Reactions Of Radical Cations Research Articles

Investigating the Reactivity of Radical Cations: Experimental and Computational Insights into the Reactions of Radical Cations with Alcohol and p-Toluene Sulfonamide Nucleophiles

The reactivity of electrochemically generated radical cations toward alcohol and p-toluene sulfonamide nucleophiles was directly investigated through competition experiments. Alcohol-trapping of the radical cation is the kinetically favored pathway and is reversible. Trapping with the sulfonamide leads to the thermodynamic product. Both reaction pathways were investigated computationally with density functional theory (UB3LYP/6-31G(d)) calculations.

Unexpected observation of carbonyl oxide radical cations from peroxy radical cations. A new isomerism of oxygen‐containing radical cations

DFT computational studies with B3LYP/6‐31G(d) level theory has been carried out for peroxy radical cations which are formed by the reaction of molecular oxygen with aliphatic and aromatic olefin radical cations. The calculations have led us to find rearrangement reactions of the peroxy radical cations to the isomeric carbonyl oxide radical cations. The results show that the peroxy radical cations in which their positive charges at the olefinic carbons cannot be stabilized due to the structural requirements have a great tendency to undergo the rearrangement. Thus, 2‐methylpropene radical cation does not afford a peroxy radical cation formed by the addition of molecular oxygen at 2‐position of the olefinic carbon, and DFT calculations to locate the structure were found to give a rearranged ethyl methyl carbonyl oxide radical cation, which is significantly more stable than the peroxy radical cation. It was also found that carbonyl oxide radical cations, depending on the structures, are as stable as, or even more stable than, the isomeric peroxy radical cations which are formed by the addition of molecular oxygen to the aromatic olefin radical cations derived from trans‐stilbene and β‐methylstyrene. The results also indicate that the C–O bonds are shorter than the O–O bonds in the alkyl carbonyl oxide radical cations examined, which suggests that oxygen lone pair delocalization to the carbonyl carbon play an important role for the determinaton of the structures and their stability. Copyright © 2012 John Wiley & Sons, Ltd.

P53 Mutagenesis by benzo[a]pyrene derived radical cations.

Benzo[a]pyrene (B[a]P), a major human carcinogen in combustion products such as cigarette smoke and diesel exhaust, is metabolically activated into DNA-reactive metabolites via three different enzymatic pathways. The pathways are the anti-(+)-benzo[a]pyrene 7,8-diol 9,10-epoxide pathway (P450/epoxide hydrolase catalyzed) (B[a]PDE), the benzo[a]pyrene o-quinone pathway (aldo ketose reductase (AKR) catalyzed) and the B[a]P radical cation pathway (P450 peroxidase catalyzed). We used a yeast p53 mutagenesis system to assess mutagenesis by B[a]P radical cations. Because radical cations are short-lived, they were generated in situ by reacting B[a]P with cumene hydroperoxide (CuOOH) and horse radish peroxidase (HRP) and then monitoring the generation of the more stable downstream products, B[a]P-1,6-dione and B[a]P-3,6-dione. On the basis of B[a]P-1,6 and 3,6-dione formation, approximately 4 μM of radical cation was generated. In the mutagenesis assays, the radical cations produced in situ showed a dose-dependent increase in mutagenicity from 0.25 μM to 10 μM B[a]P with no significant increase seen with further escalation to 50 μM B[a]P. However, mutagenesis was 200-fold less than with the AKR pathway derived B[a]P, 7-8-dione. Mutant p53 plasmids, which yield red colonies, were recovered from the yeast to study the pattern and spectrum of mutations. The mutation pattern observed was G to T (31%) > G to C (29%) > G to A (14%). The frequency of codons mutated by the B[a]P radical cations was essentially random and not enriched at known cancer hotspots. The quinone products of radical cations, B[a]P-1,6-dione and B[a]P-3,6-dione were more mutagenic than the radical cation reactions, but still less mutagenic than AKR derived B[a]P-7,8-dione. We conclude that B[a]P radical cations and their quinone products are weakly mutagenic in this yeast-based system compared to redox cycling PAH o-quinones.

Effect of electrolysis conditions on the process of anodic oxidation of tertiary phosphines in the presence of camphene

Anodic oxidation of tertiary phosphines (Et3P, Pr3P, Bu3P, i-Bu3P and Am3P) in the presence of camphene and heterogenic base (trisodium phosphate) on platinum anode in acetonitrile solution of sodium perchlorate was studied. It is established that trialkylphosphine radical cations react with camphene to give two types of products: Camphenylphosphonium salts formed by elimination of proton, and phosphiniminoterpenylphosphonium salts which are obtained due to the rearrangement of terpenyl skeleton. Conditions of electrosynthesis are found where the summary yield of terpenylphosphonium products increases. The effect of length and degree of branching of alkyl substituents in trialkylphosphines on the rate of the reaction of phosphine radical cations with camphene and starting phosphine is found.

Radiation-Induced Fragmentation of Diamide Extraction Agents in Ionic Liquid Diluents

N,N,N',N'-Tetraalkyldiglycolamides are extracting agents that are used for liquid-liquid extraction of trivalent metal ions in wet processing of spent nuclear fuel. This application places such agents in contact with the decaying radionuclides, causing radiolysis of the agent in the organic diluent. Recent research seeks to replace common molecular diluents (such as n-dodecane) with hydrophobic room-temperature ionic liquids (ILs), which have superior solvation properties. In alkane diluents, rapid radiolytic deterioration of diglycolamide agents can be inhibited by addition of an aromatic cosolvent that scavenges highly reactive alkane radical cations before these oxidize the extracting agent. Do aromatic ILs exhibit a similar radioprotective effect? To answer this question, we used electron paramagnetic resonance spectroscopy to study the fragmentation pathways in radiolysis of neat diglycolamides, their model compounds, and their solutions in the ILs. Our study indicates that aromatic ILs do not protect these types of solutes from extensive radiolytic damage. Previous research indicated a similar lack of protection for crown ethers, whereas the ILs readily protected di- and trialkyl phosphates (another large class of metal-extracting agents). Our analysis of these unanticipated failures suggests that new types of organic anions are required in order to formulate ILs capable of radioprotection for these classes of solutes. This study is a cautionary tale of the fallacy of analogical thinking when applied to an entirely new and insufficiently understood class of chemical materials.

Structural behavior of sugar radicals formed by proton transfer reaction of deoxycytidine cation radical: detailed view from NBO analysis

The cation radicals of DNA constituents generated by the ionizing radiation initiate the alteration of the bases, which is one main type of cytotoxic DNA lesions. These cation radical spices are known for their role in producing nucleic acid strand break, and it is important to identify the cation radical formation at particular atomic site in these molecules so that the major pathway for the nucleic acid damage may be trapped. In the present study, we explored theoretically energetic, structural, and electronic properties of the possible radicals formed via proton atom abstraction at various sites of sugar part of deoxycytidine cation radical by employing density functional theory at B3LYP/6-311++G (d,p) level. The computation revealed 0.0–22.6 kcal/mol energy disparity in these radicals. Radical-centered carbon increases the extent of bonding with its adjacent atoms. This tendency should be important in predicting the reactivity of sugar-based radicals. Based on DFT calculations, sugar radicals of deoxycytidine have following stability order: raH1′ > raH2′ > raH4′ > raH3′ > raH5′ > raO5′H > raO3′H. Furthermore, influence of cation radical formation on acidities of multiple sites in deoxycytidine nucleosides was investigated. For instance upon cation radical formation, ΔHacidity of O3′H and O5′H sites of deoxycytidine varies from 348.6 and 351.5 to 228.8 and 227.5 kcal/mol, respectively.

Influence of Turn (or Fold) and Local Charge in Fragmentation of the Peptide Analogue Molecule CH3CO-Gly-NH2 Following Single-Photon VUV (118.22 nm) Ionization

The radical cationic reactivity of the peptide analogue molecule CH(3)CO-Gly-NH(2) is addressed both experimentally and theoretically. The radical cation intermediate of CH(3)CO-Gly-NH(2) is created by single-photon ionization of this molecule at 118.22 nm (~10.5 eV). The two most stable conformers (C(7) and C(5)) of this molecule exhibit different folds along the backbone: the C(7) conformer has a γ-turn structure, and the C(5) conformer has a β-strand structure. The experimental results show that the radical cation intermediate of CH(3)CO-Gly-NH(2) dissociates and generates a fragment-ion signal at 73 amu that is observed through TOFMS. Theoretical results show how the fragment-ion signal at 73 amu is generated by only one conformer of CH(3)CO-Gly-NH(2) (C(7)) and how local charge and specific hydrogen bonding in the molecule influence fragmentation of the radical cation intermediate of CH(3)CO-Gly-NH(2). The specific fold of the molecule controls fragmentation of this reactive radical cation intermediate. Whereas the radical cation of the C(7) conformer dissociates through a hydrogen-transfer mechanism followed by HNCO elimination, the radical cation of the C(5) conformer does not dissociate at all. CASSCF calculations show that positive charge in the radical cationic C(7) conformer is localized at the NH(2)CO moiety of the molecular ion. This site-specific localization of the positive charge enhances the acidity of the terminal NH(2) group, facilitating hydrogen transfer from the NH(2) to the COCH(3) end of the molecular ion. Positive charge in the C(5) conformer of the CH(3)CO-Gly-NH(2) radical cation is, however, localized at the COCH(3) end of the molecular ion, and this conformer does not have enough energy to surmount the energy barrier to dissociation on the ion potential energy surface. CASSCF results show that conformation-specific localization of charge in the CH(3)CO-Gly-NH(2) molecular ion occurs as a result of the different hydrogen-bonding interactions involved in the different molecular conformers.

Study on Reactions of Long-Lived Phenoxathiin Radical Cation with Aliphatic Alcohols, Phenol and Phenyl Halides in Ambient Condition by Fused-Droplet Electrospray Ionization Mass Spectrometry

he reactions of phenoxathiin radical cations with diverse organic compounds in ambient conditions were realized by using fused-droplet electrospray ionization mass spectrometry. In the investigation, the phenoxathiin radical cation was prepared by electrospray ionization. The reactants included aliphatic alcohols, phenol and phenyl halides and the reaction studies showed the unique reactivity the of phenoxathiin radical cation towards neutral organic compounds in ambient conditions, which has not been revealed in previous studies.

Clay Mediated Route to Natural Formation of Polychlorodibenzo-p-dioxins

Recent studies have documented the ubiquitous occurrence of polychlorodibenzo-p-dioxins and dibenzofurans (PCDD/Fs) of unknown origin in soils and clay deposits. Interestingly, the PCDD/F congener profiles do not match any known natural or anthropogenic source, and global PCDD/F budgets fail to account for the observed levels in soils. To reconcile these observations, clay minerals had been hypothesized to play a central role in the natural in situ synthesis of PCDD/Fs. We recently demonstrated the clay-mediated formation of the most prevalent PCDD congener in soils, octachlorodibenzo-p-dioxin (OCDD), supporting this hypothesis. Here we report the formation of the direct precursors ("predioxins") of the most toxic PCDD congener, 2,3,7,8-tetrachlorodibenzo-p-dioxin (2,3,7,8-TCDD), and of 1,2,4,7,8-pentachlorodizenzodioxin (1,2,4,7,8-PeCDD), and two additional dimers, from the reaction of 2,4,5-trichlorophenol (2,4,5-TCP) with Fe(III)-montmorillonite clay. We propose plausible reaction pathways, each initiated by single electron transfer from 2,4,5-TCP to Fe(III)-montmorillonite forming the 2,4,5-TCP radical cation. The operative reaction mechanisms, inferred from experimental results, are supported by quantum mechanical calculations. The key role of montmorillonite is apparently to stabilize the reactive radical cation intermediate. Fortuitously, PCDD formation reactions on clay surfaces are more facile for less toxic higher chlorinated congeners like OCDD, as predicted by the proposed reaction mechanism and consistent with the observed PCDD congener distributions in soils. Importantly, increasing the toxicity equivalency factor of OCDD would immediately cause many soils to exceed PCDD regulatory levels due to the predominance of this congener.

Effect of positively charged backbone groups on radical cation migration and reaction in duplex DNA

A series of DNA oligomers were prepared that contain guanidinium linkages (positively charged) positioned selectively in place of and among the normal negatively charged phosphodiester backbone groups of duplex DNA. One-electron oxidation of these DNA oligomers by UV irradiation of a covalently linked anthraquinone group generates a radical cation (electron “hole”) that migrates by hopping through the DNA and is trapped at reactive sites, GG steps, to form mutated bases that are detected by strand cleavage after subsequent piperidine treatment of the irradiated DNA. Analysis of the strand cleavage pattern reveals that guanidinium substitution in these oligomers does not measurably affect the charge migration rate but it does inhibit reaction at nearby guanines.

Fabrication of Polyaniline/Silver Nanocomposite Under Gamma-ray Irradiation

Polyaniline (PANI)/silver composite was one-step synthesized under γ-ray irradiation. The structure of the composite was characterized by Fourier transform infrared spectroscopy, UV-Visible, and X-ray diffraction, which indicated that PANI and face-centered-cubic silver were synthesized under γ-ray irradiation. The reaction mechanism were discussed, which revealed that the PANI was formed by the reaction of aniline cation radicals formed by the reaction of aniline cation and ·OH, and Ag was formed by the reaction of Ag+ and e−aq. The morphology of the composite consisted of PANI nanofibers and Ag nanoparticles, and the mechanism of the morphology formation was discussed, which revealed that the rapid mixing like polymerization process might play an important role. It was revealed that the transport behavior of the composite well fitted with the variable-range-hopping model in 80–300 K and deviated from the model below 80 K.

The influence of fragment size and intermediate barriers on competing near-identical simple cleavage reactions: A variational RRKM study

The fragmentation reactions of almost-symmetrical radical cations exhibit remarkable energy-dependent selectivity. The simple cleavage of the N-propylbutylamine radical cation and its N-methyl analog results in loss of ethyl or propyl radicals. The energy required to expel the ethyl radical (the smaller alkyl fragment) is lower, and ethyl loss is the preferred reaction of ions with low internal energy. The branching ratio is reversed for ions with higher energy, which can be accounted for with variational transition state theory. The competition between the two concurrent cleavage reactions is not governed by product-like orbiting transition states, but by relatively tight transition states; however, these are not equally tight. The transition state for loss of ethyl from higher energy reactant ions lies earlier on the reaction coordinate than does the transition state for loss of propyl, and the latter will in turn be slightly more product-like and hence more loose. k( E) vs E for loss of propyl radicals therefore rises more steeply with increasing internal energy, and this reaction becomes the more rapid process for higher-energy reactants such as the molecular ions formed in mass spectrometers with 70 eV electron ionization. The transition states for cleavage reactions exhibit energy-dependent shifting also when moderate intermediate barriers are present.

Nature and Kinetic Analysis of Carbon−Carbon Bond Fragmentation Reactions of Cation Radicals Derived from SET-Oxidation of Lignin Model Compounds

Features of the oxidative cleavage reactions of diastereomers of dimeric lignin model compounds, which are models of the major types of structural units found in the lignin backbone, were examined. Cation radicals of these substances were generated by using SET-sensitized photochemical and Ce(IV) and lignin peroxidase promoted oxidative processes, and the nature and kinetics of their C-C bond cleavage reactions were determined. The results show that significant differences exist between the rates of cation radical C1-C2 bond cleavage reactions of 1,2-diaryl-(β-1) and 1-aryl-2-aryloxy-(β-O-4) propan-1,3-diol structural units found in lignins. Specifically, under all conditions C1-C2 bond cleavage reactions of cation radicals of the β-1 models take place more rapidly than those of the β-O-4 counterparts. The results of DFT calculations on cation radicals of the model compounds show that the C1-C2 bond dissociation energies of the β-1 lignin model compounds are significantly lower than those of the β-O-4 models, providing clear evidence for the source of the rate differences.

ChemInform Abstract: Radical Cation Reactions Associated with the Thiocarbonyl Group.

Abstract The radical cation reactions of different thiocarbonyl compounds were examined. Compounds 7, 8, 11, 14 and 18 underwent a radical cation fragmentation in a photoinduced electron transfer (PET) reaction, in the presence of tris(4-bromophenyl)aminium hexachloroantimonate. The examined thiocarbonyl compounds underwent a radical cation fragmentation in a photoinduced electron transfer (PET) reaction, in the presence of tris(4-bromophenyl)aminium hexachloroantimonate.

ChemInform Abstract: Enol Cation Radicals in Solution. Part 3. Reaction of Enol Cation Radicals in the Presence of Nucleophiles.

ChemInform is a weekly Abstracting Service, delivering concise information at a glance that was extracted from about 100 leading journals. To access a ChemInform Abstract of an article which was published elsewhere, please select a “Full Text” option. The original article is trackable via the “References” option.

ChemInform Abstract: Reactivity of Radical Cations: Generation, Characterization, and Reactivity of 1,3-Diene Radical Cations.

ChemInform is a weekly Abstracting Service, delivering concise information at a glance that was extracted from about 100 leading journals. To access a ChemInform Abstract of an article which was published elsewhere, please select a “Full Text” option. The original article is trackable via the “References” option.

ChemInform Abstract: Sulfur Radical Cations

Sulfur radical cations are novel reaction intermediates that have attracted considerable attention recently. This in part is due to the renewed interest in the chemistry of radical cations in general, as well as four other factors. The first is the basis for understanding the structure and reactions of radical cations — can their inherent nature be best depicted by analogy with radicals, with cations, or is a new algorithm required? As is exemplified in this review, sulfur radical cations show novel behavior. Second, some reactions of sulfur radical cations are attracting interest for their application in organic synthesis. Third, biological electron-transfer may be mediated by sulfur and, indeed, sulfur radical cations may be intermediates in biological redox processes. Finally, materials based on tetrathiafulvalene, polythiophene, and related sulfur compounds have high electrical conductivity which may be understood in terms of p-delocalized sulfur radical cations or the related dications. Consequently, a comprehensive and critical review of this field appeared timely.

Ion Cyclotron Resonance Mass Spectrometric Study on the Gas-Phase Reaction of Triarylphosphine Radical Cations

The gas-phase reaction of triarylphosphine radical cations was examined by ion cyclotron resonance mass spectrometry. Triarylphosphine radical cations generated from triphenylphosphine, tris(m-tolyl)phosphine, and p-tolyldiphenylphosphine underwent bimolecular reaction with the parent phosphine that exists in large excess. On the other hand, radical cations generated from tris(p-toly)phosphine, o-tolyldiphenylphosphine, tris(o-toly)phosphine, and trimesitylphosphine gave totally different products. This is the first observation that a small substituent such as a methyl group on the aryl ligand results in dramatic change of the reactivity of triarylphosphine radical cations.

Gas-phase formation and reactions of radical cations of guanosine, deoxyguanosine and their homodimers and heterodimers

Electrospray ionisation of methanolic solutions containing a mixture of the nucleoside deoxyguanosine, dG, incubated with Cu(NO3)2 resulted in the formation of a range of ions, including doubly charged copper nucleoside complexes [CuIIdGn]2+, with n ranging from 2 to 10. Collision-induced dissociation of these complexes proceeds via a number of different pathways that depend on the size of the cluster, n. When n=3, monomeric radical cations are formed via redox processes. When n=4, dimeric radical cations are formed. Related complexes are formed for the nucleoside guanosine, Gs, and these [CuIIGsn]2+ complexes fragment in similar fashions to their [CuIIdGn]2+ counterparts. A key finding is that the radical cations of dG and Gs have fragmentation patterns that depend on the way they are formed. Thus radical cations, dG+ and Gs+, formed directly in the electrospray ionisation source or via collision-induced dissociation of [CuIIdG3]2+ and [CuIIGs3]2+ complexes fragment in the same way, giving the radical cation of the guanine base at m/z 151 via cleavage of the N-glycosidic bond. In contrast, the collision-induced dissociation spectra of radical cations formed via the sequences [CuIIdG4]2+→dG2+→dG+ and [CuIIGs4]2+→Gs2+→Gs+ are dominated by the loss of CH2O and further loss of C2H3O2 from the sugar moiety. These different fragmentation reactions are attributed to different tautomeric structures of the radical cations. Quantum chemical calculations were carried out on possible structures of the radical cation dimer of the model 9-methylguanine. Three low energy structures were found. Two of these represent base pairs of the kind found in supramolecular motifs of guanine derivatives, and one of these possesses a novel tautomeric structure that may have important biological implications.

Role of base pairing partner on DNA‐protein crosslinking from guanine oxidation

Oxidative DNA damage contributes to aging, cancer, and other degenerative diseases. Guanine is particularly vulnerable to oxidation, creating radicals which form irreversible crosslinks to proteins. Here, we investigate how the reactivity of the guanine radical in the oligonucleotide 5′‐ATATGATATGGATATGATAT‐3′ depends on its base pairing partner(s). We synthesized DNA duplexes with cytosine derivatives or mismatches across from guanine. Guanine radicals were created photochemically and the DNA was analyzed by gel shift experiments. In the study of mismatches, the duplexes contained mismatches across from the 5′‐G of the GG doublet. Under both nondenaturing and denaturing conditions, crosslinking decreased in the order of G:G > G:A > G:T = G:C. The enhanced reactivity for the G:G and G:A mismatches is attributed to a lowered oxidation potential near the GG doublet. Cytosine derivatives crosslinked in the order of 5‐bromocytosine > cytosine > 5‐methylcytosine. These results are consistent with the presence of more of the more reactive radical cation with the 5‐bromocytosine, since it is a weaker base than cytosine or 5‐methylcytosine; melting temperature experiments indicated minimal differences between duplexes with the different cytosines. These results show that the reactivity of guanine in oxidative DNA‐protein crosslinking reactions depends on its base pairing partner.