76T mutation (74.6%) was higher than that of the pfmdr1-Y86 mutation (25.4%). Logistic regression analysis of socio-demographic factors predicted no significant association between pfcrt 76T mutation with gender and communities.
 Conclusions: The results indicated a high prevalence of P. malariae and mixed infection in the area under study. The high-level distribution of the pfcrtT76 observed in the study could be possibly attributed to the fact that CQ remained widely used at the community level more than 14 years after withdrawal.

Molecular identification of Ditylenchus destructor nematode with PCR Species-Specific primers in the Moscow region

Potato ( Solanum tuberosum L.) is one of the most vital food and industrial crop and Ditylenchus destructor is an influential pathogenic potato nematode and is quarantine pest in many states and territories. As a result, the polymerase chain reaction (PCR) protocol was optimized to identify Ditylenchus destructor reliably and rapidly. The species-specific internal transcribed spacer (ITS) was used as the primer of the D. destructor ribosomal DNA gene. Some populations of this species from the Moscow region in the Russian Federation were investigated through species-specific primer PCR. New sequence from ITS-rRNA was deposited in the GenBank under accession number MN122076. The current molecular technique is more appropriate to distinguishing of nematode species, since it is practical, fast and precise.

Development of Species-Specific PCR Primers for the Rapid and Simultaneous Identification of the Six Species of Genus Takifugu.

ABSTRACTPufferfish (Takifugu spp.) are economically important edible marine fish. Mistakes in pufferfish classification can lead to poisoning; therefore, accurate species identification is critical. In this study, we used the mtDNA cytochrome c oxidase subunit I gene (COI) to design specific primers for six Takifugu species among the 21 domestic or imported pufferfish species legally sold for consumption in Korea. We rapidly and simultaneously identified these pufferfish species using a highly efficient, multiplex polymerase chain reaction (PCR) system with the six species-specific primers. The results showed that species-specific multiplex PCR (multiplex species-specific polymerase chain reaction; MSS-PCR) either specifically amplified PCR products of a unique size or failed. MSS-PCR yielded amplification fragment lengths of 897 bp for Takifugu pardalis, 822 bp for T. porphyreus, 667 bp for T. niphobles, 454 bp for T. poecilonotus, 366 bp for T. rubripes, and 230 bp for T. xanthpterus using the species-specific primers and a control primer (ca. 1,200 bp). We visualized the results using agarose gel electrophoresis to obtain accurate contrasts of the six Takifugu species. MSS-PCR analysis is easily performed and provides identification results within 6 h. This technique is a powerful tool for the discrimination of Takifugu species and will help prevent falsified labeling, protect consumer rights, and reduce the risk of pufferfish poisoning..

Malassezia species dysbiosis in natural and allergen-induced atopic dermatitis in dogs.

Malassezia dermatitis and otitis are recurrent features of canine atopic dermatitis, increasing the cost of care, and contributing to a reduced quality of life for the pet. The exact pathogenesis of secondary yeast infections in allergic dogs remains unclear, but some have proposed an overgrowth of M. pachydermatis to be one of the flare factors. The distribution of Malassezia populations on healthy and allergic canine skin has not been previously investigated using culture-independent methods. Skin swabs were collected from healthy, naturally affected allergic, and experimentally sensitized atopic dogs. From the extracted DNA, fungal next-generations sequencing (NGS) targeting the ITS region with phylogenetic analysis of sequences for species level classification, and Malassezia species-specific quantitative real-time polymerase chain reaction (qPCR) were performed. M. globosa was significantly more abundant on healthy canine skin by both methods (NGS P<.0001, qPCR P<.0001). M. restricta was significantly more abundant on healthy skin by NGS (P=.0023), and M. pachydermatis was significantly more abundant on naturally-affected allergic skin by NGS (P<.0001) and on allergen-induced atopic skin lesions by qPCR (P=.0015). Shifts in Malassezia populations were not observed in correlation with the development of allergen-induced skin lesions. Differences in the lipid dependency of predominant Malassezia commensals between groups suggests a role of the skin lipid content in driving community composition and raises questions of whether targeting skin lipids with therapeutics could promote healthy Malassezia populations on canine skin.

2612. Molecular Evidence of Ureaplasma urealyticum and Ureaplasma parvum Colonization in Preterm Infants with Respiratory Distress

Background Ureaplasma urealyticum and Ureaplasma parvum have been associated with respiratory diseases in premature newborns, but their role in the pathogenesis of the respiratory distress syndrome (RDS) is unclear. The present study was conducted to investigate preterm newborns with respiratory distress for colonization of U. urealyticum and U. parvum in endotracheal fluid (TF)/nasopharyngeal aspirates (NPA) specimens employing culture and polymerase chain reaction (PCR).MethodsSixty preterm infants, presenting with respiratory distress persisting for more than 24 hours were investigated. Endotracheal fluid or nasopharyngeal aspirates specimens were inoculated in 2mL Ureaplasma broth and Ureaplasma agar for culture identification assay and PCR. DNA extracts were processed for a genus specific PCR (429 base pair region) on urease gene of U. urealyticum/U. parvum and species specific PCR (1305 base pair region) on 16S rRNA gene in U. parvum.Results Ureaplasma species colonization was positive in 11 (61.11%) male patients and7 (38.89%) females but there was no statistical association between sex and Ureaplasmaspecies colonization (P = 0.771). Ureaplasma spp. culture identification assay was positive in 7 (11.67%).Ureaplasma genus specific PCR was positive in 14 (23.33%) cases; species specific PCR in 9 (64.28%) infants were identified as U. parvum. Considering culture as diagnostic standard, sensitivity of PCR was 42.86%; specificity 79.24%; positive predictive value 21.43% and negative predictive value 91.30 %; with overall percentage agreement at 75%. Septicemia was positive in 12 (66.67%) infants colonized with Ureaplasmaspecies than in 5 (11.9%) of non colonized infants which was found to be significant (P = 0.00). Twelve (66.67%) patients with Ureaplasmaspecies colonization had lethargy with statistically significant association(P = 0.04).ConclusionThis study confirms that Ureaplasma species and particularly U. parvum colonization in preterm infants was related to respiratory distress.Disclosures All authors: No reported disclosures.

Development of a species-specific polymerase chain reaction for highly sensitive detection of Flavobacterium columnare targeting chondroitin AC lyase gene

Columnaris disease, caused by Flavobacterium columnare, is an acute infection of gills and fins, that exists worldwide and causes remarkable losses in freshwater fish. The 16S rRNA gene is not a good candidate for primer design, since this gene has high identity among species in the same genus. In the present study, we developed a species-specific PCR for detection of Flavobacterium columnare based on the chondroitin AC lyase (cslA) gene. The cslA gene sequence from 13 F. columnare strains were aligned to design a specific primer set, Fcol-F and Fcol-R, based on conserved region of the gene. The new primer set produced a specific amplicon of 287 bp from 83 isolates of F. columnare but not from related or other bacterial pathogens. The PCR was sensitive and detected up to 3 pg of genomic DNA and as few as 7 colony-forming units of bacteria. The sensitivity was decreased tenfold when F. columnare gDNA was spiked into tissue samples. The designed primers precisely amplified F. columnare from skin and gills of infected fish, but not in those of clinically healthy fish, reflecting their possible use for diagnostic purposes.

Diversities of &lt;i&gt;Anopheles gambiae ss&lt;/i&gt; and &lt;i&gt;Plasmodium falciparum&lt;/i&gt; in Minna, Nigeria

Genetic diversities of Anopheles gambiae ss and Plasmodium falciparum is a major challenge in malaria control as it affects the vector, treatment and production of a vaccine. The aim of the study is to identify the genetic variabilities of A. gambiae ss using the A. gambiae species-specific multiplex Polymerase Chain Reaction (PCR) and P. falciparum using merozoite surface protein (msp2) as antigenic marker. Results revealed that the A. gambiaes ss identified were of the M-forms and the two families of msp-2, FC27 and 3D7 were observed among the isolates of P. falciparum. Eleven (11) number of genotypes were recorded with FC27 having the highest frequency of 8(26.67%) while 3D7 had the least number of genotypes encountered with 3(10%). The allelic frequency of FC27 type was higher 29(96.67%) than 3D7 alleles with 26 (86.67%). There is no significant difference found in the distribution of FC27 alleles and 3D7 alleles in the study populations (p&gt;0.05). The observed population genetics of A. gambiae ss and P. falciparum is likely to be a consequence of the high transmission intensity. This has important implications for malaria control strategies and vaccine production.Keywords: Genetic veriabilities; malaria control strategy.

Gardnerella vaginalis Clade Distribution Is Associated With Behavioral Practices and Nugent Score in Women Who Have Sex With Women.

Gardnerella vaginalis is detected in women with and without bacterial vaginosis (BV). Identification of 4 G. vaginalis clades raised the possibility that pathogenic and commensal clades exist. We investigated the association of behavioral practices and Nugent Score with G. vaginalis clade distribution in women who have sex with women (WSW). Longitudinal self-collected vaginal specimens were analyzed using established G. vaginalis species-specific and clade-typing polymerase chain reaction assays. Logistic regression assessed factors associated with detection of G. vaginalis clades, and multinomial regression assessed factors associated with number of clades. Clades 1, 2, and 3 and multiclade communities (<2 clades) were associated with Nugent-BV. Clade 1 (odds ratio [OR], 3.36; 95% confidence interval [CI], 1.65-6.84) and multiclade communities (relative risk ratio [RRR], 9.51; 95% CI, 4.36-20.73) were also associated with Lactobacillus-deficient vaginal microbiota. Clade 4 was neither associated with Nugent-BV nor Lactobacillus-deficient microbiota (OR, 1.49; 95% CI, 0.67-3.33). Specific clades were associated with differing behavioral practices. Clade 1 was associated with increasing number of recent sexual partners and smoking, whereas clade 2 was associated with penile-vaginal sex and sharing of sex toys with female partners. Our results suggest that G. vaginalis clades have varying levels of pathogenicity in WSW, with acquisition occurring through sexual activity. These findings suggest that partner treatment may be an appropriate strategy to improve BV cure.

Pediatric Bacterial Meningitis Surveillance in Nigeria From 2010 to 2016, Prior to and During the Phased Introduction of the 10-Valent Pneumococcal Conjugate Vaccine.

BackgroundHistorically, Nigeria has experienced large bacterial meningitis outbreaks with high mortality in children. Streptococcus pneumoniae (pneumococcus), Neisseria meningitidis (meningococcus), and Haemophilus influenzae are major causes of this invasive disease. In collaboration with the World Health Organization, we conducted longitudinal surveillance in sentinel hospitals within Nigeria to establish the burden of pediatric bacterial meningitis (PBM).MethodsFrom 2010 to 2016, cerebrospinal fluid was collected from children <5 years of age, admitted to 5 sentinel hospitals in 5 Nigerian states. Microbiological and latex agglutination techniques were performed to detect the presence of pneumococcus, meningococcus, and H. influenzae. Species-specific polymerase chain reaction and serotyping/grouping were conducted to determine specific causative agents of PBM.ResultsA total of 5134 children with suspected meningitis were enrolled at the participating hospitals; of these 153 (2.9%) were confirmed PBM cases. The mortality rate for those infected was 15.0% (23/153). The dominant pathogen was pneumococcus (46.4%: 71/153) followed by meningococcus (34.6%: 53/153) and H. influenzae (19.0%: 29/153). Nearly half the pneumococcal meningitis cases successfully serotyped (46.4%: 13/28) were caused by serotypes that are included in the 10-valent pneumococcal conjugate vaccine. The most prevalent meningococcal and H. influenzae strains were serogroup W and serotype b, respectively.ConclusionsVaccine-type bacterial meningitis continues to be common among children <5 years in Nigeria. Challenges with vaccine introduction and coverage may explain some of these finding. Continued surveillance is needed to determine the distribution of serotypes/groups of meningeal pathogens across Nigeria and help inform and sustain vaccination policies in the country.

Etiology of Pediatric Bacterial Meningitis Pre- and Post-PCV13 Introduction Among Children Under 5 Years Old in Lomé, Togo

BackgroundPediatric bacterial meningitis (PBM) causes severe morbidity and mortality within Togo. Thus, as a member of the World Health Organization coordinated Invasive Bacterial Vaccine Preventable Diseases network, Togo conducts surveillance targeting Streptococcus pneumoniae (pneumococcus), Neisseria meningitidis (meningococcus), and Haemophilus influenzae, at a sentinel hospital within the capital city, Lomé, in the southernmost Maritime region.MethodsCerebrospinal fluid was collected from children <5 years with suspected PBM admitted to the Sylvanus Olympio Teaching Hospital. Phenotypic detection of pneumococcus, meningococcus, and H. influenzae was confirmed through microbiological techniques. Samples were shipped to the Regional Reference Laboratory to corroborate results by species-specific polymerase chain reaction.ResultsOverall, 3644 suspected PBM cases were reported, and 98 cases (2.7%: 98/3644) were confirmed bacterial meningitis. Pneumococcus was responsible for most infections (67.3%: 66/98), followed by H. influenzae (23.5%: 23/98) and meningococcus (9.2%: 9/98). The number of pneumococcal meningitis cases decreased by 88.1% (52/59) postvaccine introduction with 59 cases from July 2010 to June 2014 and 7 cases from July 2014 to June 2016. However, 5 cases caused by nonvaccine serotypes were observed. Fewer PBM cases caused by vaccine serotypes were observed in infants <1 year compared to children 2–5 years.ConclusionsRoutine surveillance showed that PCV13 vaccination is effective in preventing pneumococcal meningitis among children <5 years of age in the Maritime region. This complements the MenAfriVac vaccination against meningococcal serogroup A to prevent meningitis outbreaks in the northern region of Togo. Continued surveillance is vital for estimating the prevalence of PBM, determining vaccine impact, and anticipating epidemics in Togo.

Two for the price of one: Co-infection with Rickettsia bellii and spotted fever group Rickettsia in Amblyomma (Acari: Ixodidae) ticks recovered from wild birds in Brazil

The bacterium Rickettsia bellii has been detected in 25 species of ticks in the American continents, but its pathogenic potential is considered as undetermined. A possible role for this species in the phenomenon of transovarial exclusion of pathogenic members of the spotted fever group (SFG) of Rickettsia has been suggested and co-infections with pathogenic species have been reported infrequently in both North and South America. Traditional methods for the molecular detection of rickettsial agents in ticks focus largely on the identification of sequences found in SFG Rickettsia, an approach that may overlook the presence of co-infections with R. bellii. Two novel, species-specific polymerase chain reaction (PCR) assays, targeting the genes encoding the surface cell antigen (Sca), autotransporter proteins sca9 and sca14, were developed and validated for the detection of R. bellii using 150 Amblyomma ticks collected from wild birds in Brazil. Co-infection of R. bellii infected ticks was evaluated using a novel PCR assay targeting the ompA sequence characteristic of SFG Rickettsia. Preliminary species-level identification was achieved by restriction fragment length polymorphism (RFLP) analysis and subsequently confirmed by sequencing of amplicons. Nine out of seventy-three Amblyomma longirostre and one of two Amblyomma calcaratum ticks were shown to be co-infected with R. bellii and Rickettsia amblyommatis, while two out of sixty-seven Amblyomma sp. haplotype Nazaré ticks were recorded as co-infected with R. bellii and the Rickettsia parkeri-like bacterium, strain ApPR. Interestingly, our data represent the first records of R. bellii in association with A. calcaratum and Amblyomma sp. haplotype Nazaré. The novel PCR-RFLP systems reported herein, provide an alternative, rapid and cost-efficient (relative to strategies based on sequencing or real-time PCR), approach to evaluate rickettsial co-infection of ticks, a potentially significant phenomenon that has most likely been underestimated to date.

Characterization and identification of ferulic acid esterase‐producing Lactobacillus species isolated from Elymus nutans silage and their application in ensiled alfalfa

Ferulic acid esterase (FAE)-producing Lactobacillus species isolated from ensiled Elymus nutans growing on the Qinghai-Tibetan plateau were characterized, and effects of their application to the alfalfa ensiling process and the evidence to synergic effect between cellulase and FAE were investigated. The results of 16S rRNA gene sequence and species-specific polymerase chain reaction amplification showed that two screened strains with high FAE activity were Lactobacillus plantarum A1 (LP) and L. brevis A3 (LBr). The optimum temperature and pH for the LP and LBr was 37°C and 6·4 respectively. The FAE exhibited a good stability at temperatures between 25 and 50°C and at pH values of 5·0-7·0. The two strains and a commercial cellulase (CE) were applied as additives to alfalfa silage. After 60days of ensiling, the lactic acid in the control and CE groups were significantly lower than those of the other treatment groups. The neutral detergent fibre and acid detergent fibre contents in the LP group were significantly lower than those observed in the other groups. At the same time, the combination of CE and FAE-producing lactic acid bacteria synergistically improved the fermentation quality of the silage. The addition of the FAE-producing strain of L. plantarum A1 to alfalfa silage improved its fermentation quality, and reduced the fibre content of the silage. The screened homo-fermentative and FAE-producing strain of L. plantarum A1 could be a candidate strain in improving fermentation quality and fibre digestibility of ensiled forages.

Non-biogroup 1 or 2 Strains of the Emerging Zoonotic Pathogen Escherichia albertii, Their Proposed Assignment to Biogroup 3, and Their Commonly Detected Characteristics.

Escherichia albertii, a zoonotic enteropathogen, is responsible for outbreaks of disease in humans. Identifying strains of E. albertii by phenotypic characterization tests is difficult because of its poorly defined properties. Screening its phenotypic characteristics is, nevertheless, a necessary prerequisite for further genetic analysis of its properties, and species-specific polymerase chain reaction (PCR) analysis can be used to type the pathogen. While two E. albertii biogroups (1 and 2) have been described, strains with characteristics divergent from both biogroups have been reported worldwide. The aim of the present study was to evaluate the characteristics of non-biogroup 1 or 2 strains, and discern the characteristics common to all of the E. albertii strains from this study. Altogether, 107/414 field isolates were selected for examination based on pulsed-field gel electrophoresis analysis. The 107 strains were isolated from 92 sources, including humans and pigeon feces, other wild birds, and retail chicken livers. All strains were then examined using various culture-based, biochemical (API 50CHE tests, API Zym test, and others) and molecular (virulence gene screening, multi-locus sequence analysis) testing methods. Our results revealed that all field strains (n = 107) showed non-biogroup 1 or 2 characteristics, with multiple sequence differences. Variations in indole production and the lysine decarboxylase activity profiles among the isolates made identification of E. albertii very difficult. Therefore, we propose that non-biogroup 1 or 2 of E. albertii should be assigned to biogroup 3 to make screening of them easier in public health and clinical laboratory settings. Clearly, having group criteria for indole-negative/lysine-positive, indole-positive/lysine-negative, and indole-positive/lysine-positive E. albertii biogroups 1, 2, and 3 strains, respectively, should provide for more accurate identification of E. albertii isolates. Based on our findings, we recommend that isolates displaying phenotype mobility-negativity (sulfide-indole-motility medium, 37°C), hydrogen sulfide production-negativity (triple sugar iron medium), acid production-negativity from xylose, negative β-glucuronidase activity properties, and showing indole production and lysine decarboxylase activity profiles in accordance with one of the three biogroups, should be further assessed using an E. albertii-specific PCR assay.

Malaria Prevalence in a Low Transmission Area, Jazan District of Southwestern Saudi Arabia.

Detailed description of malaria in low transmission areas is crucial for elimination. The current study aimed to provide a comprehensive description for malaria transmission in Jazan, a low transmission district, southwestern Saudi Arabia. Patients at a tertiary care hospital were recruited in our study between August 2016 and September 2018. Malaria diagnosis was performed through a species-specific nested polymerase chain reaction (nested PCR), microscopy and Paramax-3TM rapid detection test (RDT). Malaria was detected in 30 patients by the PCR, with point prevalence of 10.9%. Of these malaria infections, 80% was imported, 26.6% was asymptomatic and 23.3% was sub-microscopic. Malaria was reported throughout the year, with February/March and September/October peaks. Infection was significantly more in males than in females (P=0.01). Likewise, infections were detected more in febrile than in non-febrile patients (P=0.01). Adult aged 15–24 years, fever and travel were identified as high-risk factors. Malaria was primarily attributed to Plasmodium falciparum mono-infections, followed by P. vivax mono-infections and lastly to falciparum/vivax mixed infections accounting 76.6%, 16.6%, and 6.6% of PCR-confirmed malaria cases, respectively. The nested PCR was superior to the smear microscopy (sensitivity 76.6%; specificity 100%) and the RDT (sensitivity 83.3%, specificity 94.2%). The overall percent agreement between microscopy and the RDT was 92.7% (kappa=0.63). High proportion of imported malaria including sub-microscopic and sub-patent cases were described. We suggest that incorporation of molecular tool into the conventional malaria diagnosis is beneficial in Jazan district.

Authentication of Shan-Dou-Gen Based on DNA Analysis

Shan-Dou-Gen (山豆根) is a crude drug mainly derived from the roots of Leguminosae plants, and it has antipyretic, antidotal, anti-inflammatory, and analgesic effects. In Japan, the root of Euchresta japonica has been used as a material of Shan-Dou-Gen. However, E. japonica is not used for medicinal purposes today, and commercial Shan-Dou-Gen products are imported from China. In China, several plant species have been used as Shan-Dou-Gen materials, but a crude drug derived from the root of Sophora tonkinensis is now officially used as Shan-Dou-Gen. However, it is difficult to morphologically identify the species used in Shan-Dou-Gen. In the present study, we showed that the Shan-Dou-Gen products commercially available in Japan are derived from S. tonkinensis using phylogenetic and sequencing analyses of the chloroplast trnH–psbA region. Furthermore, we performed species-specific polymerase chain reaction using conserved sequences of S. tonkinensis. Amplification was observed with Shan-Dou-Gen, whereas no amplification occurred with other crude drugs derived from the roots of S. flavescens and S. japonica. These results indicated that the genetic approach can be useful to authenticate Shan-Dou-Gen.

Species-specific PCR assays for Gambierdiscus excentricus and Gambierdiscus silvae (Gonyaulacales, Dinophyceae).

The two most toxic Gambierdiscus species identified from the Caribbean are G.excentricus and G.silvae. These species are the primary causes of ciguatera fish poisoning and likely contribute disproportionately to the toxicity of marine food webs. While Gambierdiscus species are difficult to distinguish using light or scanning electron microscopy, reliable species-specific molecular identification methods have been developed and used successfully to identify a number of other Gambierdiscus species. Corresponding species-specific assays are not yet available for G.excentricus and G.silvae, which imposes limitations on species identification and related ecological studies. The following note describes species-specific polymerase chain reaction assays for G.excentricus and G.silvae that can be used for these purposes.

Potential for Seed Transmission of Verticillium longisporum in Oilseed Rape (Brassica napus).

Verticillium longisporum is a soilborne vascular fungal pathogen that has spread throughout the European oilseed rape cultivation area since the 1980s and was detected in canola fields in Canada in 2014. In a series of greenhouse and field inoculation experiments using V. longisporum-resistant and susceptible cultivars of winter and spring types of oilseed rape, the present study investigated the potential of V. longisporum dissemination by seeds of Brassica napus. Greenhouse inoculation studies with a DsRed-labeled isolate of V. longisporum confirmed the systemic growth of the pathogen from roots to seeds. Further monitoring of plant colonization in the greenhouse with a species-specific real-time polymerase chain reaction assay verified the pathogen growth from roots to stem bases, pods, and seeds in root-inoculated plants. The frequency of recovery of viable colonies of V. longisporum from seeds harvested from greenhouse-grown inoculated plants ranged from 0.08 to 13.3%. The frequency of seed transmission in the greenhouse differed in oilseed rape cultivars varying in susceptibility to V. longisporum. Subsequent studies on transmission of the disease into the offspring revealed that only 1.7 to 2.3% of plants showed disease symptoms as confirmed by the formation of microsclerotia in the stems. Results from field-grown plants differed from the greenhouse studies. The degree of seed transmission in the field was dependent on the crop type. Although only low concentrations of DNA of V. longisporum were detectable in seeds harvested from severely infected winter oilseed rape, significantly greater concentrations of fungal DNA were found in seeds of spring-type oilseed rape, at similar soil conditions and inoculum densities. Correspondingly, plating seeds that were harvested from infected plants on agar yielded viable V. longisporum colonies only from seeds of the spring-type but not of the winter-type plants. Lack of seed infection in the winter-type crop was confirmed in two seasons. Equally, none of the offspring grown from seeds from severely diseased winter oilseed rape plants developed symptoms of Verticillium stem striping. The results suggest that the rate of seed transmission of V. longisporum depends on the degree of plant colonization, which is significantly faster under greenhouse than field conditions and in a spring-sown crop compared with an autumn-sown oilseed rape crop. According to our studies, disease transmission by seeds from European winter oilseed rape production cannot be confirmed.

Molecular identification and pathogenicity of Ralstonia solanacearum isolates collected from north west of Pakistan

In the tomato commercial growing districts of Khyber Pakhtunkhwa (KP); a province in the north west of Pakistan, multiple comprehensive surveys were conducted during 2012. The main objectives of the current study were to identify the Ralstonia solanacearum (R. solanacearum) isolate through its colony characteristics, molecular tools; and to investigate the ability of this pathogen to cause Bacterial wilt (BW) disease, when being inoculated into tomato plant using different inoculation methods. For this purpose, a total of 74 locations covering all over the KP were visited for the presence of tomato plants with BW disease, caused by R. solanacearum. The bacterial pathogen was isolated from diseased plant tissues by growing it on the selective 2,3,5-triphenyl-tetrazolium chloride (TTC) medium. Based on colony morphology of R. solanacearum on the agar plates; and pathogenicity assays, about 29 isolates were guessed to be R. solanacearum. To further confirm the identity of these isolates, a species-specific primers-mediated Polymerase chain reaction (PCR) was carried out. Two specific primers i.e. forward primer: 5'GTCGCCGTCAACTCACTTTCC3', and reverse primer: 5'GTCGCCGTAGCAATGCGGAATCG3', were used for amplification of the 281bp band. Twenty five isolates out of the 29 were genetically confirmed to be R. solanacearum based on their amplified 281bp band.

Analysis of archive samples of spring and winter barley support an increase in individual Fusarium species in Bavarian barley grain over the last decades

A broad range of different Fusarium (F.) species is associated with Fusarium head blight (FHB) on barley and the corresponding negative effects in downstream processing of barley grain in food and feed production. Previous studies highlight the significance of the wheat-relevant and well-studied species F. graminearum as well as less prominent species including F. culmorum, F. avenaceum, F. tricinctum, F. langsethiae, F. sporotrichioides, F. poae, and others. In this context, prevalent climate and cultivation conditions were shown to determine disease severity as well as dominance of certain species within the Fusarium pathogen complex. To gain further insight into possible historic developments of FHB, the annual occurrence of currently relevant Fusarium species was analyzed in Bavarian archive samples of winter (from 1958 to 2010) and spring barley (from 1965 to 2010) using species-specific quantitative polymerase chain reaction. Although DNA contents varied between samples of individual years, data suggest a general increase in Fusarium incidence, particularly in spring barley. Comparing pathogen complexes, we observed not only continuous dominance of F. graminearum in winter barley, but also an increasing relevance of this species in spring barley. The rising Fusarium incidence over time generally coincides with climate change related factors like increasing temperatures. However, it may furthermore be linked to changing cultivation methods and intensified maize production. This study therefore exhibits the dynamic complexity of barley grain contamination with Fusarium spp., which should be taken into account for future disease management.

Prevalence and Genotyping of Microsporidian Parasites in Dogs in Turkey: Zoonotic Concerns.

Microsporidia are opportunistic pathogens that infect a wide range of invertebrates and vertebrates. To assess the potential role of dogs in the transmission of these zoonotic pathogens, a total of 282 fecal samples from dogs in the Central Anatolia Region of Turkey were analyzed by utilizing species specific polymerase chain reaction for the four most frequent human microsporidia. Two microsporidia species were recognized in 41 samples (14.5%). Encephalitozoon intestinalis was detected in 35 samples (12.4%) and it was the most common microsporidium. The second microsporidium, E.cuniculi, was identified in six (2.1%) of the samples. Sequence analysis of the intergenic spacer of the ribosomal ribonucleic acid (RNA) internal transcribed spacer (ITS) gene revealed the presence of three E.intestinalis haplotypes closely associated with each other. No polymorphic region was found among the ITS sequences of E.cuniculi isolates and they were characterized as genotype III. This studyprovides the first data on the zoonotic microsporidia species from dogs in Turkey.