Protein Transfection Research Articles

Enhancing genetic modification in recalcitrant plants: An investigation in chili (Capsicum annuum) through the optimized tape sandwich protoplast isolation and polyethylene glycol-mediated transfection

Chili presents challenges for Agrobacterium-mediated transfection due to its highly recalcitrant nature. One way to overcome this challenge is by using PEG-mediated transfection of protoplasts, which enhances the likelihood of successfully introducing transgenes into the cells. The tape sandwich method for isolating chili leaf protoplasts was optimized by adjusting enzyme concentrations and incubation duration, resulting in a high yield of 1.3×106 cells ml-1 per 0.1 g of leaves. The efficiency of transfecting GFP-encoding plasmids and Cas9 protein using PEG molecules of different sizes was also examined. The highest plasmid transfection efficiency was achieved with 5 µg of plasmid in 50 µl-1, with an average efficiency of 48.71%. For Cas9 protein transfection, the most effective treatment involved using 1000 µg of protein in 100 µl-1, mediated by 40% PEG 4000, resulting in an average efficiency of 2.94% due to protein aggregation. Nevertheless, this optimized protocol reduces the time required for chili protoplast isolation and enhances plasmid transfection efficiency by nearly 50%.

Evaluating SARS-CoV-2 Spike Protein Transfection in HEK-293T Cells for VLP Applications

Evaluating SARS-CoV-2 Spike Protein Transfection in HEK-293T Cells for VLP Applications

Engineering PEG10assembled endogenous virus-like particles with genetically encoded neoantigen peptides for cancer vaccination.

Tumor neoantigen peptide vaccines hold potential for boosting cancer immunotherapy, yet efficiently co-delivering peptides and adjuvants to antigen-presenting cells in vivo remains challenging. Virus-like particle (VLP), which is a kind of multiprotein structure organized as virus, can deliver therapeutic substances into cells and stimulate immune response. However, the weak targeted delivery of VLP in vivo and its susceptibility to neutralization by antibodies hinder their clinical applications. Here, we first designed a novel protein carrier using the mammalian-derived capsid protein PEG10, which can self-assemble into endogenous VLP (eVLP) with high protein loading and transfection efficiency. Then, an engineered tumor vaccine, named ePAC, was developed by packaging genetically encoded neoantigen into eVLP with further modification of CpG-ODN on its surface to serve as an adjuvant and targeting unit to dendritic cells (DCs). Significantly, ePAC can efficiently target and transport neoantigens to DCs, and promote DCs maturation to induce neoantigen-specific T cells. Moreover, in mouse orthotopic liver cancer and humanized mouse tumor models, ePAC combined with anti-TIM-3 exhibited remarkable antitumor efficacy. Overall, these results support that ePAC could be safely utilized as cancer vaccines for antitumor therapy, showing significant potential for clinical translation.

Engineering PEG10-assembled endogenous virus-like particles with genetically encoded neoantigen peptides for cancer vaccination

Tumor neoantigen peptide vaccines hold potential for boosting cancer immunotherapy, yet efficiently co-delivering peptides and adjuvants to antigen-presenting cells in vivo remains challenging. Virus-like particle (VLP), which is a kind of multiprotein structure organized as virus, can deliver therapeutic substances into cells and stimulate immune response. However, the weak targeted delivery of VLP in vivo and its susceptibility to neutralization by antibodies hinder their clinical applications. Here, we first designed a novel protein carrier using the mammalian-derived capsid protein PEG10, which can self-assemble into endogenous VLP (eVLP) with high protein loading and transfection efficiency. Then, an engineered tumor vaccine, named ePAC, was developed by packaging genetically encoded neoantigen into eVLP with further modification of CpG-ODN on its surface to serve as an adjuvant and targeting unit to dendritic cells (DCs). Significantly, ePAC can efficiently target and transport neoantigens to DCs, and promote DCs maturation to induce neoantigen-specific T cells. Moreover, in mouse orthotopic liver cancer and humanized mouse tumor models, ePAC combined with anti-TIM-3 exhibited remarkable antitumor efficacy. Overall, these results support that ePAC could be safely utilized as cancer vaccines for antitumor therapy, showing significant potential for clinical translation.

Pyruvate kinase M2 sustains cardiac mitochondrial quality surveillance in septic cardiomyopathy by regulating prohibitin 2 abundance via S91 phosphorylation

The endogenous mitochondrial quality control (MQC) system serves to protect mitochondria against cellular stressors. Although mitochondrial dysfunction contributes to cardiac damage during many pathological conditions, the regulatory signals influencing MQC disruption during septic cardiomyopathy (SC) remain unclear. This study aimed to investigate the involvement of pyruvate kinase M2 (PKM2) and prohibitin 2 (PHB2) interaction followed by MQC impairment in the pathogenesis of SC. We utilized LPS-induced SC models in PKM2 transgenic (PKM2TG) mice, PHB2S91D-knockin mice, and PKM2-overexpressing HL-1 cardiomyocytes. After LPS-induced SC, cardiac PKM2 expression was significantly downregulated in wild-type mice, whereas PKM2 overexpression in vivo sustained heart function, suppressed myocardial inflammation, and attenuated cardiomyocyte death. PKM2 overexpression relieved sepsis-related mitochondrial damage via MQC normalization, evidenced by balanced mitochondrial fission/fusion, activated mitophagy, restored mitochondrial biogenesis, and inhibited mitochondrial unfolded protein response. Docking simulations, co-IP, and domain deletion mutant protein transfection experiments showed that PKM2 phosphorylates PHB2 at Ser91, preventing LPS-mediated PHB2 degradation. Additionally, the A domain of PKM2 and the PHB domain of PHB2 are required for PKM2-PHB2 binding and PHB2 phosphorylation. After LPS exposure, expression of a phosphorylation-defective PHB2S91A mutant negated the protective effects of PKM2 overexpression. Moreover, knockin mice expressing a phosphorylation-mimetic PHB2S91D mutant showed improved heart function, reduced inflammation, and preserved mitochondrial function following sepsis induction. Abundant PKM2 expression is a prerequisite to sustain PKM2-PHB2 interaction which is a key element for preservation of PHB2 phosphorylation and MQC, presenting novel interventive targets for the treatment of septic cardiomyopathy.

Improved CaP Nanoparticles for Nucleic Acid and Protein Delivery to Neural Primary Cultures and Stem Cells.

Efficiently delivering exogenous materials into primary neurons and neural stem cells (NSCs) has long been a challenge in neurobiology. Existing methods have struggled with complex protocols, unreliable reproducibility, high immunogenicity, and cytotoxicity, causing a huge conundrum and hindering in-depth analyses. Here, we establish a cutting-edge method for transfecting primary neurons and NSCs, named teleofection, by a two-step process to enhance the formation of biocompatible calcium phosphate (CaP) nanoparticles. Teleofection enables both nucleic acid and protein transfection into primary neurons and NSCs, eliminating the need for specialized skills and equipment. It can easily fine-tune transfection efficiency by adjusting the incubation time and nanoparticle quantity, catering to various experimental requirements. Teleofection's versatility allows for the delivery of different cargos into the same cell culture, whether simultaneously or sequentially. This flexibility proves invaluable for long-term studies, enabling the monitoring of neural development and synapse plasticity. Moreover, teleofection ensures the consistent and robust expression of delivered genes, facilitating molecular and biochemical investigations. Teleofection represents a significant advancement in neurobiology, which has promise to transcend the limitations of current gene delivery methods. It offers a user-friendly, cost-effective, and reproducible approach for researchers, potentially revolutionizing our understanding of brain function and development.

Chitosan-Functionalized Poly(β-Amino Ester) Hybrid System for Gene Delivery in Vaginal Mucosal Epithelial Cells.

Gene therapy displays great promise in the treatment of cervical cancer. The occurrence of cervical cancer is highly related to persistent human papilloma virus (HPV) infection. The HPV oncogene can be cleaved via gene editing technology to eliminate carcinogenic elements. However, the successful application of the gene therapy method depends on effective gene delivery into the vagina. To improve mucosal penetration and adhesion ability, quaternized chitosan was introduced into the poly(β-amino ester) (PBAE) gene-delivery system in the form of quaternized chitosan-g-PBAE (QCP). At a mass ratio of PBAE:QCP of 2:1, the polymers exhibited the highest green fluorescent protein (GFP) transfection efficiency in HEK293T and ME180 cells, which was 1.1 and 5.4 times higher than that of PEI 25 kD. At this mass ratio, PBAE-QCP effectively compressed the GFP into spherical polyplex nanoparticles (PQ-GFP NPs) with a diameter of 255.5 nm. In vivo results indicated that owing to the mucopenetration and adhesion capability of quaternized CS, the GFP transfection efficiency of the PBAE-QCP hybrid system was considerably higher than those of PBAE and PEI 25 kD in the vaginal epithelial cells of Sprague-Dawley rats. Furthermore, the new system demonstrated low toxicity and good safety, laying an effective foundation for its further application in gene therapy.

Enrichment and Delivery of Target Proteins into the Cell Cytosol via Outer Membrane Vesicles.

Advanced intracellular delivery of proteins has profound applications in both scientific investigations and therapies. However, existing strategies relying on various chemical and physical methods have drawbacks such as the requirement of high concentrations of in vitro prepared target proteins and difficulty in labeling target proteins. Developing new delivery systems integrating the enveloping and labeling of target proteins would bring great advantages for efficient protein transfections. Here, we enriched a high concentration (62 mg/mL) of several target proteins into the outer membrane vesicles (OMVs) of Escherichia coli to employ the native property of OMVs to deliver proteins into the cytosol of eukaryotic cells. The results revealed a high protein transfection efficiency from 90 to 97% for different cell lines. Moreover, the free penetration of molecules less than 600 Da across the membrane of OMVs allows direct labeling of target proteins within OMVs, facilitating the visualization of target proteins. Importantly, the nanobody delivered intracellularly by OMVs retains the biological activity of binding with its target, highlighting the advantages of OMVs as an emerging tool for efficient intracellular delivery of proteins.

Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E)protein-encoding sequenceand luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.

LAMP3 transfer via extracellular particles induces apoptosis in Sjögren’s disease

Sjögren’s disease (SjD) is an autoimmune disease that affects exocrine tissues and is characterized by increased apoptosis in salivary and lacrimal glands. Although the pathogenic mechanism triggering SjD is not well understood, overexpression of lysosome-associated membrane protein 3 (LAMP3) is associated with the disease in a subset of SjD patients and the development of SjD-like phenotype in mice. In this study, histological analysis of minor salivary glands of SjD patients suggested that LAMP3-containing material is being ejected from cells. Follow-on in vitro experiments with cells exposed to extracellular particles (EPs) derived from LAMP3-overexpressing cells showed increased apoptosis. Proteomics identified LAMP3 as a major component of EPs derived from LAMP3-overexpressing cells. Live-cell imaging visualized release and uptake of LAMP3-containing EPs from LAMP3-overexpressing cells to naïve cells. Furthermore, experiments with recombinant LAMP3 protein alone or complexed with Xfect protein transfection reagent demonstrated that internalization of LAMP3 was required for apoptosis in a caspase-dependent pathway. Taken together, we identified a new role for extracellular LAMP3 in cell-to-cell communication via EPs, which provides further support for targeting LAMP3 as a therapeutic approach in SjD.

Plasmid-free CRISPR/Cas9 genome editing in Saccharomyces cerevisiae.

The current CRISPR/Cas9 systems in the yeast Saccharomyces cerevisiae cannot be considered a non-genetic modification technology because it requires the introduction of Cas9 and sgRNA into yeast cells using plasmid expression systems. Our present study showed that the yeast genome can be edited without plasmid expression systems by using a commercially available protein transfection reagent and chemically modified sgRNAs.

Apolipoprotein A-IV reduced metabolic inflammation in white adipose tissue by inhibiting IKK and JNK signaling in adipocytes

Apolipoprotein A-IV reduced metabolic inflammation in white adipose tissue by inhibiting IKK and JNK signaling in adipocytes

Neofunctionalization of a Noncoding Portion of a DNA Transposon in the Coding Region of the Chimerical Sex-Determining Gene dm-W in Xenopus Frogs.

Most vertebrate sex-determining genes (SDGs) emerge as neofunctionalized genes through duplication and/or mutation of ancestral genes that are involved with sexual differentiation. We previously demonstrated dm-W to be the SDG in the African clawed frog Xenopus laevis and found that a portion of this gene emerged from the masculinization gene dmrt1 after allotetraploidization by interspecific hybridization between two ancestral species around 17–18 Ma. dm-W has four exons consisting of a noncoding exon 1, dmrt1-derived exons 2 and 3, and an orphan exon 4 (Ex4) of unknown origin that includes coding sequence (CDS). In this study, we searched for the origin of Ex4 and investigated the function of the CDS of this exon. We found that the Ex4-CDS is derived from a noncoding portion of the hAT-10 family of DNA transposon. Evolutionary analysis of transposons and determination of the Ex4 sequences from three other species indicated that Ex4 was generated before the diversification of most or all extant allotetraploid species in subgenus Xenopus, during which time we hypothesize that transposase activity of this hAT superfamily was active. Using DNA–protein binding and transfection assays, we further demonstrate that the Ex4-encoded amino acid sequence increases the DNA-binding ability and transrepression activity of DM-W. These findings suggest that the conversion of the noncoding transposon sequence to the CDS of dm-W contributed to neofunctionalization of a new chimeric SDG in the ancestor of the allotetraploid Xenopus species, offering new insights into de novo origin and functional evolution of chimerical genes.

Transfection of Heat Shock Protein 70 kDa (HSP70)

Heat shock protein 70 kDa (HSP70) is a major protein family in the cell protections against stress-induced denaturation and aggregation and in the folding of nascent proteins. It is a highly conserved protein that can be found in most organisms and is strongly connected to several intracellular pathways such as protein folding and refolding, protein degradation and regulation, and protection against intense stress. Cellular delivery of HSP70 would be of high impact for clarification of its role in these cellular processes.PepFect14 is a cell-penetrating peptide known to be able to mediate the transfection of various oligonucleotides to multiple cell lines with a higher efficacy than most commercially available transfection agents and without inducing significant toxic effects.In this study we demonstrated that PepFect14 was able to form a complex with HSP70 and to deliver it inside cells in the same fashion with oligonucleotide delivery. The delivered HSP70 showed an effect in the cell regulation indicating that the protein was biologically available in the cytoplasm and the interactions with PepFect14 did not impeach its active sites once the plasma barrier crossed.This study reports the first successful delivery of HSP70 to our knowledge and the first protein transfection mediated by PepFect14. It opens new fields of research for both PepFect14 as a delivery agent and HSP70 as a therapeutic agent; with potential in peptide aggregation caused diseases such as Parkinson’s and Alzheimer’s diseases.

TAQing2.0 for genome reorganization of asexual industrial yeasts by direct protein transfection

Genomic rearrangements often generate phenotypic diversification. We previously reported the TAQing system where genomic rearrangements are induced via conditional activation of a restriction endonuclease in yeast and plant cells to produce mutants with marked phenotypic changes. Here we developed the TAQing2.0 system based on the direct delivery of endonucleases into the cell nucleus by cell-penetrating peptides. Using the optimized procedure, we introduce a heat-reactivatable endonuclease TaqI into an asexual industrial yeast (torula yeast), followed by a transient heat activation of TaqI. TAQing2.0 leads to generation of mutants with altered flocculation and morphological phenotypes, which exhibit changes in chromosomal size. Genome resequencing suggested that torula yeast is triploid with six chromosomes and the mutants have multiple rearrangements including translocations having the TaqI recognition sequence at the break points. Thus, TAQing2.0 is expected as a useful method to obtain various mutants with altered phenotypes without introducing foreign DNA into asexual industrial microorganisms.

Delivery of target proteins through microfluidics supports increased cell viability for in-cell NMR spectroscopy

Delivery of target proteins through microfluidics supports increased cell viability for in-cell NMR spectroscopy

Protein transfection via spherical nucleic acids.

The efficient transfection of functional proteins into cells can serve as a means for regulating cellular processes toward solving fundamental challenges in biology and medicine. However, the use of proteins as effective intracellular agents is hindered by their low cellular uptake and susceptibility to degradation. Over the past 15 years, our group has been developing spherical nucleic acids (SNAs), nanoparticles functionalized with a dense radially oriented shell of nucleic acids. These structures actively enter cells and have opened new frontiers in chemical sensing, biodiagnostics and therapeutics. Recently, we have shown that proteins can be used as structurally precise and homogeneous nanoparticle cores in SNAs. The resultant protein SNAs (ProSNAs) allow previously cell-impermeable proteins to actively enter cells, exhibit high degrees of stability and activity both in cell culture and in vivo, and show enhanced pharmacokinetics. Consequently, these modular structures constitute a plug-and-play platform in which the protein core and nucleic acid shell can be independently varied to achieve a desired function. Here, we describe the synthesis of ProSNAs through the chemical modification of solvent-accessible surface residues (3-5 d). We also discuss design considerations, strategies for characterization, and applications of ProSNAs in cellular transfection, biological sensing and functional enzyme delivery in vivo.

Cell-penetrating peptide-mediated transfection of proteins into tissues of Arabidopsis and Chinese cabbage

Cell-penetrating peptide-mediated transfection of proteins into tissues of Arabidopsis and Chinese cabbage

Cancer microcell initiation and determination

BackgroundCancer remains one of the leading causes of death worldwide, despite the possibilities to detect early onset of the most common cancer types. The search for the optimal therapy is complicated by the cancer diversity within tumors and the unsynchronized development of cancerous cells. Therefore, it is necessary to characterize cancer cell populations after treatment has been applied, because cancer recurrence is not rare. In our research, we concentrated on small cancer cell subpopulation (microcells) that has a potential to be cancer resistance source. Previously made experiments has shown that these cells in small numbers form in specific circumstances after anticancer treatment.MethodsIn experiments described in this research, the anticancer agents’ paclitaxel and doxorubicin were used to stimulate the induction of microcells in fibroblast, cervix adenocarcinoma, and melanoma cell lines. Mainly for the formation of microcells in melanoma cells. The drug-stimulated cells were then characterized in terms of their formation efficiency, morphology, and metabolic activity.ResultsWe observed the development of cancer microcells and green fluorescent protein (GFP) transfection efficiency after stress. In the time-lapse experiment, we observed microcell formation through a renewal process and GFP expression in the microcells. Additionally, the microcells were viable after anticancer treatment, as indicated by the nicotinamide adenine dinucleotide hydrogen phosphate (NADPH) enzyme activity assay results. Taken together, these findings indicate that cancer microcells are viable and capable of resisting the stress induced by anticancer drugs, and these cells are prone to chemical substance uptake from the environment.ConclusionMicrocells are not only common to a specific cancer type, but can be found in any tumor type. This study could help to understand cancer emergence and recurrence. The appearance of microcells in the studied cancer cell population could be an indicator of the individual anticancer therapy effectiveness and patient survival.

364 Mechanical forces of human dermal fibroblasts significantly decrease with age

364 Mechanical forces of human dermal fibroblasts significantly decrease with age