Root Pathogens Research Articles (Page 1)

via an addition reaction, a tetrahedral cobalt(II) complex with the asymmetric ligand 1-(2,5-dimethylphenyl)-3-phenylthiourea (L) was synthesized. Crystal structure of the complex, [CoL2Cl2], demonstrated a monoclinic system packing and coordination of the divalent cobalt ion with S atoms of two thiourea ligand molecules and two chlorine atoms. Fusarium species are very destructive phytopathogens, causing considerable economic loss. Drawbacks of organic antifungals include their poor solubility, instability and limited bioavailability. Environmental accumulation and negative effects on people’s health are results of their extensive use. The complex [CoL2Cl2], comparing with its precursors, offered higher inhibitions in plates of three Fusarium phytopathogens, i.e. Fusarium lateritium, Fusarium oxysporum, and Fusarium solani. [CoL2Cl2] (150 µg/ml) inhibited F. oxysporum, F. solani, and F. lateritium by 28–38 mm, but 1-(2,5-dimethylphenyl)-3-phenylthiourea and cobalt(II) chloride hexahydrate inhibited these fungi by 7–8.5 and 7.5–24.5 mm, respectively. In the presence of [CoL2Cl2] (150 µg/ml), the percent pathogenicity to wheat seeds by F. oxysporum and F. lateritium was brought to zero (20% by F. solani). Phytotoxicity action of [CoL2Cl2], cobalt(II) chloride hexahydrate, and 1-(2,5-dimethylphenyl)-3-phenylthiourea (150 µg/ml) on wheat seed germination was weak, reducing the optimal germination percentage (100% for control) to 83.3, 76.7, and 90%, respectively.

Abstract Permafrost peatlands store vast amounts of frozen carbon across northern landscapes. When ground ice melts, surface subsidence produces thermokarst landforms that expand wetlands at the edges of permafrost plateaus. Thermokarst represents an accelerating climate feedback, but uncertainties remain about how ground ice, hydrology, and vegetation interact to shape landscape change and carbon fluxes. We extended the process-based model ecosys to simulate thermokarst dynamics in laterally coupled 2D transects at a well-characterized peatland site in Canada’s Northwest Territories. After benchmarking against site observations, we varied ground ice content and hydrologic boundary conditions across ranges typical near the southern permafrost limit. Simulations revealed distinct degradation regimes governed by the elevation difference between the frost table and the external water table (FT-EWT). Rates of lateral retreat, the thaw-driven encroachment of wetlands into adjacent plateaus, ranged from 0 to >2 m yr-1 under identical weather forcing, consistent with observations and highlighting the strong role of WT and ground ice. Vegetation simulations indicate that black spruce mortality cannot be explained by anoxia alone, pointing to additional stressors such as root damage, pathogens, or physical destabilization. Despite large hydrologic shifts, net ecosystem CO2 exchange remained a slight sink after collapse, while methane (CH4) emissions rose by one to two orders of magnitude. As a result, lateral retreat substantially increases the greenhouse warming potential of permafrost peatlands (1.7 million km² in area), with simulated emissions of 0.1-10 Mt CO₂-eq decade-1 depending on hydrology and retreat rates. These results underscore the need to account for both ground ice and hydrologic dynamics when assessing thermokarst-driven climate feedbacks.

Plants of high THC-containing Cannabis sativa L. (cannabis) grown outdoors in south-central British Columbia showing symptoms of stunted growth, yellowing, and leaf curl were sampled during April–August, 2023. Root and crown tissues from three genotypes were surface-sterilized and plated onto potato dextrose agar (PDA) containing 130 mg L−1 streptomycin sulphate. Emerging colonies were identified using morphological criteria and PCR of the ITS1–ITS4 region of ribosomal DNA. Leaf tissues were tested for beet curly top virus and hop latent viroid using pathogen-specific PCR primers. The genera and species recovered from affected root and crown tissues (in decreasing order) were Globisporangium sylvaticum, Fusarium commune, F. equiseti, F. sporotrichioides and F. acuminatum. In leaf tissues of one genotype (‘Grandaddy Bruce’), the presence of hop latent viroid was confirmed. A mixture of mycelium and spores of the fungal and oomycete isolates was used to inoculate stem cuttings, rooted cuttings and hydroponically grown plants of cannabis genotype ‘Powdered Donuts’. Disease incidence and severity were rated after 3–4 weeks, depending on the tissues used. In all experiments, isolates of G. sylvaticum and F. commune were the most pathogenic, followed by F. acuminatum and F. sporotrichioides. There was minimal disease development following F. equiseti inoculation. Symptoms of stunting, root browning and decay were observed with F. commune, G. sylvaticum, F. acuminatum and F. sporotrichioides, all of which are reported for the first time as root pathogens affecting C. sativa in Canada. Combined inoculation of G. sylvaticum with F. commune produced more severe root symptoms than either pathogen alone.

The genus Armillaria is a broad group of basidiomycete (Agaricales, Physalacriaceae) plant pathogens that can have detrimental effects on woody hosts in forested, urban, and horticultural landscapes. Several species are known as aggressive root pathogens on both conifers and deciduous woody plants. Armillaria species are considered white rot fungi due to their capacity to degrade both lignin and cellulose in woody tissues. Armillaria mexicana was recently described as a new species found in peach (Prunus persica) orchards of Coatepec Harinas, State of Mexico. However, a subsequent study identified A. mexicana on avocado (Persea americana) and pine (Pinus sp.), suggesting that A. mexicana may be able to infect diverse hosts that are planted in disturbed areas following deforestation. We assembled a reference genome for A. mexicana consisting of 38 contigs constructed using PacBio and Illumina sequencing reads. Genome annotation and comparison with A. mellea, a phylogenetic sister taxon, revealed notable differences, including a larger number of interspersed repeats in A. mexicana and the absence of small RNAs, which were detected in A. mellea. While A. mexicana (49 Mb) has a roughly 30% smaller genome than A. mellea (70 Mb), it has a similar number of genes encoding pectinases and nonribosomal peptide synthetase (NRPS) and NPRS-like secondary metabolites, which may influence the pathogenicity of A. mexicana. This reference genome of A. mexicana allows future genomic comparisons that can help characterize the evolutionary history and enhance our understanding of the molecular mechanisms involved in pathogenicity and wood decomposition of Armillaria species.

Different fungal pathogens that cause rot root disease have a significant impact on cucumbers, which has a tremendous economic limitation on the yield of this important vegetable crop. The current study aims to examine the effect of cold aqueous extract of three plants (Acacia farnesiana, Myrtus communis and Nerium oleander) on the radial growth and the biomass of some pathogenic fungi (Rhizoctonia solani and Macrophomina phaseolina) with the presence of Trichoderma harzianum as a bio-control agent. Fungal pathogens were isolated from root parts of infected cucumber plants that were collected from different regions of Najaf province, while the bio-control fungus was obtained from the Bio-control Laboratory, Faculty of Agriculture - University of Kufa. Results of the current study showed that 20% of the cold aqueous extract of M. communis powder was superior to the rest of the studied extracts in inhibiting the radial growth of studied fungi, as the radial growth of R. solani reached 3.49cm, M. phaseolina 3.02cm, and T. harzianum 3.67cm. Thely apparent effect of the same extra extract on the growth of the fresh and dry biomass of the aforementioned fungi. The outcomes demonstrated that the 20% concentration of cold aqueous extract of M. communis also increased the percentage of seed germination and the fresh weight of cucumber plants. The cold aqueous extract of M. communis leaves and T. harzianum as a biological can be used , to inhibit the growth of both pathogens of rot root disease, thus protecting cucumber seedlings and producing healthy plants.

Converting pig manure into biochar mitigates the antibiotic resistance of vegetable endophytes.

Antagonism of ectotrophic mycorrhizal fungi to Phytophthora cinnamomi, other root pathogenic fungi, and soil bacteria was examined. In agar plate tests, Laccaria laccata, Lactarius deliciosus, Leucopaxillus cerealis var. piceina, Pisolithus tinctorius, and Suillus luteus inhibited growth of nearly half of the 48 different fungal root pathogens. Leucopaxillus cerealis var. piceina inhibited 92% of the test pathogens. Differences in sensitivity of several isolates of P. cinnamomi to inhibitions by this symbiont were not found. Culture filtrates of L. cerealis var. piceina were inhibitory also to growth of P. cinnamomi and soil bacteria. Zoospore germination was inhibited completely in filtrates of this symbiont. Maximum antibiotic production occurred during the rapid growth phase in liquid culture. Length of culture incubation and temperature strongly influenced production of inhibitory substances by L. cerealis var. piceina in liquid culture. It grew best from 10 to 20 C, whereas P. tinctorius grew best from 30 to 35 C in liquid culture.

Seedlings of the ecologically important, critically endangered tree Ocotea monteverdensisis experience high mortality in the Monteverde, Costa Rica, cloud forests at the onset of the wet season, yet there are no studies suggesting the disease etiology. Here, healthy and diseased plant root and bulk soils were analyzed for various carbon and nitrogen (N) metrics and respiration levels, and DNA sequence-based bacterial and fungal community compositions. All nitrogen metric levels were greater in diseased vs. healthy plant root soils, which could enhance pathogen growth and pathogenic mechanisms. Greater DNA percentages from several potential pathogens were found in diseased vs. healthy plant root soils, suggesting this disease may be associated with a root pathogen. The DNA of the fungus Mycosphaerella was at greater levels in diseased vs. healthy plant root soils than other potential pathogens. Mycosphaerella causes similar diseases in other plants, including coffee, after onset of the wet season. The O. monteverdensis disease also occurs in seedlings planted within or near former coffee plantations at wet season onset. Distance-based linear model analyses indicated that NO3− levels best predicted the pattern of fungal pathogens in the soils, and Mycosphaerella and Tremella best predicted the patterns of the different N metrics in the soils, supporting their possible roles in this disease.

Biological nitrogen fixation in plants gives them a competitive edge by converting atmospheric nitrogen into ammonium. Rhizobia and leguminous plants have symbiotic relationships in which the latter produce nitrogen-fixing nodules in their roots. Rhizobial bacteria infiltrate leguminous plants through signal exchange. Under low nitrogen environments, host plant roots release flavonoids that cause rhizobia to produce Nod factors, which are lipo-chitooligosaccharide signalling molecules. Flavonoids play a crucial role in interactions between plants and microbes, facilitating symbiosis and defensive mechanisms. Flavonoids are a diverse class of phenolic compounds found in all higher plants and act as chemo-attractants, attracting compatible rhizobia, promoting or suppressing expression of rhizobial nod genes, suppressing root pathogens, promoting germination of mycorrhizal spores, quorum sensing and chelating soil nutrients. Flavonoids activate the bacterial regulatory protein NodD, which controls the transcription of nod genes required for the synthesis of the bacterial Nod factor. The legume-rhizobium interaction allows rhizobia to enter the host plants and stimulate flavonoids from legume roots.

Fusarium wilt, caused by Fusarium oxysporum f. sp. melongenae (Fomg), has emerged as a serious disease limiting brinjal productivity. Soil-borne nature of the pathogen, limited reproducibility and environmental variability complicate the use of the laborious traditional screening methods for resistance to Fusarium wilt in breeding programs. To facilitate reliable screening and rapid phenotyping, we resorted to a novel hydroponic approach. In this study, 90 brinjal genotypes, including diverse cultivated and wild accessions, were grown in Hoagland solution and inoculated with Fomg, isolated from a Fusarium wilt-endemic field at the host institute. Disease indices (DI), area under disease progress curve (AUDPC) and area under disease progress stairs (AUDPS) were used to identify resistant genotypes and study disease progression. Host phenotypic trait assessments and histopathological studies were also used to characterize resistant sources. Five genotypes, namely BR-40-7, Pink, Bouldar, S. sisymbriifolium, and S. torvum were found immune to Fusarium wilt, while fifteen genotypes each were found highly resistant and resistant to the disease. Genotypes immune to the disease were asymptomatic. Highly resistant genotypes were late-wilters, while the resistant genotypes were slow-wilters. Highly susceptible genotypes exhibited early, rapid and severe wilting. Resistant genotypes exhibited superior root and shoot development compared to susceptible genotypes. The broad applicability of the hydroponic screening method to diverse plant species and root pathogens underscores its potential to address critical challenges in agriculture. This study is the first to use Fusarium-specific screening of germplasm in hydroponic brinjal and wild Solanum cultures.

Salicylic Acid (SA) has been the focus of intensive research due to its function as an endogenous signal mediating systemic plant defense responses against root pathogens. In present experiment, application of 25 mM salicylic acid and soil drenched with PGPR ameliorate plant growth parameters, photosynthetic pigments, carbohydrates, proteins, phenol, peroxidase and catalase activities. While, 150mM (NaCl) observed immense decrease in weight as well in length of root/shoot but also reduced the physiological parameters. The combined effect of SA + NaCl + PGPR had significantly increased the growth of mung bean plants and photosynthesis activity as compared to salinity stress. Inoculation of PGPR (6.4 x 10-8 CFU/mL) under salinity stress provides bio protection of root-colonization which can increase plant resistance against abiotic stress which showed positive results when applied alone, however in combination with 25mM salicylic acid ameliorate the activity of photosynthesis and antioxidant enzymes activity against the salinity.

Plant nucleotide-binding domain and leucine-rich repeat immune receptors (NLRs) confer disease resistance to many foliar and root parasites. However, the extent to which NLR-mediated immunity is differentially regulated between plant organs is poorly known. Here, we show that a large cluster of tomato (Solanum lycopersicum) genes, encoding the cyst and root-knot nematode disease resistance proteins Hero and MeR1 as well as the NLR helper NLR required for cell death 6 (NRC6), is nearly exclusively expressed in the roots. This root-specific gene cluster emerged in Solanum species about 21 million years ago through gene duplication of the ancient asterid NRC network. NLR sensors in this gene cluster function exclusively through NRC6 helpers to trigger hypersensitive cell death. These findings indicate that the NRC6 gene cluster has sub-functionalized from the larger NRC network to specialize in mediating resistance against root pathogens, including cyst and root-knot nematodes. We propose that some NLR gene clusters and networks may have evolved organ-specific gene expression as an adaptation to particular parasites and to reduce the risk of autoimmunity.

ABSTRACT Conventional agriculture negatively affects biodiversity, including soil biota. Agroecology advocates reducing agrochemicals and enhancing biodiversity’s ecological services, though its impact on vegetable root symbionts is poorly understood. We compared root mutualists’ abundance and richness, such as arbuscular mycorrhizal fungi (AMF) and dark septate endophytic fungi (DSEF), and the root pathogen Olpidiaster brassicae in lettuce roots from “transition to agroecology” (TA) and “conventional horticulture” (CH) fields. Plants from TA showed higher root colonization and richness of mutualists, with reduced O. brassicae root colonization. These findings highlight agroecological management’s potential to enhance plant health by nurturing beneficial root symbionts and suppressing antagonistic fungi.

ABSTRACT Widespread use of pesticides for crop disease management raises environmental and health concerns but exploring indigenous rhizobacteria as eco-friendly alternatives can help mitigate this issue. In the study, 11 (7 Bacillus and 4 Pseudomonas) isolates were selected based on demonstrated plant growth-promoting (PGP) and biocontrol potential. Selected bacterial isolates exhibited significant antagonistic activity against pathogenic fungi, Sclerotium rolfsii and Fusarium oxysporum f. sp. lycopersici. Several known genes for antibiotic, HCN and lytic enzyme production were identified, with Pseudomonas isolates also demonstrating siderophore production capabilities. Greenhouse trials revealed that seed inoculation with the bacterial strains caused a significant increase in plant biomass (80%), shoot length (74%), and root length (126%). The PGPR strains were developed into four consortia (C1-C4) and inoculated into tomato seeds, seedlings, and soil which successfully suppressed the incidence of root diseases and promoted plant growth both in greenhouse and field conditions. Application of bacterial consortia as a talc-based formulation to seeds and soil yielded enhanced plant growth (87.5%) and suppressed infection by Sclerotium rot and Fusarium rot and wilt (73%). In the field trial, C4-treated plots showed approximately 40% increase in fruit yield compared to the control which was the overall highest amongst the treatments. Furthermore, qPCR analysis demonstrated the persistence of the introduced strains in the rhizosphere, while endpoint PCR confirmed their endophytic colonisation. Overall, this study highlights the effectiveness of native PGPR consortia as a sustainable tool for improving plant health and enhancing crop yield.

Abstract The soilborne pathogens, Aphanomyces euteiches, Fusarium avenaceum and F. solani, pose a threat to sustainable pea production in Canada. The objectives of this study were to correlate pea root rot severity and pathogen levels with soil physico-chemical factors, assess pathogen levels in different soil depths, their spatial distribution pattern within a field, and determine whether their DNA quantification in soil can accurately predict root rot potential. Soil at three depths from 21 pea fields located in four soil zones in Saskatchewan, Canada were sampled after crop harvest in 2015 and 2016, and tested for disease-causing potential using a greenhouse pea bioassay. Quantification of pathogens was performed using droplet digital PCR on soil DNA. DNA quantification of soils revealed that A. euteiches was the most common with 72.7% incidence in both years, followed by F. solani at 58.4–68.7% and F. avenaceum at 44.4 − 57.6% incidence. Disease severity and levels of all three pathogens was highest in the top layer of soil. The spatial pattern for the distribution of A. euteiches was mostly (57.1%) uniform. The distributions of F. solani and F. avenaceum were predominantly random or clumped. A weak linear relationship between disease severity and pathogen quantities in soil was observed. There was no consistent correlation with soil type or soil physico-chemical properties. Weak interactions between disease severity and soil pathogen levels suggest that the quantification of inoculum potential from soil in the absence of a susceptible host crop underestimates the true disease-causing potential of a soil.

Citruses are one of the major fruit crops globally. Among Mediterranean citrus producers, Sicily (southern Italy) is renowned for its high-quality fresh fruit production. Phytophthora diseases are a serious issue for citrus production worldwide and Phytophthora nicotianae is a prevalent causal agent of root rot in most citrus growing areas globally and particularly in the Mediterranean region. This study reports the occurrence of Phytophthora inundata as a root pathogen of declining mature citrus trees in eastern Sicily in association with P. nicotianae. This is the first record of P. inundata on citrus in Europe and the Mediterranean region. The species was identified on the basis of a morphology and multi-gene phylogenetic analysis, which included the internal transcribed spacer, β-tubulin and cytochrome c oxidase subunit 1. Pathogenicity tests on citrus saplings showed P. inundata was a less aggressive pathogen than P. nicotianae. However, the co-inoculation of both species produced more severe symptoms than inoculation with a single species, indicating an additive effect of these two pathogens and suggesting that opportunistic secondary pathogens like P. inundata may have a crucial role in complex diseases.

Roots can recognize and differentially respond to beneficial and pathogenic microbes, which are fundamental for maintaining root microbiome homeostasis, plasticity, and plant fitness. Meanwhile, roots are highly heterogeneous tissues with complex cell-type compositions and spatially distinct developmental stages. We found that beneficial microbe specifically induces the expression of translation-related genes in the proximal meristem cells, and diverse ribosome proteins and translation regulators are necessary for beneficial microbe-mediated growth promotion. Notably, the root maturation zone can still mount localized immune responses to root pathogens, including genes related to camalexin and triterpene biosynthesis. A triterpene biosynthesis mutant blocked the microbiome reshaping process upon GMI1000 infection. Our results indicate roots may have specialized immune responses in the maturation zone, and provide important insights and vital resources for further elucidating regulators of root-microbe interactions and microbiome reshaping.

ABSTRACTUnderstanding the ecology of biocontrol agents (BCAs) is needed for their effective deployment. We used a propidium monoazide (PMA)‐based quantitative PCR method to study the dynamics of viable populations of (1) Gliocladium catenulatum and Trichoderma asperellum on root surfaces following drenching and (2) G. catenulatum and Bacillus subtilis on leaves and flowers via spraying. Experiments were conducted on table‐top strawberry grown in coir substrate under protection. The viable population size of both G. catenulatum and T. asperellum on roots did not decrease or increase for at least 2 weeks after application. Both G. catenulatum and B. subtilis survived on strawberry flowers, with the mortality rate varying greatly among individual applications. There was an overall decrease in the viable population size for both BCAs, but only a small proportion of variability in the BCA mortality rate was attributable to weather conditions. The daily mortality rate linearly decreased with the increasing daily variability in vapour pressure deficit. Neither G. catenulatum nor B. subtilis led to a statistically significant reduction in Botrytis infection of flowers when applied at a concentration of 108 spores/mL (G. catenulatum) or 109 CFU/mL (B. subtilis) before or after inoculation of flowers with 105 spores/mL Botrytis cinerea. This failure in controlling B. cinerea may partially be due to the possibility that some flowers were infected by naturally occurring B. cinerea before BCAs were applied. The present research suggests that biocontrol of root pathogens in strawberry grown in coir substrate may hold a greater promise than the control of flower/fruit diseases.

The use of meteorological information obtained from the base weather station for conducting forest pathological monitoring in the conditions of nature conservation research departments (PNDV) of the Polissya Nature Reserve is justified. The results of conducting forest pathological monitoring studies of pine stands in the forest vegetation conditions of the Perhansky, Kopyshchansky, Selezivsky PNDVs of the Polissya Nature Reserve are analyzed.The subject of the work is the practical application of an innovative method using meteorological information from a local automatic meteorological station in the conditions of the settlement of Selezivka, for conducting forest pathological monitoring surveys of the sanitary condition of forests in the forest vegetation conditions of the Perhansky, Kopyshchansky, Selezivsky PNDV of the Polissya Nature Reserve, as well as its comparison with the effectiveness of existing methodologies for assessing the pathological condition of forests in the conditions of the Central Polissya zone of Ukraine. Testing and assessment of the representativeness of innovative methodological principles for using meteorological information obtained from the automatic meteorological station of the Polissya Nature Reserve to conduct forest pathological monitoring studies and forecasts of the spread of diseases and the spread of pests in the conditions of the Pergan, Kopyshchan, Seleziv PNDV, assessment of the actual discrepancy of indicators in comparison with the proposed methodology with generally recognized methods for conducting forest pathological surveys for disease and pest damage, as well as further forecasting the forest pathological state of forests using meteorological information to prevent the occurrence and spread of epiphytoses of forest diseases and pests.The aim of the work is to determine the effectiveness of the proposed innovative methodology for conducting forest pathological monitoring using meteorological information from an automatic weather station on the territory of forest uses of the Polissya Nature Reserve; to assess the possibility of using meteorological data obtained from an automatic weather station on the territory of the Polissya Nature Reserve to compile forest pathological and entomological forecasts regarding the likely spread of diseases and pests in the forest vegetation conditions of the Pergan, Kopyshchan, and Seleziv PNDVs; based on the proposed innovative methodology for conducting forest pathological monitoring studies using meteorological data, to provide practical targeted recommendations to both forestry branches and objects of the nature reserve fund of Ukraine regarding the prevention of the occurrence and spread of epiphytoties of diseases and pests, as well as the compilation of forest pathological forecasts for planning preventive measures in the conditions of the Central Polissya zone of Ukraine.The main methods of conducting research to study methodological approaches to predicting forest pathological conditions using meteorological information obtained from an automatic weather station in the conditions of the PNDV of the Polissya Nature Reserve were:1. Calculation and analytical for collecting and processing the results of research to study the effectiveness of the proposed methodology for conducting forest pathological studies using meteorological information from an automatic weather station in the forest vegetation conditions of the Pergansky, Kopyshchansky, Selezivsky PNDVs of the Polissya Nature Reserve, as well as their comparison with generally accepted methods.2. Implementation of general and sub-annual forest pathological monitoring and statistical analysis of the results obtained using existing methodologies for research into the pathological condition of forests in the Central Polissya zone of Ukraine.3. Determination of the representativeness and objectivity of the obtained research results in relation to all objects of the nature reserve fund of the Central Polissya zone of Ukraine, where pine stands dominate.4. Providing practical recommendations to both branches of the State Enterprise "Forests of Ukraine" and objects of the nature reserve fund on the possibility of applying the proposed innovative methodology for determining the forest pathological condition of forests using meteorological data from an automatic weather station, as well as the possibility of creating forecasts of the risks of the occurrence and spread of epiphytoties of diseases and pests in the forest vegetation conditions of the nature reserve fund of Ukraine.According to the results of the work, it was found that meteorological information during forest pathological monitoring provides an assessment of the climatic features of the region, carries out a detailed analysis of weather conditions of individual years and seasons of the year (spring, summer, autumn, winter), provides an objective assessment of the weather situation during critical periods of the life cycle of forest insect pests and the spread of diseases, assesses meteorological phenomena that cause abiotic stress in plants and, through a complex system of biocenotic relationships, modify the number of insects and pathogens in various forest-vegetation conditions. It has been proven that with a large positive anomaly of the sums of active temperatures, quite favorable conditions are created (especially in combination with a deficit of precipitation) for a sharp increase in the number of forest insect pests. The method of forecasting the heat supply of the growing season is based on the relationship between the sums of active temperatures (Σt>t°) and the date of the spring transition of the average daily air temperature through 10°C. Such a methodological approach to forest pathological forecasts makes it possible to establish with a probability of 95% not only the probable area of disease distribution, but also to determine specific types of pests and their threshold of harmfulness in forest edatopes. It was found that the assessment of moisture conditions during the growing season directly affects the course of disease pathogenesis and the spread of pests in the conditions of the PNDV of the Polissya Nature Reserve. The results of the conducted forest pathological studies indicate a significant change in pathological processes under the influence of weather conditions in pine nature reserve forests of the Central Polissya zone of Ukraine.The scope of application of the results of the conducted research is the objects of the nature reserve fund on the example of the Polissya Nature Reserve, forestry enterprises and forestry enterprises, which are geographically located in the Central Polissya zone, in order to determine the pathological state of forests and subsequently the possibility of predicting the risks of the occurrence and spread of epiphytoties in natural forest ecosystems. The data obtained as a result of the research can also be used when compiling forest pathological computer models of the probable occurrence, spread of pests and diseases in the forests of the nature reserve fund of the Central Polissya zone of Ukraine.The conclusions of the research are that the spread of diseases and pests as a result of weather and climatic features in the spring-autumn and winter period due to abnormally warm winters annually destroys significant areas of forests of the nature reserve fund. The most affected by constant pathogenesis and damage by pests are pine stands of the boreal type of Pergansky, Selezivsky and Kopyshchansky PNDV of the Polesie Nature Reserve. We have determined that as a result of weather and climatic anomalies in the forest vegetation conditions of the Polesie Nature Reserve, the active pathological effect of the complex of diseases and pests, causing active drying of stands of Scots pine and European birch, is 2 times higher than similar indicators in areas with more stable weather indicators, especially the amount of precipitation and the sum of active temperatures. The entry of Scots pine into a persistent pathological process with subsequent death due to the active biological activity of diseases and pests in the conditions of the Polesie Nature Reserve occurs quite intensively. It was established that the scale and nature of the pathological process in pine stands of the Polesie Nature Reserve in the context of the applied innovative methodology for determining pathological features using meteorological information from an automatic weather station differs significantly from the previously described methods. It was determined that meteorological data from an automatic weather station provide significant indicators of weather conditions that can be used to assess the pathologies of pests and forest diseases. The annual dynamics of the intensity of pathogenesis in the pine forest has significantly changed for the worse due to abnormally warm winters, especially in 2023, 2024, 2025. It was studied that in a pine forest affected by a pathological process, there is a higher formation and spread of mass epiphytoses of root and pine sponge, as well as the biological activity of apex, six-toothed bark beetles, pine woodworm, gold leaf beetle and other woodworm pests. Pathologies of pine stands due to weather and climatic conditions, as well as the probability of such dangerous phenomena as windbreak and windbreak due to the pathological activity of root and pine sponge pathogens in the conditions of forest use of the Polesie Nature Reserve is quite high compared to control areas, where the pathogenic impact of these pathogens is quite low. This, in turn, causes a faster rate of biological destruction of dead trees and broken logs, which, by the way, can further lead to the accumulation of forest combustible materials and their further natural preparation for possible fire in the presence of appropriate weather and climatic conditions. The practical use of the obtained research results is to determine the possibility of applying the methodology of forest pathological surveys using meteorological data to analyze the current and forecast the future forest pathological situation in the forest-vegetation boreal conditions of the Polesie Nature Reserve. Determining the pathological state of forests in the conditions of the Perhansky, Selezivsky, Kopyshchansky PNDV of the Polesie Nature Reserve will further allow for the practical determination of the quantitative and species composition of pathogens and pests, to determine the probability of the occurrence of epiphytoties and their spread in the conditions of the Polesie Nature Reserve.

Wheat is the major staple food in Uzbekistan, and it occupies the largest harvested area (1,3 million hectares) in the country (USDA 2024). In June 2023, a survey was conducted to investigate root pathogens in wheat growing fields of Kaspi district in the Kashkadarya region of Uzbekistan. A total of 24 symptomatic plants with root rot and dark brown root lesions were collected from focal lesions in 4 different fields. From each plant, roots were excised and surface sterilized with 1% sodium hypochlorite for four minutes, then rinsed three times with sterile distilled water. Following surface sterilization, the excised roots were air dried in a laminar flow on sterile tissue sheets, rinsed twice with sterile distilled water, and then cut into 1 cm lengths segments (5 segments per one plant). The root pieces were cultured at 24°C for 4 days with a 12-hour photoperiod on potato dextrose agar supplemented with streptomycin (0.1 g/liter) and chloramphenicol (0.05 g/liter). From 24 symptomatic plants a 5 dematiaceous hyphomycete monoconidial pure isolates with abundant conidia were isolated. The conidia (n = 60) were mostly fusiform, straight, four to seven distoseptate, olivaceous brown to dark brown, and measured 51 to 88.7 × 17.9 to 25.4 μm (average 69.7 × 21.57 μm). Based on morphological characteristics the fungus was identified as E. pedicellatum according to Sivanesan (1987) and Hernandez-Restrepo et al. (2018). From five isolated monoconidial colonies, one has been chosen for molecular-genetic identification. Total DNA was extracted from it using PureLink™ Genomic DNA Mini Kit (Thermo Fisher Scientific, Waltham, MA, USA). For more informative analysis two loci, he translation elongation factor 1-alpha (tef1) and beta-tubulin (tub) genes were PCR-amplified and sequenced using gene specific primers: EF-1F （5'-CGGTGGTATCGACAAGCGT-3'), EF-2R （5'-AGCATGTTGTCGCCGTTGAAG-3'）designed by Primer3web v4.1.0 software (Untergasser et al. 2012), and Bt2a （5'- GGTAACCAAATCGGTGCTGCTTTC, Bt2b （5'-ACCCTCAGTGTAGTGACCCTTGGC -3'）described by Glass and Donaldson (1995), respectively. The resulting sequences were deposited in NCBI database under accession number PQ095881 and PQ095882. After BLAST analysis they showed highest similarity with the corresponding sequences of tef1 JQ672389 (100% identity, from 287 bp 287 bp are matching) and tub JQ671941 (100% identity, from 273 bp 273 bp are matching) of BMP 0384 isolate of E. pedicellatum from USA. In the plant inoculations (pathogenicity test), three isolates of E. pedicellatum were evaluated. For the pathogenicity test, conidia were scraped from PDA plate, suspended in water, and mixed with sterile sand to obtain a density of 500 conidia/g. A total of 20 wheat seed (Grom variety) previously disinfected 2 min with 10% NaOCl, were sown in each plastic pot (14 cm x 4 cm, 2 seeds per pot) filled with the inoculated soil (5 pots) and with sterilized soil (5 pots) as a control. Plants were grown in a growth chamber with a 12-h photoperiod at 24°C for 4 weeks. Plants grown in inoculated soil displayed symptoms on their roots similar to those observed in the field-grown plants, whereas the roots of the control plants remained asymptomatic. The fungus was reisolated from the symptomatic roots and confirmed morphologically and molecular genetically as E. pedicellatum, fulfilling Koch's postulates. To the best of our knowledge this is the first report of E. pedicellatum on wheat in Uzbekistan.Since phylogenetic analysis of the GPEB-70 strain showed clustering with strains from USA and also taking into account intensification of globalization in agriculture, rising of global seeds market and increasing demand for high-yielding USA and Canadian wheat seeds in Central Asian farmers, we speculate that there may have been a recent introduction of E. pedicellatum from USA into Uzbekistan. Given that wheat is an important and popular staple food in Uzbekistan, further work would focus on developing efficient strategies to manage this root rot disease, the development of effective management strategies for this root rot disease would be the main focus of future research.