Related Topics
Articles published on Protein Transfection
Authors
Select Authors
Journals
Select Journals
Duration
Select Duration
184 Search results
Sort by Recency
- Research Article
- 10.1038/s41421-025-00840-x
- Oct 21, 2025
- Cell Discovery
- Rudi Mao + 14 more
Bacterial pathogens have evolved multiple mechanisms to modulate host cell death, evade host immunity, and establish persistent infection. Here, we show that an infective endocarditis causative pathogen, Bergeyella cardium, is frequently detected in oral specimens from clinical patients. A variant strain of Bergeyella cardium (BCV) induces unique cytoplasmic vacuolization cell death and minor apoptosis-like cell death in macrophages. The cytoplasmic vacuolization cell death triggered by BCV is characterized by Fused LysosOme-Associated Termination (floatptosis) and is inhibited by the sodium channel inhibitor amiloride. Moreover, outer membrane vesicles (OMVs) or transfection of barrel-like membrane proteins, lipocalin, β-barrel, and PorV, dramatically induce cytoplasmic vacuolization. Endosomal solute carrier family 9 member A9 (SLC9A9) plays important roles in the process of BCV-, OMVs-, and barrel-like proteins-triggered cytoplasmic vacuolization cell death via promoting vacuole fusion. SLC9A9 deficiency or amiloride administration increases host defense against BCV infection. These findings contribute to developing novel approaches to modulate cytoplasmic vacuolization cell death and treat infectious diseases.
- Research Article
- 10.1016/j.yjmcc.2025.07.003
- Aug 1, 2025
- Journal of molecular and cellular cardiology
- Fengyang Xu + 9 more
Soluble αKlotho interacts with Hsp90aa1 to inhibit the chaperone machinery-mediated Hif1α stabilization and alleviate CKD-induced vascular calcification.
- Research Article
1
- 10.21776/ub.jels.2025.015.02.01
- Jun 30, 2025
- The Journal of Experimental Life Sciences
- Ilmiana Nurur Rohmah + 7 more
Corrigendum: Evaluating SARS-CoV-2 Spike Protein Transfection in HEK-293T Cells for VLP Applications
- Research Article
5
- 10.1016/j.biomaterials.2024.123079
- Jun 1, 2025
- Biomaterials
- Arun R.K Kumar + 20 more
Non-viral, high throughput genetic engineering of primary immune cells using nanostraw-mediated transfection.
- Research Article
- 10.2147/sccaa.s519338
- May 1, 2025
- Stem cells and cloning : advances and applications
- Ratih Rinendyaputri + 6 more
Mesenchymal stem cells (MSCs) have a paracrine impact and may regenerate a variety of tissues. This represents a new prospect in cell-based stroke treatment. Several in vitro and in vivo investigations have demonstrated the neuroprotective and neurogenesis properties of MSCs and their secretome. This review provides a comprehensive analysis of the therapeutic effects of MSCs and their secretome on stroke models in vitro and in vivo. A coverage evaluation is undertaken in accordance with PRISMA-ScR principles. The selection procedure includes the identification of items. Scopus site, PubMed and ScienceDirect, are used for in vitro and in vitro research, including electronic searches. The search terms include "ischemic stroke" or "MCAO", "MSC", "secretome", and "neurogenesis" or "angiogenesis". The searches are limited to English-language articles with full text availability. After selecting 390 papers from two search engines, 94 publications satisfied the review criteria for using MSCs and secretomes for ischemic stroke treatment. We comprehensively review both in vitro and in vivo studies, analyzing aspects such as the source and treatment of MSCs and secretomes, as well as administration, dosage, and mechanisms of therapeutic effects in stroke models. MSC and secretome therapy for stroke have shown promising results in both in vitro and in vivo models. Exploration of alternative MSC sources, refining of isolation techniques, transfection of various proteins, and combination with herbal medicine are all efforts to improve the preclinical model. This work can be used as a reference for preclinical researchers to help with research design and translational research in clinical trials.
- Research Article
1
- 10.5511/plantbiotechnology.24.0613a
- Dec 25, 2024
- Plant Biotechnology
- Hanggara Aji Sakti Mahambara Padma Negara + 5 more
Chili presents challenges for Agrobacterium-mediated transfection due to its highly recalcitrant nature. One way to overcome this challenge is by using PEG-mediated transfection of protoplasts, which enhances the likelihood of successfully introducing transgenes into the cells. The tape sandwich method for isolating chili leaf protoplasts was optimized by adjusting enzyme concentrations and incubation duration, resulting in a high yield of 1.3×106 cells ml-1 per 0.1 g of leaves. The efficiency of transfecting GFP-encoding plasmids and Cas9 protein using PEG molecules of different sizes was also examined. The highest plasmid transfection efficiency was achieved with 5 µg of plasmid in 50 µl-1, with an average efficiency of 48.71%. For Cas9 protein transfection, the most effective treatment involved using 1000 µg of protein in 100 µl-1, mediated by 40% PEG 4000, resulting in an average efficiency of 2.94% due to protein aggregation. Nevertheless, this optimized protocol reduces the time required for chili protoplast isolation and enhances plasmid transfection efficiency by nearly 50%.
- Research Article
- 10.21776/ub.jels.2024.014.03.02
- Oct 30, 2024
- The Journal of Experimental Life Sciences
- Ilmiana Nurur Rohmah + 6 more
Evaluating SARS-CoV-2 Spike Protein Transfection in HEK-293T Cells for VLP Applications
- Research Article
2
- 10.7554/elife.98579
- Sep 13, 2024
- eLife
- Ruijing Tang + 10 more
Tumor neoantigen peptide vaccines hold potential for boosting cancer immunotherapy, yet efficiently co-delivering peptides and adjuvants to antigen-presenting cells in vivo remains challenging. Virus-like particle (VLP), which is a kind of multiprotein structure organized as virus, can deliver therapeutic substances into cells and stimulate immune response. However, the weak targeted delivery of VLP in vivo and its susceptibility to neutralization by antibodies hinder their clinical applications. Here, we first designed a novel protein carrier using the mammalian-derived capsid protein PEG10, which can self-assemble into endogenous VLP (eVLP) with high protein loading and transfection efficiency. Then, an engineered tumor vaccine, named ePAC, was developed by packaging genetically encoded neoantigen into eVLP with further modification of CpG-ODN on its surface to serve as an adjuvant and targeting unit to dendritic cells (DCs). Significantly, ePAC can efficiently target and transport neoantigens to DCs, and promote DCs maturation to induce neoantigen-specific T cells. Moreover, in mouse orthotopic liver cancer and humanized mouse tumor models, ePAC combined with anti-TIM-3 exhibited remarkable antitumor efficacy. Overall, these results support that ePAC could be safely utilized as cancer vaccines for antitumor therapy, showing significant potential for clinical translation.
- Research Article
4
- 10.7554/elife.98579.3
- Sep 13, 2024
- eLife
- Ruijing Tang + 10 more
Tumor neoantigen peptide vaccines hold potential for boosting cancer immunotherapy, yet efficiently co-delivering peptides and adjuvants to antigen-presenting cells in vivo remains challenging. Virus-like particle (VLP), which is a kind of multiprotein structure organized as virus, can deliver therapeutic substances into cells and stimulate immune response. However, the weak targeted delivery of VLP in vivo and its susceptibility to neutralization by antibodies hinder their clinical applications. Here, we first designed a novel protein carrier using the mammalian-derived capsid protein PEG10, which can self-assemble into endogenous VLP (eVLP) with high protein loading and transfection efficiency. Then, an engineered tumor vaccine, named ePAC, was developed by packaging genetically encoded neoantigen into eVLP with further modification of CpG-ODN on its surface to serve as an adjuvant and targeting unit to dendritic cells (DCs). Significantly, ePAC can efficiently target and transport neoantigens to DCs, and promote DCs maturation to induce neoantigen-specific T cells. Moreover, in mouse orthotopic liver cancer and humanized mouse tumor models, ePAC combined with anti-TIM-3 exhibited remarkable antitumor efficacy. Overall, these results support that ePAC could be safely utilized as cancer vaccines for antitumor therapy, showing significant potential for clinical translation.
- Research Article
10
- 10.1007/s00018-024-05253-9
- Jun 10, 2024
- Cellular and Molecular Life Sciences
- Yingzhen Du + 8 more
The endogenous mitochondrial quality control (MQC) system serves to protect mitochondria against cellular stressors. Although mitochondrial dysfunction contributes to cardiac damage during many pathological conditions, the regulatory signals influencing MQC disruption during septic cardiomyopathy (SC) remain unclear. This study aimed to investigate the involvement of pyruvate kinase M2 (PKM2) and prohibitin 2 (PHB2) interaction followed by MQC impairment in the pathogenesis of SC. We utilized LPS-induced SC models in PKM2 transgenic (PKM2TG) mice, PHB2S91D-knockin mice, and PKM2-overexpressing HL-1 cardiomyocytes. After LPS-induced SC, cardiac PKM2 expression was significantly downregulated in wild-type mice, whereas PKM2 overexpression in vivo sustained heart function, suppressed myocardial inflammation, and attenuated cardiomyocyte death. PKM2 overexpression relieved sepsis-related mitochondrial damage via MQC normalization, evidenced by balanced mitochondrial fission/fusion, activated mitophagy, restored mitochondrial biogenesis, and inhibited mitochondrial unfolded protein response. Docking simulations, co-IP, and domain deletion mutant protein transfection experiments showed that PKM2 phosphorylates PHB2 at Ser91, preventing LPS-mediated PHB2 degradation. Additionally, the A domain of PKM2 and the PHB domain of PHB2 are required for PKM2-PHB2 binding and PHB2 phosphorylation. After LPS exposure, expression of a phosphorylation-defective PHB2S91A mutant negated the protective effects of PKM2 overexpression. Moreover, knockin mice expressing a phosphorylation-mimetic PHB2S91D mutant showed improved heart function, reduced inflammation, and preserved mitochondrial function following sepsis induction. Abundant PKM2 expression is a prerequisite to sustain PKM2-PHB2 interaction which is a key element for preservation of PHB2 phosphorylation and MQC, presenting novel interventive targets for the treatment of septic cardiomyopathy.
- Research Article
9
- 10.1021/acsnano.3c09608
- Jan 29, 2024
- ACS Nano
- Yu-Wen Chao + 13 more
Efficiently delivering exogenous materials into primaryneuronsand neural stem cells (NSCs) has long been a challenge in neurobiology.Existing methods have struggled with complex protocols, unreliablereproducibility, high immunogenicity, and cytotoxicity, causing ahuge conundrum and hindering in-depth analyses. Here, we establisha cutting-edge method for transfecting primary neurons and NSCs, namedteleofection, by a two-step process to enhance the formation of biocompatiblecalcium phosphate (CaP) nanoparticles. Teleofection enables both nucleicacid and protein transfection into primary neurons and NSCs, eliminatingthe need for specialized skills and equipment. It can easily fine-tunetransfection efficiency by adjusting the incubation time and nanoparticlequantity, catering to various experimental requirements. Teleofection’sversatility allows for the delivery of different cargos into the samecell culture, whether simultaneously or sequentially. This flexibilityproves invaluable for long-term studies, enabling the monitoring ofneural development and synapse plasticity. Moreover, teleofectionensures the consistent and robust expression of delivered genes, facilitatingmolecular and biochemical investigations. Teleofection representsa significant advancement in neurobiology, which has promise to transcendthe limitations of current gene delivery methods. It offers a user-friendly,cost-effective, and reproducible approach for researchers, potentiallyrevolutionizing our understanding of brain function and development.
- Research Article
14
- 10.3390/pharmaceutics16010154
- Jan 22, 2024
- Pharmaceutics
- Xueqin Gao + 7 more
Gene therapy displays great promise in the treatment of cervical cancer. The occurrence of cervical cancer is highly related to persistent human papilloma virus (HPV) infection. The HPV oncogene can be cleaved via gene editing technology to eliminate carcinogenic elements. However, the successful application of the gene therapy method depends on effective gene delivery into the vagina. To improve mucosal penetration and adhesion ability, quaternized chitosan was introduced into the poly(β-amino ester) (PBAE) gene-delivery system in the form of quaternized chitosan-g-PBAE (QCP). At a mass ratio of PBAE:QCP of 2:1, the polymers exhibited the highest green fluorescent protein (GFP) transfection efficiency in HEK293T and ME180 cells, which was 1.1 and 5.4 times higher than that of PEI 25 kD. At this mass ratio, PBAE-QCP effectively compressed the GFP into spherical polyplex nanoparticles (PQ-GFP NPs) with a diameter of 255.5 nm. In vivo results indicated that owing to the mucopenetration and adhesion capability of quaternized CS, the GFP transfection efficiency of the PBAE-QCP hybrid system was considerably higher than those of PBAE and PEI 25 kD in the vaginal epithelial cells of Sprague-Dawley rats. Furthermore, the new system demonstrated low toxicity and good safety, laying an effective foundation for its further application in gene therapy.
- Research Article
7
- 10.1021/acsami.3c00427
- Jun 19, 2023
- ACS Applied Materials & Interfaces
- Huan Wang + 10 more
Advanced intracellular delivery of proteins has profound applications in both scientific investigations and therapies. However, existing strategies relying on various chemical and physical methods have drawbacks such as the requirement of high concentrations of in vitro prepared target proteins and difficulty in labeling target proteins. Developing new delivery systems integrating the enveloping and labeling of target proteins would bring great advantages for efficient protein transfections. Here, we enriched a high concentration (62 mg/mL) of several target proteins into the outer membrane vesicles (OMVs) of Escherichia coli to employ the native property of OMVs to deliver proteins into the cytosol of eukaryotic cells. The results revealed a high protein transfection efficiency from 90 to 97% for different cell lines. Moreover, the free penetration of molecules less than 600 Da across the membrane of OMVs allows direct labeling of target proteins within OMVs, facilitating the visualization of target proteins. Importantly, the nanobody delivered intracellularly by OMVs retains the biological activity of binding with its target, highlighting the advantages of OMVs as an emerging tool for efficient intracellular delivery of proteins.
- Research Article
7
- 10.1016/j.ymthe.2023.02.012
- Feb 14, 2023
- Molecular Therapy
- Yuanjun Zhu + 16 more
Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.
- Research Article
3
- 10.1038/s41598-023-28857-w
- Feb 14, 2023
- Scientific Reports
- Tsutomu Tanaka + 7 more
Sjögren’s disease (SjD) is an autoimmune disease that affects exocrine tissues and is characterized by increased apoptosis in salivary and lacrimal glands. Although the pathogenic mechanism triggering SjD is not well understood, overexpression of lysosome-associated membrane protein 3 (LAMP3) is associated with the disease in a subset of SjD patients and the development of SjD-like phenotype in mice. In this study, histological analysis of minor salivary glands of SjD patients suggested that LAMP3-containing material is being ejected from cells. Follow-on in vitro experiments with cells exposed to extracellular particles (EPs) derived from LAMP3-overexpressing cells showed increased apoptosis. Proteomics identified LAMP3 as a major component of EPs derived from LAMP3-overexpressing cells. Live-cell imaging visualized release and uptake of LAMP3-containing EPs from LAMP3-overexpressing cells to naïve cells. Furthermore, experiments with recombinant LAMP3 protein alone or complexed with Xfect protein transfection reagent demonstrated that internalization of LAMP3 was required for apoptosis in a caspase-dependent pathway. Taken together, we identified a new role for extracellular LAMP3 in cell-to-cell communication via EPs, which provides further support for targeting LAMP3 as a therapeutic approach in SjD.
- Research Article
2
- 10.1093/bbb/zbad008
- Jan 24, 2023
- Bioscience, Biotechnology, and Biochemistry
- Akira Nishimura + 4 more
The current CRISPR/Cas9 systems in the yeast Saccharomyces cerevisiae cannot be considered a non-genetic modification technology because it requires the introduction of Cas9 and sgRNA into yeast cells using plasmid expression systems. Our present study showed that the yeast genome can be edited without plasmid expression systems by using a commercially available protein transfection reagent and chemically modified sgRNAs.
- Research Article
6
- 10.1016/j.mce.2022.111813
- Oct 29, 2022
- Molecular and Cellular Endocrinology
- Xiao-Huan Liu + 10 more
Apolipoprotein A-IV reduced metabolic inflammation in white adipose tissue by inhibiting IKK and JNK signaling in adipocytes
- Research Article
14
- 10.1093/molbev/msac138
- Jun 28, 2022
- Molecular Biology and Evolution
- Shun Hayashi + 8 more
Most vertebrate sex-determining genes (SDGs) emerge as neofunctionalized genes through duplication and/or mutation of ancestral genes that are involved with sexual differentiation. We previously demonstrated dm-W to be the SDG in the African clawed frog Xenopus laevis and found that a portion of this gene emerged from the masculinization gene dmrt1 after allotetraploidization by interspecific hybridization between two ancestral species around 17–18 Ma. dm-W has four exons consisting of a noncoding exon 1, dmrt1-derived exons 2 and 3, and an orphan exon 4 (Ex4) of unknown origin that includes coding sequence (CDS). In this study, we searched for the origin of Ex4 and investigated the function of the CDS of this exon. We found that the Ex4-CDS is derived from a noncoding portion of the hAT-10 family of DNA transposon. Evolutionary analysis of transposons and determination of the Ex4 sequences from three other species indicated that Ex4 was generated before the diversification of most or all extant allotetraploid species in subgenus Xenopus, during which time we hypothesize that transposase activity of this hAT superfamily was active. Using DNA–protein binding and transfection assays, we further demonstrate that the Ex4-encoded amino acid sequence increases the DNA-binding ability and transrepression activity of DM-W. These findings suggest that the conversion of the noncoding transposon sequence to the CDS of dm-W contributed to neofunctionalization of a new chimeric SDG in the ancestor of the allotetraploid Xenopus species, offering new insights into de novo origin and functional evolution of chimerical genes.
- Research Article
4
- 10.1007/s10989-022-10416-y
- May 19, 2022
- International Journal of Peptide Research and Therapeutics
- Maxime Gestin + 5 more
Heat shock protein 70 kDa (HSP70) is a major protein family in the cell protections against stress-induced denaturation and aggregation and in the folding of nascent proteins. It is a highly conserved protein that can be found in most organisms and is strongly connected to several intracellular pathways such as protein folding and refolding, protein degradation and regulation, and protection against intense stress. Cellular delivery of HSP70 would be of high impact for clarification of its role in these cellular processes.PepFect14 is a cell-penetrating peptide known to be able to mediate the transfection of various oligonucleotides to multiple cell lines with a higher efficacy than most commercially available transfection agents and without inducing significant toxic effects.In this study we demonstrated that PepFect14 was able to form a complex with HSP70 and to deliver it inside cells in the same fashion with oligonucleotide delivery. The delivered HSP70 showed an effect in the cell regulation indicating that the protein was biologically available in the cytoplasm and the interactions with PepFect14 did not impeach its active sites once the plasma barrier crossed.This study reports the first successful delivery of HSP70 to our knowledge and the first protein transfection mediated by PepFect14. It opens new fields of research for both PepFect14 as a delivery agent and HSP70 as a therapeutic agent; with potential in peptide aggregation caused diseases such as Parkinson’s and Alzheimer’s diseases.
- Research Article
9
- 10.1038/s42003-022-03093-6
- Feb 17, 2022
- Communications Biology
- Taishi Yasukawa + 8 more
Genomic rearrangements often generate phenotypic diversification. We previously reported the TAQing system where genomic rearrangements are induced via conditional activation of a restriction endonuclease in yeast and plant cells to produce mutants with marked phenotypic changes. Here we developed the TAQing2.0 system based on the direct delivery of endonucleases into the cell nucleus by cell-penetrating peptides. Using the optimized procedure, we introduce a heat-reactivatable endonuclease TaqI into an asexual industrial yeast (torula yeast), followed by a transient heat activation of TaqI. TAQing2.0 leads to generation of mutants with altered flocculation and morphological phenotypes, which exhibit changes in chromosomal size. Genome resequencing suggested that torula yeast is triploid with six chromosomes and the mutants have multiple rearrangements including translocations having the TaqI recognition sequence at the break points. Thus, TAQing2.0 is expected as a useful method to obtain various mutants with altered phenotypes without introducing foreign DNA into asexual industrial microorganisms.