Random Amplified Polymorphic DNA Patterns Research Articles

Differentiation of Aspergillus niger by random amplification of polymorphic DNA

The randomly amplified polymorphic DNA (RAPD) patterns of whole-cell lysates from five Aspergillus niger isolates, including one reference strain, two isolated from deep freeze, and two environmental strains from soil and plant infections, were investigated. PCR-RAPD analysis of genomic DNA was performed using eight primers (Tube-A1, Tube-A6, Tube-A17, Tube-B8, Tube-B11, Tube-B15, Tube-C5, Tube-C6). The RAPD assay discriminated between all strains. Comparison of deep freeze isolates showed identical RAPD patterns in some of the reference and environmental isolates. The data indicates that the RAPD technique is useful for fingerprinting A. niger.

Optimization of conditions in random amplified polymorphic DNA (RAPD) reaction for determination of plant pathogenic bacteria

Random Amplified Polymorphic DNA (RAPD) technique is a powerful tool for genetic studies. It can be also applied for determination of bacterial species. The goal of this work was to optimize conditions for RAPD reaction, and to obtain RAPD patterns specific for some plant-associated bacteria. RAPD could be a good choice for screening and preliminary bacterial determination. Application of RAPD can determine that some of bacterial species are not reason of infection, and make additional tests for them unnecessary. This can provide time, labor, and as well as money saving, which is important particularly if expensive tests are applied. Optimization of reaction conditions in this work made possible good repeatability of RAPD electrophoretic patterns for particular bacterial species.

Genetic Diversity Analysis of Starchy Curcuma Species Using RAPD Markers

The genetic variability in starchy Curcuma species was assessed using Random Amplified Polymorphic DNA (RAPD) technique. The RAPD pattern generated by 20 primers revealed a high degree of polymorphism. A total of 274 bands were generated of which 264 were polymorphic. All the species were separated into 3 clusters using UPGMA. C. aromatica, C. leucorrhiza, and C. brog formed a cluster within which C. longa and C. zedoaria formed a subgroup. C. harita was genetically distinct from all the other Curcuma species. Since it is difficult to distinguish different species by leaf morphology, the RAPD pattern has high utility in identification of starchy Curcuma species.

Genotypic analysis of Candida albicans isolates obtained from removable prosthesis wearers

To assess of the genotypic diversity of Candida albicans isolated from removable prosthesis wearers, with and without denture-related stomatitis (DRS). The occurrence of different genotypes in pathological and control cases was investigated. One hundred and sixty-four isolates of C. albicans obtained from different oral cavity locations were compared by randomly amplified polymorphic DNA (RAPD). The coherence of this analysis was confirmed by genotyping a selected group of isolates with pulsed field gel electrophoresis (PFGE). Among the 164 isolates, 150 were grouped into seven groups on the basis of their RAPD patterns. Three of these groups (comprising 54 isolates) had significant (alpha < 0.10) predominance of clinical or control cases. For the other isolates, no significant differences were observed between control and DRS cases. Occasionally, more than one genotype was found in the same person. These findings were sustained by PFGE analysis. No relevant associations between the genotypic patterns and pathology level were found. This study evidenced that C. albicans with similar genotypes may be found in individuals with DRS and in control cases. This conclusion hints the involvement of other aetiological factors that alone or in association with C. albicans may trigger the emergence of DRS.

Molecular, Morphological and Oil Composition Variability within Olive (Olea europaea L.) at Semi-Arid Conditions

ABSTRACTGenetic diversity studies using Random Amplified Polymorphic DNA (RAPD) technique were carried out on olive (for oil) ecotypes of Olea europeae L. for semi-arid region. Analysis of PCR products was achieved by using the simple matching coefficient and UPGMA clustering. Primers were identified and used in order to discriminate within the Ayvalik cultivar, which is moderate drought resistant. The diversity of RAPD patterns demonstrated the biodiversity among samples. The genetic variability was further subjected to pomological and biochemical analyses to support and determine the genetic variability.

Molecular epidemiology ofCandidaspecies isolated from clinical specimens of intensive care unit patients

Epidemiological analysis of nosocomial Candida infections has gained importance due to an increase in these infections during the recent years. This study investigated the prevalence of clinical infections of Candida in anesthesiology intensive care unit patients, and ascertains the level of genetic diversity in the Candida species. A total of 70 Candida isolates, consisting of 42 Candida albicans, 16 Candida glabrata and 12 Candida tropicalis strains isolated from various clinical sites of infection of anesthesiology intensive care unit patients, were analysed. The susceptibility of the isolates against amphotericin B and fluconazole was determined by microdilution method according to Clinical and Laboratory Standards Institute M27-A2 standards. The strains were typed by random amplified polymorphic DNA (RAPD)-PCR using OPE-03, OPE-18, RP4-2 and AP50-1 primers. In the patients with Candida infections, most isolates exhibited different RAPD patterns. Only three C. albicans pairs isolated within a short time period had the same RAPD pattern. Most of the Candida infections in the anesthesiology intensive care unit of our hospital seem to be caused by endogenous strains. Exogenous spread of C. albicans infections occurred less frequently.

Storage procedures for yeast preservation: phenotypic and genotypic evaluation

The aim of this study was to evaluate the morphological and biochemical characteristics of yeasts during storage. SixCandida spp. standard strains were stored in agarized medium with mineral oil in distilled water, frozen at −70°C and freeze dried. Strains were phenotypically characterised before being stored and then periodically for up to 18 months. Randomly Amplified Polymorphic DNA (RAPD) was carried out in time zero, 6, 12 and 18 months of storage. The viability of all samples was preserved except for the strain ofCandida dubliniensis after 12 months of storage with mineral oil. No phenotypic alterations were observed in any of the methods employed. However, variations were observed in some phospholipase or proteinase activities. Changes in the RAPD patterns were not detected. These results seem to indicate that the maintenance methods tested were able to preserve the stability of the yeast phenotypic and genotypic characteristics.

Agronomic, chemical and genetic profiles of hot peppers (Capsicum annuum ssp.)

A study on morphology, productive yield, main quality parameters and genetic variability of eight landraces of hot pepper (Capsicum annuum ssp.) from Southern Italy has been performed. Morphological characters of berries and productivity values were evaluated by agronomic analyses. Chemical and genetic investigations were performed by HPLC and random amplified polymorphic DNA (RAPD)-PCR, respectively. In particular, carotenoid and capsaicinoid (pungency) contents were considered as main quality parameters of hot pepper. For the eight selected samples, genetic similarity values were calculated from the generated RAPD fragments and a dendrogram of genetic similarity was constructed. All the eight landraces exhibited characteristic RAPD patterns that allowed their characterization. Agro-morphological and chemical determinations were found to be adequate for selection, but they resulted useful only for plants grown in the same environmental conditions. RAPD application may provide a more reliable way based on DNA identification. The results of our study led to the identification of three noteworthy populations, suitable for processing, which fitted into different clusters of the dendrogram.

Modifying effects of fermented brown rice on fecal microbiota in rats

Brown rice fermented by Aspergillus oryzae (FBRA) is a fiber-rich food. Effects of dietary administration of FBRA on rat fecal microbiota composition were examined. Male Wistar rats were fed a basal diet or a 5% FBRA- or 10% FBRA-containing diet, and fecal microbiota was analyzed by culture and terminal-restriction fragment length polymorphism (T-RFLP) analysis. The viable cell number of lactobacilli significantly increased after feeding 10% FBRA diet for 3 weeks compared with that in the basal diet group and that in the same group at the beginning of the experiment (day 0). An increase in the viable cell number of lactobacilli was also observed after feeding 10% FBRA for 12 weeks compared with the effect of a basal diet. T-RFLP analysis showed an increase in the percentage of lactobacilli cells in feces of rats fed 10% FBRA for 14 weeks. Lactobacilli strains isolated from rat feces were divided into six types based on their randomly amplified polymorphic DNA (RAPD) patterns, and they were identified as Lactobacillus reuteri, L. intestinalis and lactobacilli species based on homology of the partial sequence of 16S rDNA. FBRA contains lactic acid bacteria, but their RAPD patterns and identified species were different from those in rat feces. These results indicated that dietary FBRA increases the number of lactobacilli species already resident in the rat intestine.

Incongruence Between mtDNA Phylogeny and Morphologial and Ecological Characters in Loaches of the Genus Lefua (Balitoridae, Cypriniformes)

To elucidate the phylogenetic position of Lefua loaches from Aichi and Shizuoka Prefectures of Honshu Island, Japan, we determined their nucleotide sequences for the mitochondrial D-loop region and compared these to sequences from four other Lefua species: L. costata, L. nikkonis, L. echigonia, and L. sp. Loaches identified as L. sp. on the basis of morphology comprised a clade (the L. sp. Tokai population) that grouped together with L. echigonia; hence, the processes involved in evolution within the genus Lefua were unclear. We performed randomly amplified polymorphic DNA (RAPD) analyses to obtain genetic information on nuclear DNA. The RAPD patterns of the L. sp. Tokai population differed from those of the local L. echigonia and L. sp. populations. The L. sp. Tokai population was similar to L. echigonia with regard to mitochondrial DNA but differed from L. echigonia and L. sp. with respect to nuclear DNA; this indicated that the evolutionary background of the L. sp. Tokai population was unique. We suggest that introgression of mitochondria occurred from L. echigonia to the L. sp. Tokai population, and speculate on the process of evolution of the latter population of Lefua. As with six L. echigonia populations and two L. sp. populations, we regard the L. sp. Tokai population as an evolutionary significant unit (ESU) that qualifies for protection as an endangered loach.

Molecular characterization and determination of antimicrobial resistance of Mycoplasma gallisepticum isolated from chickens

In this study, three consecutive approaches of molecular characterization, determination of minimum inhibitory concentration (MIC) and antimicrobial tested on Mycoplasma gallisepticum (MG) isolated from chicken farms were investigated. These approaches were conducted between 2004 and 2005 to 134 MG samples collected from five different regions of the intensive farming area of Thailand. Twenty MG isolates and four reference strains including S6, F, ts-11, and 6/85 were classified according to Random Amplification of Polymorphic DNA (RAPD) patterns prior to the antimicrobial tests. These isolates exhibited 5 different genotypes (A–E). Consequently, MG isolates representing each genotype were tested on 11 registered antibiotics. The levels of MIC were determined. Three antibiotics, doxycycline (0.20 μg/ml), tiamulin (0.10 μg/ml), and tylosin (0.33 μg/ml), gave the least MICs among all effective drugs. Break point comparisons of each antimicrobial suggested that the MG isolates were most sensitive to lincomycin, oxytetracycline, tiamulin, and tylosin. Some MG isolates had an intermediate effect on josamycin and were resistant to enrofloxacin and erythromycin. Our results also indicated that MG isolated and collected from the region and nearby districts had similar RAPD patterns showing properties of antimicrobial resistance. The RAPD patterns may imply the frequent use of antibiotics and a resistant strain of MG. This is the first report of genetic characterization using RAPD reflected by the levels of MIC against MG. The information is useful to plan for prophylactic and therapeutic impacts on the poultry industry especially in the area of intensive use of antibiotics.

Genetic analyses of micropropagated and regenerated plantlets of banana as assessed by RAPD and ISSR markers

A cultivar of dessert banana, namely, Nanjanagudu Rasabale (NR), classified under group “silk” (of genotype AAB), is seriously under the threat of extinction due to its susceptibility to bacterial wilt and bunchy-top virus disease. A regeneration protocol using tissue culture method was developed (Venkatachalam et al. 2006), where a large number of plantlets were regenerated from leaf base explants. Simultaneously, a micropropagation protocol was also developed where high levels of up to 53.28 μM of benzylamino purine (BAP) and 55.80 μM of kinetin (Kn) were used. The progressive increase of cytokinins levels resulted in concomitant increase in shoot number, with a maximum of 80 shoot buds per segment in BAP (31.08 μM). The plantlets were analyzed for their genetic stability using randomly amplified polymorphic DNA (RAPD) and inter simple sequence repeats (ISSR) markers. A total of 50 RAPD and 12 ISSR primers resulted in 625 distinct and reproducible bands showing homogeneous RAPD and ISSR patterns. Band intensity histogram of each gel confirmed their monomorphic nature with no genetic variation among the plantlets analyzed. The present study has established for the first time that the regeneration and rapid micropropagation protocol developed through the present study will be of great use in conserving the endangered cultivar – NR – without risk of genetic instability.

Genetic relationships and molecular authentication of plant origins and the commercial medicinal herbs in peony using RAPD markers

Genetic polymorphism and molecular authentication were investigated with the commercial medicinal herb, Peony (Paeonia spp.), using random amplified polymorphic DNA (RAPD) markers. To identify the polymorphism of the RAPD patterns among plant origins, 20 different random primers were applied to the genomic DNA extracted from Paeonia spp. plants such as Paeonia (P.) lactiflora, P. officinale and P. japonica. Ten primers out of 20 primers could be used to discriminate the plant species in the same genus and 72 out of 81 scored DNA fragments (88.9%) generated with these primers were polymorphic. Especially, four primers, such as OPA1, OPA3, OP9, and OPA13, were useful to discriminate the plant origins among the species of Peony. In the results of cluster analysis using RAPD data obtained from the 10 primers, Peony (Paeonia spp.) plants used in this study were grouped into the two distinctive clusters, genetically. Herb medicine, especially P. lactiflora, were easily identified, when species-specific primers were applied to the investigation for discriminating herb medicine currently traded in domestic herb market, Kyungdongmart. Consequently, RAPD analysis was useful method to discriminate plant origins and the commercial medicinal herbs, Paeonia spp..

Comparison of Curcuma sp. in Yakushima with C. aeruginosa and C. zedoaria in Java by trnK gene sequence, RAPD pattern and essential oil component

As the result of a comparison of Curcuma sp. (Gajutsu in Japanese) in Yakushima Island, Japan, with Curcuma aeruginosa and C. zedoaria in Java, Indonesia, by trnK gene sequence, random amplified polymorphic DNA (RAPD) pattern and essential oil component, it is indicated that Curcuma sp. in Yakushima is more closely related to C. aeruginosa than to C. zedoaria.

Epidemiological Analysis of Erysipelothrix Isolates from Various Animals by Acriflavine Resistance and RAPD Typing

The epidemiological analysis of Erysipelothrix isolates recovered from pigs, cattle and chickens was studied by the analysis of acriflavine resistance and the PCR-based DNA fingerprinting method using random amplified polymorphic DNA (RAPD). Thirty-two Erysipelothrix field isolates, 7 Erysipelothrix reference strains and 13 random primers were tested. Among the tested primers, the primers NK6 (CCCGCGCCCC) and D9355 (CCGGATCCGTGATGCGGTGCG) produced noticeable results. The primer NK6 revealed 5 RAPD patterns (a∼e) while primer D9355 revealed 8 RAPD patterns (A∼H) that were not serovar specific. Namely, different patterns were produced among strains of the same serovar showing that the RAPD method is able to identify the genetic variations of Erysipelothrix species but the RAPD data demonstrated that the some serovar 1a E. rhusiopathiae strains including strain Koganei 65-0.15 for the production of live vaccine were closely related each other genetically, irrespective of their acriflavine resistance. Based on these results, we concluded that the RAPD method with primer D9355 is a rapid and reliable method to differentiate Erysipelothrix isolates from various animals ; and might be a useful tool for the epidemiological analysis of the Erysipelothrix species.

Diversity of swine Bordetella bronchiseptica isolates evaluated by RAPD analysis and PFGE

The degree of genetic diversity in 45 Bordetella (B.) bronchiseptica strains comprised of a vaccine strain (N = 1), reference strains (N = 3) and field isolates (N = 41) was evaluated using random amplified polymorphic DNA (RAPD) fingerprinting and pulsed-field gel electrophoresis (PFGE). Three candidate primers were selected for RAPD analysis after screening 20 random decamer oligonucleotides for their discriminatory abilities. The OPA-07, OPA-08 and OPA-18 primers yielded 10, 10, and 6 distinct fingerprint patterns, respectively. The most common identical RAPD pattern was produced by OPA-07 which was shared by 32 isolates (71.1%), the pattern produced by OPA-08 was shared by 26 isolates (57.8%), and the pattern produced by OPA-18 was shared by 40 isolates (88.9%). The RAPD patterns of the vaccine strain and the 3 reference strains did not match any of the patterns produced by the field isolates when primers OPA-07 and OPA-08 were used. PFGE using the restriction endonuclease XbaI produced a total of 15 patterns consisting of 4 PFGE types (A, B, B1 and C, differing by ≥ 4 bands) and 11 A subtypes (differing by ≤ 3 bands). Most of the field isolates exhibited identical type A and B patterns, suggesting that they were related. The vaccine strain and the three reference strains showed different PFGE patterns as compared to the identical type A strains.

Pathological and molecular diversity inColletotrichum lindemuthianum(bean anthracnose) across Himachal Pradesh, a north-western Himalayan state of India

Ninety isolates of Colletotrichum lindemuthianum collected from commercial bean growing areas of Himachal Pradesh were characterised on international differential bean varieties and analysed by random amplified polymorphic DNA (RAPD) analysis for elucidation of variability. Virulence analysis of 90 isolates on a differential set categorised them into 29 pathogenic races. Out of these, 12 races resembled American and European virulences, whereas 17 races (101, 103, 115, 119, 131, 195, 537, 551, 581, 598, 613, 615, 631, 639, 707, 775 and 935) were identified as new, thereby enhancing the total race number to more than 140 globally. RAPD data analysis with nine 10-mer random primers producing polymorphic bands, grouped 90 isolates into two major clusters accommodating 36 and 54 isolates, respectively. There was no congruence between the RAPD pattern and virulence phenogram. Interaction analysis among the races and the two Phaseolus vulgaris gene pools indicated that most of the races were virulent on both Andean and Mesoamerican gene pools. Virulence and avirulence interactions between isolates and differential cultivars provided valuable information for resistance to Indian virulences of the anthracnose pathogen, as four differential cultivars (AB 136, Cornell 49242, G 2333 and TO) possessing different resistance genes were resistant to most of the Indian races.

Genetic Diversity of Stenotrophomonas maltophilia Isolated from Clinical Specimens

Stenotrophomonas maltophilia is a multi-drug resistant pathogen that has been isolated with increasing frequency from the hospitalized patients. A total of 202 S. maltophilia was isolated from three university hospitals and analysed by molecular typing for an epidemiologic investigation. All isolates were tested by antimicrobial susceptibility, random amplified polymorphic DNA (RAPD) analysis, and pulsed-field gel electrophoresis (PFGE). The RAPD and PFGE patterns were recorded and analysed by the unweighted-pair group method with arithmetic average method. Two or more isolates were considered to be clonally related if their PFGE pattern exhibited ≥80% similarity. Trimethoprim/ sulfamethoxazole and ciprofloxacin were the most active antimicrobial agents tested. The majority of the isolates found to be genetically unrelated by PFGE. The genetically related isolates were recovered from the same patient. The result demonstrates a high genetic diversity of S. maltophilia isolates from clinical specimens. The clonal diversity of S. maltophilia from the hospitalized patients is partly due to the strains originated from the hospital environments, but not horizontal transfer between the patients.

Intra-specific relationships among Tibetan Eared-pheasants based on randomly amplified polymorphic DNA (RAPD) analysis

The Tibetan Eared-pheasant Crossoptilon harmani is a rare species native to China. A captive population has been established in the Beijing Zoo since 1999. In order to determine the kinship of the offsprings in 2001, randomly amplified polymorphic DNA (RAPD) was used to examine the parenthood of seven Tibetan Eared-pheasants in the Beijing Zoo. To amplify the genomic DNA of each individual, 53 arbitrary primers were selected. The results of amplifications showed that 14 primers had clear and distinct RAPD patterns. Totally, 226 amplified fragments were generated by RAPD in this study. Cluster analysis of the seven Tibetan Eared-pheasants indicated that all the four young birds had the same father (No.5 male). This study provides a practical method to determine the relationship of offsprings whose parents are unknown in birds.

Characterization of Fusarium oxysporum f. sp. fragariae Based on Vegetative Compatibility Group, Random Amplified Polymorphic DNA and Pathogenicity

Twenty-two isolates of Fusarium oxysporum f. sp. fragariae were obtained from diseased strawberry plants and their characteristics were investigated by vegetative compatibility group (VCG), random amplified polymorphic DNA (RAPD), and pathogenicity. Three major VCGs (A, B, and C) and one incompatible group were identified by nitrate reductase complementation test. The virulence pattern of the 22 isolates was studied in relation to four cultivars including Dochiodome, Red-pearl, Maehyang and Akihime. RAPD markers were used to determine genetic relationship, and created three major clusters among the 22 isolates of F. oxysporum f. sp. fragariae. Isolates belong to VCG-C were strongly pathogenic, and relatively high correlation was existed among VCG and RAPD, and virulence. In addition, VCG and RAPD pattern between pathogenic and non-pathogenic isolates were distinctly different.