Protein-encoding Genes Research Articles

Whole genome sequencing of a novel Bacillus thuringiensis isolated from Assam soil

BackgroundBacillus thuringiensis (Bt) is a gram-positive ubiquitous saprophytic bacterium that produces proteins (Crystal protein, Vegetative insecticidal protein, and Secreted insecticidal protein) toxic to insects during its growth cycle. In the present study, the whole genome of a locally isolated B. thuringiensis strain BA04 was sequenced to explore the genetic makeup and to identify the genes responsible to produce insecticidal proteins including the virulence factors. The strain was isolated from the soil sample of the Kaziranga National Park, Assam, North-Eastern part of India (Latitude: 26°34′39.11''N and Longitude: 93°10′16.04''E).ResultsThe whole genome sequencing (WGS) of the BA04 strain revealed that it has a circular genome of size 6,113,005 bp with four numbers of plasmids. A total of 6,111 genes including two novel crystal protein-encoding genes (MH753362.1 and MH753363.1) were identified. The BLASTn analysis of MH753362.1 showed 84% similarities (maximum identity) with Cry1Ia (KJ710646.1) gene, whereas MH753363.1 exhibited 66% identity with Insecticidal Crystal Protein (ICP)-6 gene (KM053257.1). At the protein level, MH753362.1 and MH753363.1 shared 79% identity with Cry1Ia (AIW52613.1) and 40% identity with Insecticidal Crystal Protein (ICP)-6 (AJW76687.1) respectively. Three-dimensional structures of these two novel protein sequences revealed that MH753362.1 have 48% structural similarity with Cry8ea1 protein, whereas MH753363.1 showed only 20% structural similarity with Cry4Aa protein.Apart from these insecticidal genes, the strain was also found to contain virulence and virulence-associated factors including the antibiotic resistance genes and Clustered regularly interspaced short palindromic repeat (CRISPR) sequences.ConclusionThis is the first report on the whole genome sequence of Bt strain BA04 isolated from Assam, a North-Eastern state of India. The WGS of strain BA04 unveils the presence of two novel types of insecticidal crystal protein-encoding genes which can be used for the development of insect-resistant transgenic crops. Additionally, the strain could be used for the formulations of effective biopesticides. The WGS provides the fastest and cheapest platform for a better understanding of the genetic makeup of a strain and helps to explore the role of virulence genes in pathogenicity against the insect host.

Identification of a novel role for the immunomodulator ILRUN in the development of several T cell subsets in mice

Inflammation and lipid regulator with UBA-like and NBR1-like domains (ILRUN) is a protein-encoding gene associated with innate immune signaling, lipid metabolism and cancer. In the context of innate immunity, ILRUN inhibits IRF3-mediated transcription of antimicrobial and proinflammatory cytokines by inducing degradation of the transcriptional coactivators CBP and p300. There remains a paucity of information, however, regarding the innate immune roles of ILRUN beyond in vitro analyses. To address this, we utilize a knockout mouse model to investigate the effect of ILRUN on cytokine expression in splenocytes and on the development of immune cell populations in the spleen and thymus. We show elevated production of tumor necrosis factor and interleukin-6 cytokines in ILRUN-deficient splenocytes following stimulation with the innate immune ligands polyinosinic:polycytidylic acid or lipopolysaccharide. Differences were also observed in the populations of several T cell subsets, including regulatory, mucosal-associated invariant and natural killer. These data identify novel functions for ILRUN in the development of certain immune cell populations and support previous in vitro findings that ILRUN negatively regulates the synthesis of pathogen-stimulated cytokines. This establishes the ILRUN knockout mouse model as a valuable resource for further study of the functions of ILRUN in health and disease.

The mitochondrial and plastid genomes of Oryza sativa L. cv. Taichung 65.

A highly contiguous mitochondrial and plastid genome sequences of a japonica rice cultivar, Taichung 65, were determined by a hybrid approach with long- and short-read sequences. The assembled mitochondrial genome was 465,453 bases in length with an overall GC content of 43.8%. It was predicted to harbor 62 protein-encoding genes, 16 kinds (33 copies) of transfer RNA, and three kinds (six copies) of ribosomal RNA genes. The mitochondrial genome structure in Taichung 65 is largely the same as that of Nipponbare, but the first ∼9.5 kb sequence in Nipponbare (DQ167400) is replaced with a ∼27 kb sequence duplicated from other parts of the mitochondrial genome. Phylogenetic and sequence polymorphism analysis indicated that Taichung 65 is classified as typical japonica. The assembled plastid genome sequence was 134,551 bases in length and completely identical to the previously reported Nipponbare sequence. These near-complete organelle genome sequences will serve as fundamental resources for investigating alloplasmic cytoplasmic male sterile lines and other organelle-controlled phenomena in rice.

Whole genome characterization of thermophilic Campylobacter species isolated from dairy manure in small specialty crop farms of Northeast Ohio.

With more public interest in consuming locally grown produce, small specialty crop farms (SSCF) are a viable and growing segment of the food production chain in the United States. The goal of this study was to investigate the genomic diversity of Campylobacter isolated from dairy manure (n = 69) collected from 10 SSCF in Northeast Ohio between 2018 and 2020. A total of 56 C. jejuni and 13 C. coli isolates were sequenced. Multi-locus sequence typing (MLST) identified 22 sequence types (STs), with ST-922 (18%) and ST-61 (13%) predominant in C. jejuni and ST-829 (62%) and ST-1068 (38%) predominant in C. coli. Interestingly, isolates with similar genomic and gene contents were detected within and between SSCF over time, suggesting that Campylobacter could be transmitted between farms and may persist in a given SSCF over time. Virulence-associated genes (n = 35) involved in the uptake and utilization of potassium and organic compounds (succinate, gluconate, oxoglutarate, and malate) were detected only in the C. jejuni isolates, while 45 genes associated with increased resistance to environmental stresses (capsule production, cell envelope integrity, and iron uptake) were detected only in the C. coli isolates. Campylobacter coli isolates were also sub-divided into two distinct clusters based on the presence of unique prophages (n = 21) or IncQ conjugative plasmid/type-IV secretion system genes (n = 15). Campylobacter coli isolates harbored genes associated with resistance to streptomycin (aadE-Cc; 54%) and quinolone (gyrA-T86I; 77%), while C. jejuni had resistance genes for kanamycin (aph3'-IIIa; 20%). Both species harbored resistance genes associated with β-lactam (especially, blaOXA-193; up to 100%) and tetracycline (tetO; up to 59%). Our study demonstrated that Campylobacter genome plasticity associated with conjugative transfer might provide resistance to certain antimicrobials and viral infections via the acquisition of protein-encoding genes involved in mechanisms such as ribosomal protection and capsule modification.

Genome Resource Announcement for Two Isolates of Phytophthora sansomeana with Varying Levels of Pathogenicity on Soybean

Phytophthora sansomeana was recognized as a distinct species in 2009. It has since been detected in Phytophthora surveys across the North Central region of the United States in recent years. Two isolates of P. sansomeana with moderate and high levels of pathogenicity (Psan_MP and Psan_HP, respectively), based on lesion development on soybean tap roots, were chosen for Oxford Nanopore Technologies long-read genome sequencing to allow within-species genomic comparisons between isolates with different levels of pathogenicity on soybean. The genome assembly size, number of predicted protein-encoding genes, and number of candidate effectors were greater in the highly pathogenic isolate (Psan_HP) than in the moderately pathogenic isolate (Psan_MP). Future work should more closely examine the context of P. sansomeana pathogenicity mechanisms relative to other Phytophthora species. [Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY 4.0 International license .

Genome-wide DNA methylation analysis of aggressive behaviour: a longitudinal population-based study.

Human aggression is influenced by an interplay between genetic predisposition and experience across the life span. This interaction is thought to occur through epigenetic mechanisms, inducing differential gene expression, thereby moderating neuronal cell and circuit function, and thus shaping aggressive behaviour. Genome-wide DNA methylation (DNAm) levels were measured in peripheral blood obtained from 95 individuals participating in the Estonian Children Personality Behaviours and Health Study (ECPBHS) at 15 and 25 years of age. We examined the association between aggressive behaviour, as measured by Life History of Aggression (LHA) total score and DNAm levels both assessed at age 25. We further examined the pleiotropic effect of genetic variants regulating LHA-associated differentially methylated positions (DMPs) and multiple traits related to aggressive behaviours. Lastly, we tested whether the DNA methylomic loci identified in association with LHA at age 25 were also present at age 15. We found one differentially methylated position (DMP) (cg17815886; p= 1.12 × 10-8 ) and five differentially methylated regions (DMRs) associated with LHA after multiple testing adjustments. The DMP annotated to the PDLIM5 gene, and DMRs resided in the vicinity of four protein-encoding genes (TRIM10, GTF2H4, SLC45A4, B3GALT4) and a long intergenic non-coding RNA (LINC02068). We observed evidence for the colocalization of genetic variants associated with top DMPs and general cognitive function, educational attainment and cholesterol levels. Notably, a subset of the DMPs associated with LHA at age 25 also displayed altered DNAm patterns at age 15 with high accuracy in predicting aggression. Our findings highlight the potential role of DNAm in the development of aggressive behaviours. We observed pleiotropic genetic variants associated with identified DMPs, and various traits previously established to be relevant in shaping aggression in humans. The concordance of DNAm signatures in adolescents and young adults may have predictive value for inappropriate and maladaptive aggression later in life.

Draft Genome Sequence of Aspergillus ochraceus Strain DY1, a Lignin-Degrading Fungus Isolated from Wood Rot.

Aspergillus spp. are known for their lignin-degrading ability and also for the degradation of complex aromatic compounds. In this paper, we present the genome sequence of Aspergillus ochraceus strain DY1, which was isolated from rotten wood in a biodiversity park. The total genome size is 35,149,223 bp, including 13,910 hits of protein-encoding genes, with a GC content of 49.92%.

The complete plastome sequence of Momordica cochinchinensis (Cucurbitaceae)

Momordica cochinchinensis (Lour.) Spreng. is an important medicinal plant that is used to treat various diseases in South and Southeast Asia. In this study, the complete plastome of M. cochinchinensis was sequenced and found to exhibit a total length of 158,955 bp, with a large single copy (LSC) region of 87,924 bp and a small single copy (SSC) region of 18,479 bp, as well as with two inverted repeats (IRs) that were both 26,726 bp in length. In total, 129 genes were detected, comprising 86 protein-encoding genes, 8 ribosomal RNA (rRNA) genes, and 35 transfer RNA (tRNA) genes. Furthermore, the inferred phylogenetic tree confirmed that M. cochinchinensis belongs to the genus Momordica in the Cucurbitaceae family. The research results will be used for authenticating M. cochinchinensis plant materials and for analyzing the genetic diversity and phylogenetic relationships in Momordica.

IAG Regulates the Expression of Cytoskeletal Protein-Encoding Genes in Shrimp Testis.

Insulin-like androgenic gland hormone (IAG) is the master regulator of sexual differentiation and testis development in male crustaceans. However, the molecular mechanism on how IAG functions during testis development is still largely unknown. Here, the transcriptional changes were analyzed in the testes of shrimp after LvIAG knockdown in Litopenaeus vannamei. Differential expression analysis identified 111 differentially expressed genes (DEGs), including 48 upregulated DEGs and 63 downregulated DEGs, in testes of shrimp after LvIAG knockdown. Gene ontology (GO) analysis showed that these DEGs were apparently enriched in cytoskeleton-related GO items. Gene function analysis showed that genes enriched in these GO items mainly encoded actin, myosin, and heat shock protein. Interestingly, these genes were all downregulated in testis after LvIAG knockdown, which was confirmed by qRT-PCR detection. Furthermore, injection of LvIAG protein that was recombinantly expressed in insect cells upregulated the expression levels of these genes. The present study revealed that shrimp IAG might function in testis development through regulating the expression of cytoskeletal protein-encoding genes, which would provide new insights into understanding the functional mechanisms of IAG on male sexual development of crustaceans.

Functional annotation and comparative analysis of four Botrytis cinerea mitogenomes reported from Punjab, Pakistan

Botrytis cinerea is one of the top phytopathogenic fungus which ubiquitously cause grey mold on a variety of horticultural plants. The mechanism of respiration in the fungus occurs within the mitochondria. Mitogenomes serve as a key molecular marker for the investigation of fungal evolutionary patterns. This study aimed at the complete assembly, characterization, and comparative relationship of four mitogenomes of Botrytis cinerea strains including Kst5C, Kst14A, Kst32B, Kst33A, respectively. High throughput sequencing of four mitogenomes allowed the full assembly and annotation of these sequences. The total genome length of these 4 isolates Kst5C Kst14A, Kst32B, Kst33A was 69,986 bp, 77,303 bp, 76,204 bp and 55, 226 bp respectively. The distribution of features represented 2 ribosomal RNA genes,14 respiration encoding proteins, 1 mitochondrial ribosomal protein-encoding gene, along with varying numbers of transfer RNA genes, protein-coding genes, mobile intronic regions and homing endonuclease genes including LAGLIDADG and GIY-YIG domains were found in all four mitogenomes. The comparative analyses performed also decipher significant results for four mitogenomes among fungal isolates included in the study. This is the first report on the detailed annotation of mitogenomes as a proof for investigation of variation patterns present with in the B. cinerea causing grey mold on strawberries in Pakistan. This study will also contribute to the rapid evolutionary analysis and population patterns present among Botrytis cinerea.

SmCIP7, a COP1 interactive protein, positively regulates anthocyanin accumulation and fruit size in eggplant

In higher plants, COP1 (Constitutively Photomorphogenic 1) acts as a central regulator of light-signaling networks and globally conditions the target proteins via the ubiquitin-proteasome pathway. However, the function of COP1-interacting proteins in light-regulated fruit coloration and development remains unknown in Solanaceous plants. Here, a COP1-interacting protein-encoding gene, SmCIP7, expressed specifically in the eggplant (Solanum melongena L.) fruit, was isolated. Gene-specific silencing of SmCIP7 using RNA interference (RNAi) significantly altered fruit coloration, fruit size, flesh browning, and seed yield. SmCIP7-RNAi fruits showed evident repression of the accumulation of anthocyanins and chlorophyll, indicating functional similarities between SmCIP7 and AtCIP7. However, the reduced fruit size and seed yield indicated SmCIP7 had evolved a distinctly new function. With the comprehensive application of HPLC-MS, RNA-seq, qRT-PCR, Y2H, BiFC, LCI, and dual-luciferase reporter system (DLR™), it was found that SmCIP7, a COP1 interactive protein in light signaling promoted anthocyanin accumulation, probably by regulating the transcription of SmTT8. Additionally, the drastic up-regulation of SmYABBY1, a homologous gene of SlFAS, might account for the strongly retarded fruit growth in SmCIP7-RNAi eggplant. Altogether, this study proved that SmCIP7 is an essential regulatory gene to modulate fruit coloration and development, serving as a key gene locus in eggplant molecular breeding.

Plasmid pMO1 from Marinitoga okinawensis, first non-cryptic plasmid reported within Thermotogota

Mobile genetic elements (MGEs), such as viruses and plasmids, drive the evolution and adaptation of their cellular hosts from all three domains of life. This includes microorganisms thriving in the most extreme environments, like deep-sea hydrothermal vents. However, our knowledge about MGEs still remains relatively sparse in these abyssal ecosystems. Here we report the isolation, sequencing, assembly, and functional annotation of pMO1, a 28.2 kbp plasmid associated with the reference strain Marinitoga okinawensis. Carrying restriction/modification and chemotaxis protein-encoding genes, pMO1 likely affects its host's phenotype and represents the first non-cryptic plasmid described among the phylum Thermotogota.

Development of SSR markers on the basis of the Panax notoginseng transcriptome for agronomic and biochemical trait association analyses

Panax notoginseng (Burk.) F.H. Chen (Araliaceae) is a precious medicinal plant, but little is known about the mechanism underlying the inheritance of its important agronomic and biochemical traits. The development of effective molecular markers and the characterization of genes associated with agronomic and biochemical traits are critical for P. notoginseng genetic analyses and breeding. In this study, 41 pairs of primers for polymorphic simple sequence repeats (SSRs) were developed according to the P. notoginseng transcriptome. Among them, 18 SSR markers can be used to reveal the rich genetic diversity among four wild Panax stipuleanatus populations. In addition, 20 significant correlations between 15 SSR locus and 14 agronomic and biochemical traits were identified using mixed linear models. It is worth noting that P19-FAM loci is significantly correlated with the content of P. notoginseng saponin R1 in rhizomes and tuberous roots, and the corresponding unigene sequence of P19-FAM loci is a dof zinc finger protein-encoding gene (PnDof1). Moreover, the PnDof1 protein was localized in the plant cell nucleus, and transgenic PnDof1-overexpressing P. notoginseng cells had higher notoginsenoside R1 and ginsenoside (Rg1, Re, Rb1, and Rd) contents than non-transgenic cells. Some P. notoginseng saponin (PNS) biosynthesis-related genes were significantly up-regulated in the PnDof1-overexpressing transgenic cells. The transcriptome SSR markers developed in this study are useful for the genetic analysis of Panax germplasm resources as well as for molecular breeding. The PnDof1 gene may encode a transcription factor that regulates PNS biosynthesis in P. notoginseng.

Genome-wide analysis of long non-coding RNAs in sugar beet (Beta vulgaris L.) under drought stress.

Drought stress is one of the most severe abiotic stresses that restrict global crop production. Long non-coding RNAs (lncRNAs) have been proved to play a key role in response to drought stress. However, genome-wide identification and characterization of drought-responsive lncRNAs in sugar beet is still lacking. Thus, the present study focused on analyzing lncRNAs in sugar beet under drought stress. We identified 32017 reliable lncRNAs in sugar beet by strand-specific high-throughput sequencing. A total of 386 differentially expressed lncRNAs (DElncRNAs) were found under drought stress. The most significantly upregulated and downregulated lncRNAs were TCONS_00055787 (upregulated by more than 6000 fold) and TCONS_00038334 (downregulated by more than 18000 fold), respectively. Quantitative real-time PCR results exhibited a high concordance with RNA sequencing data, which conformed that the expression patterns of lncRNAs based on RNA sequencing were highly reliable. In addition, we predicted 2353 and 9041 transcripts that were estimated to be the cis- and trans-target genes of the drought-responsive lncRNAs. As revealed by Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis, the target genes of DElncRNAs were significantly enriched in organelle subcompartment, thylakoid, endopeptidase activity, catalytic activity, developmental process, lipid metabolic process, RNA polymerase activity, transferase activity, flavonoid biosynthesis and several other terms associated with abiotic stress tolerance. Moreover, 42 DElncRNAs were predicted as potential miRNA target mimics. LncRNAs have important effects on plant adaptation to drought conditions through the interaction with protein-encoding genes. The present study leads to greater insights into lncRNA biology and offers candidate regulators for improving the drought tolerance of sugar beet cultivars at the genetic level.

Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E)protein-encoding sequenceand luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.

A Novel Radiogenomics Biomarker for Predicting Treatment Response and Pneumotoxicity From Programmed Cell Death Protein or Ligand-1 Inhibition Immunotherapy in NSCLC

IntroductionPatient selection for checkpoint inhibitor immunotherapy is currently guided by programmed death-ligand 1 (PD-L1) expression obtained from immunohistochemical staining of tumor tissue samples. This approach is susceptible to limitations resulting from the dynamic and heterogeneous nature of cancer cells and the invasiveness of the tissue sampling procedure. To address these challenges, we developed a novel computed tomography (CT) radiomic-based signature for predicting disease response in patients with NSCLC undergoing programmed cell death protein 1 (PD-1) or PD-L1 checkpoint inhibitor immunotherapy. MethodsThis retrospective study comprises a total of 194 patients with suitable CT scans out of 340. Using the radiomic features computed from segmented tumors on a discovery set of 85 contrast-enhanced chest CTs of patients diagnosed with having NSCLC and their CD274 count, RNA expression of the protein-encoding gene for PD-L1, as the response vector, we developed a composite radiomic signature, lung cancer immunotherapy—radiomics prediction vector (LCI-RPV). This was validated in two independent testing cohorts of 66 and 43 patients with NSCLC treated with PD-1 or PD-L1 inhibition immunotherapy, respectively. ResultsLCI-RPV predicted PD-L1 positivity in both NSCLC testing cohorts (area under the curve [AUC] = 0.70, 95% confidence interval [CI]: 0.57–0.84 and AUC = 0.70, 95% CI: 0.46–0.94). In one cohort, it also demonstrated good prediction of cases with high PD-L1 expression exceeding key treatment thresholds (>50%: AUC = 0.72, 95% CI: 0.59–0.85 and >90%: AUC = 0.66, 95% CI: 0.45–0.88), the tumor’s objective response to treatment at 3 months (AUC = 0.68, 95% CI: 0.52–0.85), and pneumonitis occurrence (AUC = 0.64, 95% CI: 0.48–0.80). LCI-RPV achieved statistically significant stratification of the patients into a high- and low-risk survival group (hazard ratio = 2.26, 95% CI: 1.21–4.24, p = 0.011 and hazard ratio = 2.45, 95% CI: 1.07–5.65, p = 0.035). ConclusionsA CT radiomics-based signature developed from response vector CD274 can aid in evaluating patients’ suitability for PD-1 or PD-L1 checkpoint inhibitor immunotherapy in NSCLC.

The SET domain protein PsKMT3 regulates histone H3K36 trimethylation and modulates effector gene expression in the soybean pathogen Phytophthora sojae.

Plant pathogens secrete effector proteins to overcome host immunity and promote colonization. In oomycete plant pathogens, the expression of many effector genes is altered upon infection; however, the regulatory mechanisms are unclear. In this study, we identified a su(var)3-9, enhancer of zeste, and trithorax (SET) domain protein-encoding gene, PsKMT3, that was highly induced at early infection stages in Phytophthora sojae. Deletion of PsKMT3 led to asexual development and pathogenicity defects. Chromatin immunoprecipitation followed by sequencing (ChIP-seq) and western blot analyses demonstrated that histone H3K36 trimethylation (H3K36me3) was significantly reduced genome-wide in mutants. RNA-seq analysis identified 374 genes encoding secreted proteins that were differentially expressed in pskmt3 at the mycelium stage. The significantly altered genes encompassed the RxLR (Arg-x-Lys-Arg) effector gene family, including the essential effector genes Avh23, Avh181, Avh240, and Avh241. Transcriptome analysis at early infection stages showed misregulation of effector gene expression waves in pskmt3. H3K36me3 was directly and indirectly associated with RxLR effector gene activation. Our results reveal a role of a SET domain protein in regulating effector gene expression and modulating histone methylation in P. sojae.

Mitochondrial dysfunction in human hypertrophic cardiomyopathy is linked to cardiomyocyte architecture disruption and corrected by improving NADH-driven mitochondrial respiration.

Genetic hypertrophic cardiomyopathy (HCM) is caused by mutations in sarcomere protein-encoding genes (i.e. genotype-positive HCM). In an increasing number of patients, HCM occurs in the absence of a mutation (i.e. genotype-negative HCM). Mitochondrial dysfunction is thought to be a key driver of pathological remodelling in HCM. Reports of mitochondrial respiratory function and specific disease-modifying treatment options in patients with HCM are scarce. Respirometry was performed on septal myectomy tissue from patients with HCM (n = 59) to evaluate oxidative phosphorylation and fatty acid oxidation. Mitochondrial dysfunction was most notably reflected by impaired NADH-linked respiration. In genotype-negative patients, but not genotype-positive patients, NADH-linked respiration was markedly depressed in patients with an indexed septal thickness ≥10 compared with <10. Mitochondrial dysfunction was not explained by reduced abundance or fragmentation of mitochondria, as evaluated by transmission electron microscopy. Rather, improper organization of mitochondria relative to myofibrils (expressed as a percentage of disorganized mitochondria) was strongly associated with mitochondrial dysfunction. Pre-incubation with the cardiolipin-stabilizing drug elamipretide and raising mitochondrial NAD+ levels both boosted NADH-linked respiration. Mitochondrial dysfunction is explained by cardiomyocyte architecture disruption and is linked to septal hypertrophy in genotype-negative HCM. Despite severe myocardial remodelling mitochondria were responsive to treatments aimed at restoring respiratory function, eliciting the mitochondria as a drug target to prevent and ameliorate cardiac disease in HCM. Mitochondria-targeting therapy may particularly benefit genotype-negative patients with HCM, given the tight link between mitochondrial impairment and septal thickening in this subpopulation.

Comparative Genomic Analysis Reveals the Functional Traits and Safety Status of Lactic Acid Bacteria Retrieved from Artisanal Cheeses and Raw Sheep Milk.

Lactic acid bacteria (LAB) are valuable for the production of fermented dairy products. We investigated the functional traits of LAB isolated from artisanal cheeses and raw sheep milk, assessed their safety status, and explored the genetic processes underlying the fermentation of carbohydrates. Lactiplantibacillus plantarum had the largest and more functional genome compared to all other LAB, while most of its protein-encoding genes had unknown functions. A key finding of our analysis was the overall absence of acquired resistance genes (RGs), virulence genes (VGs), and prophages, denoting that all LAB isolates fulfill safety criteria and can be used as starter or adjunct cultures. In this regard, the identified mobile genetic elements found in LAB, rather than enabling the integration of RGs or VGs, they likely facilitate the uptake of genes involved in beneficial functions and in the adaptation of LAB in dairy matrices. Another important finding of our study was that bacteriocins and CAZymes were abundant in LAB though each species was associated with specific genes, which in turn had different activity spectrums and identified applications. Additionally, all isolates were able to metabolize glucose, lactose, maltose, and sucrose, but Lactiplantibacillus plantarum was strongly associated with the fermentation of rhamnose, mannose, cellobiose, and trehalose whereas Levilactobacillus brevis with the utilization of arabinose and xylose. Altogether these results suggest that to fully exploit the beneficial properties of LAB, a combination of strains as food additives may be necessary. Interestingly, biological processes involved in the metabolism of carbohydrates that are not of direct interest for the dairy industry may yield valuable metabolites or activate pathways associated with beneficial health effects. Our results provide useful information for the development of new probiotic artisanal cheeses and probiotic starter cultures.

MiRNAs role in bladder cancer pathogenesis and targeted therapy: Signaling pathways interplay - A review.

Bladder cancer (BC) is the 11th most popular cancer in females and 4th in males. A lot of efforts have been exerted to improve BC patients' care. Besides, new approaches have been developed to enhance the efficiency of BC diagnosis, prognosis, therapeutics, and monitoring. MicroRNAs (miRNAs, miRs) are small chain nucleic acids that can regulate wide networks of cellular events. They can inhibit or degrade their target protein-encoding genes. The miRNAs are either downregulated or upregulated in BC due to epigenetic alterations or biogenesis machinery abnormalities. In BC, dysregulation of miRNAs is associated with cell cycle arrest, apoptosis, proliferation, metastasis, treatment resistance, and other activities. A variety of miRNAs have been related to tumor kind, stage, or patient survival. Besides, although new approaches for using miRNAs in the diagnosis, prognosis, and treatment of BC have been developed, it still needs further investigations. In the next words, we illustrate the recent advances in the role of miRNAs in BC aspects. They include the role of miRNAs in BC pathogenesis and therapy. Besides, the clinical applications of miRNAs in BC diagnosis, prognosis, and treatment are also discussed.