Potato Virus Research Articles

Plant-Produced Nanoparticles Based on Artificial Self-Assembling Peptide Bearing the Influenza M2e Epitope.

Despite advances in vaccine development, influenza remains a persistent global health threat and the search for a broad-spectrum recombinant vaccine against influenza continues. The extracellular domain of the transmembrane protein M2 (M2e) of the influenza A virus is highly conserved and can be used to develop a universal vaccine. M2e is a poor immunogen by itself, but it becomes highly immunogenic when linked to an appropriate carrier. Here, we report the transient expression of a recombinant protein comprising four tandem copies of M2e fused to an artificial self-assembling peptide (SAP) in plants. The hybrid protein was efficiently expressed in Nicotiana benthamiana using the self-replicating potato virus X-based vector pEff. The protein was purified using metal affinity chromatography under denaturing conditions. The hybrid protein was capable of self-assembly in vitro into spherical particles 15-30 nm in size. The subcutaneous immunization of mice with M2e-carrying nanoparticles induced high levels of M2e-specific IgG antibodies in serum and mucosal secretions. Immunization provided mice with protection against a lethal influenza A virus challenge. SAP-based nanoparticles displaying M2e peptides can be further used to develop a recombinant "universal" vaccine against influenza A produced in plants.

Construction of an Agroinfectious Clone of a Korean Isolate of Sweet Potato Symptomless Virus 1 and Comparison of Its Infectivity According to Agrobacterium tumefaciens Strains in Nicotiana benthamiana

Sweet potato symptomless virus 1 (SPSMV-1) is a single-stranded circular DNA virus, belonging to the genus <i>Mastrevirus</i> (family <i>Geminiviridae</i>) that was first identified on sweet potato plants in South Korea in 2012. Although SPSMV-1 does not induce distinct symptoms in sweet potato plants, its co-infection with different sweet potato viruses is highly prevalent, and thus threatens sweet potato production in South Korea. In this study, the complete genome sequence of a Korean isolate of SPSMV-1 was obtained by Sanger sequencing of polymerase chain reaction (PCR) amplicons from sweet potato plants collected in the field (Suwon). An infectious clone of SPSMV-1 (1.1-mer) was constructed, cloned into the plant expression vector pCAMBIA1303, and agro-inoculated into <i>Nicotiana benthamiana</i> using three <i>Agrobacterium tumefaciens</i> strains (GV3101, LBA4404, and EHA105). Although no visual differences were observed between the mock and infected groups, SPSMV-1 accumulation was detected in the roots, stems, and newly produced leaves through PCR. The <i>A. tumefaciens</i> strain LBA4404 was the most effective at transferring the SPSMV-1 genome to <i>N. benthamiana</i>. We confirmed the viral replication in <i>N. benthamiana</i> samples through strand-specific amplification using virion-sense- and complementary-sense-specific primer sets.

Plant viruses induce plant volatiles that are detected by aphid parasitoids

Aphis gossypii (Sternorrhyncha: Aphididae) aphids are vectors of important plant viruses among which cucumber mosaic virus (CMV) and potato virus Y (PVY). Virus-infected plants attract aphid vectors and affect their behavior and growth performance either positively or negatively depending on mode of transmission. Viruses cause changes in the composition and the amount of volatile organic compounds (VOCs) released by the plant that attract aphids. The aphid parasitoid Aphidius colemani (Hymenoptera: Aphelinidae) has been shown to have higher parasitism and survival rates on aphids fed on virus-infected than aphids fed on non-infected plants. We hypothesized that parasitoids distinguish virus-infected plants and are attracted to them regardless of the presence of their aphid hosts. Herein, we examined the attraction of the A. colemani parasitoid to infected pepper plants with each of CMV or PVY without the presence of aphids. The dynamic headspace technique was used to collect VOCs from non-infected and CMV or PVY-infected pepper plants. Identification was performed with gas chromatography-mass spectrometry (GC–MS). The response of the parasitoids on virus-infected vs non-infected pepper plants was tested by Y-tube olfactometer assays. The results revealed that parasitoids displayed a preference to CMV and PVY infected plants compared to those that were not infected.

Design and Immunogenicity of SARS-CoV-2 DNA Vaccine Encoding RBD-PVXCP Fusion Protein.

The potential of immune-evasive mutation accumulation in the SARS-CoV-2 virus has led to its rapid spread, causing over 600 million confirmed cases and more than 6.5 million confirmed deaths. The huge demand for the rapid development and deployment of low-cost and effective vaccines against emerging variants has renewed interest in DNA vaccine technology. Here, we report the rapid generation and immunological evaluation of novel DNA vaccine candidates against the Wuhan-Hu-1 and Omicron variants based on the RBD protein fused with the Potato virus X coat protein (PVXCP). The delivery of DNA vaccines using electroporation in a two-dose regimen induced high-antibody titers and profound cellular responses in mice. The antibody titers induced against the Omicron variant of the vaccine were sufficient for effective protection against both Omicron and Wuhan-Hu-1 virus infections. The PVXCP protein in the vaccine construct shifted the immune response to the favorable Th1-like type and provided the oligomerization of RBD-PVXCP protein. Naked DNA delivery by needle-free injection allowed us to achieve antibody titers comparable with mRNA-LNP delivery in rabbits. These data identify the RBD-PVXCP DNA vaccine platform as a promising solution for robust and effective SARS-CoV-2 protection, supporting further translational study.

Overexpression of VQ Motif-Containing Gene does not Affect Infection Rates of Potato with Potato Virus Y

Overexpression of VQ Motif-Containing Gene does not Affect Infection Rates of Potato with Potato Virus Y

Expression of Chitinase and shRNA Gene Exhibits Resistance to Fungi and Virus.

With the increasing global population, saving crops from diseases caused by different kinds of bacteria, fungi, viruses, and nematodes is essential. Potato is affected by various diseases, destroying many crops in the field and storage. In this study, we developed potato lines resistant to fungi and viruses, Potato Virus X (PVX) and Potato Virus Y (PVY), by inoculating chitinase for fungi and shRNA designed against the mRNA of the coat protein of PVX and PVY, respectively. The construct was developed using the pCAMBIA2301 vector and transformed into AGB-R (red skin) potato cultivar using Agrobacterium tumefaciens. The crude protein extract of the transgenic potato plant inhibited the growth of Fusarium oxysporum from ~13 to 63%. The detached leaf assay of the transgenic line (SP-21) showed decreased necrotic spots compared to the non-transgenic control when challenged with Fusarium oxysporum. The transgenic line, SP-21, showed maximum knockdown when challenged with PVX and PVY, i.e., 89 and 86%, while transgenic line SP-148 showed 68 and 70% knockdown in the PVX- and PVY-challenged conditions, respectively. It is concluded from this study that the developed transgenic potato cultivar AGB-R showed resistance against fungi and viruses (PVX and PVY).

Simplified extraction protocol for plant tissues and reverse transcription RPA assay for quick and reliable diagnosis and its application in resistance screening of chilli veinal mottle virus

The widespread occurrence and predominant association of chilli veinal mottle virus (ChiVMV) with the valuable chilli landraces of North East Region (NER) of India and associated threat to chilli production necessitated the development of simplified and robust detection procedure. Present study reports a simplified reverse transcription-recombinase polymerase amplification (RT-RPA) method for detection of ChiVMV in crude leaf extract prepared through simplified extraction protocol using NaOH:EDTA (1:1) based tissue lysis, without the need of conventional RNA extraction and sample processing. Developed RT-RPA assay could be performed at an isothermal temperature (38 °C) in 30 min and exhibited no cross-reactivity with other prevalent chilli viruses (potato virus Y, cucumber mosaic virus, large cardamom chirke virus, capsicum chlorosis orthotospovirus, pepper mild mottle virus and chilli leaf curl virus), indicating high specificity. It could detect ChiVMV up to 10−9 dilution (100 ag/μl) of crude leaf extract, 10 ag/μl of RNA of ChiVMV infected leaf tissues and plasmid DNA containing viral gene insert, thus exhibiting sufficient sensitivity which is at par or better than the standard RT-PCR. Developed RT-RPA assay was employed to reveal the widespread occurrence of ChiVMV in NER India with 50.81% (1545 samples tested) of symptomatic and 7.85% (1593 samples tested) of asymptomatic samples tested positive. RT-RPA exhibited higher sensitivity in detection of ChiVMV infection in field samples as compared to the standard RT-PCR which gave false negative in 2.07% of symptomatic and 2.01% of asymptomatic samples. The developed assay was further applied in screening of 49 chilli germplasm for ChiVMV infection. The pooled results of field screening based on the disease score indicated that none of the chilli germplasm had immune or complete resistance, while 29 chilli germplasm (bird's eye chilli: C. frutescens; Morokatekpa: C. annuum, Leihao morok, Morok masingkha; Chingpimorok: Capsicum sp.) exhibited tolerant reaction with a disease score of 1.27–2.00. All the tested bird's eye chilli germplasm showed tolerance to the ChiVMV. The artificial screening to the severe isolate and qRT-PCR based viral titre determination confirmed the results of field screening wherein the germplasm RCMC6, RCMC7, RCMC17, RCMC27 and RCMC42 exhibited either asymptomatic or mild mosaic symptoms and decrease in viral titre at 20 DAI thus categorized as tolerant. The simplified RT-RPA assay developed and validated in the present study can be applied in routine detection of ChiVMV in field samples, disease-free seedling production and resistance screening under resource poor laboratory setup with limited technical expertise. Chilli germplasm with tolerance to ChiVMV identified in the present study can be used as donors in resistance breeding.

Effect of infection of potato plants by Potato virus Y (PVY), Potato virus S (PVS), and Potato virus M (PVM) on content and physicochemical properties of tuber starch.

Potato virus Y (PVY), Potato virus S (PVS), and Potato virus M (PVM) infection of potato plants leads to decreased dry matter and starch content in tubers. Starch samples from potato tubers infected with PVY, PVS, and PVM had higher amylose content. Granules of starch isolated from potato tubers infected by PVS exhibit larger granules than starch granules isolated from tubers of healthy plants. In contrast, in the case of PVM and PVY infection, starch granules were significantly smaller in diameter. A decrease in the degree of crystallinity has been observed in all samples of starches obtained from the tubers of infected plants compared to starch isolated from tubers of healthy plants. A slight decrease in gelatinization temperature was noted for starch samples isolated from tubers infected by PVY and PVM, and a slight increase in gelatinization temperature for starch samples isolated from tubers infected by PVS compared to starch isolated from tubers of healthy plants. In all samples of starch obtained from tubers of infected plants, an increase in the value of gelatinization enthalpy was observed. Thus, it can be concluded that damage to potato plants by PVM and PVY leads to a significant decrease in the quality of starch in tubers. At the same time, infection by PVS had practically no considerable effect.

First report of Tomato yellow mottle-associated virus infecting pepper (Capsicum annuum L.) in China.

Tomato yellow mottle-associated virus (TYMaV), is a member of the genus Cytorhabdovirus in the family Rhabdoviridae, which has been reported to infect tomato (Lycopersicon esculentum) (Xu et al. 2017), Solanum nigrum (Li et al., 2022) and Nicotiana benthamiana (Zhou et al. 2019). In July 2021, virus-like symptoms of chlorosis, mosaic, and ring spots were observed in pepper, tomato, and eggplant during a survey of viral symptoms in Huzhou City, Zhejiang Province, China. To identify viral agents potentially associated with these diseases, an Oxford Nanopore cDNA library from the mixed samples was generated and sequenced. Briefly, total RNA from 10 leaf tissue samples (3 pepper plants, 4 tomato plants, and 3 eggplant plants) was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan) and pooled in equal amounts (100 ng/l each). The library was constructed using a PCR-cDNA sequencing kit (SQK-PCS109; Oxford Nanopore Technologies, Oxford, UK) in accordance with the manufacturer's instructions. Approximately 8.6 million reads were obtained from the Oxford MinION platform. After removing adapters and low-quality reads using iVar v1.3.1 (Grubaugh et al., 2019), the clean reads were subjected to BLASTn search in the GenBank database. We identified sequences derived from potato virus X (PVX), potato virus Y (PVY), cucumber mosaic virus (CMV), pepper mottle virus (PepMoV), and TYMaV. Of these reads, 339 with lengths ranging from 375 to 8651 nt were mapped to the genome of TYMaV (GeneBank Accession No. KY075646.1) at a 98.2% query coverage. To identify TYMaV-infected plants in the pooled samples, all 10 samples were analyzed by two-step RT-PCR using AMV reverse transcriptase (Takara, Tokyo, Japan) combined with random primers N6 (Takara, Dalian, China) and high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan) with primer pairs: N-F 5'- CAGGGAGAGAATGTACAAGTTGATC'/N-R 5'- GACCTTGCTCATCTGATGCAAC -3', amplifying 420 bp of the 3'end of nucleoprotein (N) gene. A pepper sample showing chlorosis symptom was positive for the TYMaV infection, but negative for PVX, PVY, CMV or PepMoV infection when tested using the primers listed in table S1. To confirm the genome sequence of TYMaV Zhejiang isolate (TYMaV-ZJ), we carried out two-step RT-PCR with seven primer pairs (Table S1) designed based on the reference TYMaV genome (GeneBank accession number KY075646.1). PCR products were cloned into pLB vector (Tiangen, Beijing, China) and Sanger sequenced in both directions. At least five independent clones of each fragment were sequenced to avoid possible mutations introduced by PCT. The sequences were assembled into a nearlyfull-length genome of TYMaV -ZJ which was composed of 13344nt (GeneBank accession number OP296980). Pairwise sequence comparison revealed that TYMaV -ZJ genome shared 91.50% and 85.59% nt sequence identity with that of the TYMaV tomato isolate (KY075646.1) and the Solanum nigrum isolate (MW527091.1), which is higher than the species demarcation threshold of 75% for the genus Cytorhabdovirus (Walker et al., 2022). To the best of our knowledge, this is the first report of TYMaV infecting pepper.

Molecular Analysis of the Global Population of Potato Virus S Redefines Its Phylogeny, and Has Crop Biosecurity Implications.

In 2020, 264 samples were collected from potato fields in the Turkish provinces of Bolu, Afyon, Kayseri and Niğde. RT-PCR tests, with primers which amplified its coat protein (CP), detected potato virus S (PVS) in 35 samples. Complete CP sequences were obtained from 14 samples. Phylogenetic analysis using non-recombinant sequences of (i) the 14 CP's, another 8 from Tokat province and 73 others from GenBank; and (ii) 130 complete ORF, RdRp and TGB sequences from GenBank, found that they fitted within phylogroups, PVSI, PVSII or PVSIII. All Turkish CP sequences were in PVSI, clustering within five subclades. Subclades 1 and 4 were in three to four provinces, whereas 2, 3 and 5 were in one province each. All four genome regions were under strong negative selection constraints (ω = 0.0603-0.1825). Considerable genetic variation existed amongst PVSI and PVSII isolates. Three neutrality test methods showed PVSIII remained balanced whilst PVSI and PVSII underwent population expansion. The high fixation index values assigned to all PVSI, PVSII and PVSIII comparisons supported subdivision into three phylogroups. As it spreads more readily by aphid and contact transmission, and may elicit more severe symptoms in potato, PVSII spread constitutes a biosecurity threat for countries still free from it.

A Single Nonsynonymous Substitution in the RNA-Dependent RNA Polymerase of Potato virus Y Allows the Simultaneous Breakdown of Two Different Forms of Antiviral Resistance in Capsicum annuum.

The dominant Pvr4 gene in pepper (Capsicum annuum) confers resistance to members of six potyvirus species, all of which belong to the Potato virus Y (PVY) phylogenetic group. The corresponding avirulence factor in the PVY genome is the NIb cistron (i.e., RNA-dependent RNA polymerase). Here, we describe a new source of potyvirus resistance in the Guatemalan accession C. annuum cv. PM949. PM949 is resistant to members of at least three potyvirus species, a subset of those controlled by Pvr4. The F1 progeny between PM949 and the susceptible cultivar Yolo Wonder was susceptible to PVY, indicating that the resistance is recessive. The segregation ratio between resistant and susceptible plants observed in the F2 progeny matched preferably with resistance being determined by two unlinked recessive genes independently conferring resistance to PVY. Inoculations by grafting resulted in the selection of PVY mutants breaking PM949 resistance and, less efficiently, Pvr4-mediated resistance. The codon substitution E472K in the NIb cistron of PVY, which was shown previously to be sufficient to break Pvr4 resistance, was also sufficient to break PM949 resistance, a rare example of cross-pathogenicity effect. In contrast, the other selected NIb mutants showed specific infectivity in PM949 or Pvr4 plants. Comparison of Pvr4 and PM949 resistance, which share the same target in PVY, provides interesting insights into the determinants of resistance durability.

Monitoring of the flight of aphids on potato plantations in the Arkhangelsk region

The results of the catch of aphids in vegetative plantings of potatoes in 2018–2021 are presented. The studies were carried out in the southern part of the Arkhangelsk region (Kotlas region). Yellow water traps were used to catch winged aphids. It was revealed that 25 species of winged aphids migrate to potato plantations with an average annual number of 162 individuals during the growing season. Of the total number, 7 species of aphids carrying potato viruses were identified. These included Acyrthosiphon pisum Harr., Aphis fabae Scop., Aphis nasturtii Kalt., Aulocarthum solani Kalt., Hyperomyzus lactucae L., Macrosiphum euphorbiae Thomas, and Rhopalosiphum padi L. These species account for 70 to 82% of the abundance structure. Not a single individual of the most harmful species Myzus persicae Sulz was caught. In the group of virus-carrying aphids, the most numerous species are R. padi L. (an average of 48 individuals per season) and A. fabae Scop. (an average of 35 individuals per season). It has been established that the flight of aphids is largely influenced by average daily air temperatures. In the conditions of the hottest year (2021) at an average daily air temperature of 19 °C, the largest annual number of aphids was identified - 181 individuals. Winged aphids are present in potato agrocenoses throughout the entire growing season, which indicates the need for annual monitoring of their numbers and the use of protective measures.

Identification and Molecular Characterization of a Novel Carlavirus Infecting Chrysanthemum morifolium in China.

Chrysanthemum (Chrysanthemum morifolium) is an important ornamental and medicinal plant suffering from many viruses and viroids worldwide. In this study, a new carlavirus, tentatively named Chinese isolate of Carya illinoinensis carlavirus 1 (CiCV1-CN), was identified from chrysanthemum plants in Zhejiang Province, China. The genome sequence of CiCV1-CN was 8795 nucleotides (nt) in length, with a 68-nt 5'-untranslated region (UTR) and a 76-nt 3'-UTR, which contained six predicted open reading frames (ORFs) that encode six corresponding proteins of various sizes. Phylogenetic analyses based on full-length genome and coat protein sequences revealed that CiCV1-CN is in an evolutionary branch with chrysanthemum virus R (CVR) in the Carlavirus genus. Pairwise sequence identity analysis showed that, except for CiCV1, CiCV1-CN has the highest whole-genome sequence identity of 71.3% to CVR-X6. At the amino acid level, the highest identities of predicted proteins encoded by the ORF1, ORF2, ORF3, ORF4, ORF5, and ORF6 of CiCV1-CN were 77.1% in the CVR-X21 ORF1, 80.3% in the CVR-X13 ORF2, 74.8% in the CVR-X21 ORF3, 60.9% in the CVR-BJ ORF4, 90.2% in the CVR-X6 and CVR-TX ORF5s, and 79.4% in the CVR-X21 ORF6. Furthermore, we also found a transient expression of the cysteine-rich protein (CRP) encoded by the ORF6 of CiCV1-CN in Nicotiana benthamiana plants using a potato virus X-based vector, which can result in a downward leaf curl and hypersensitive cell death over the time course. These results demonstrated that CiCV1-CN is a pathogenic virus and C. morifolium is a natural host of CiCV1.

Interactions of Tomato Chlorosis Virus p27 Protein with Tomato Catalase Are Involved in Viral Infection.

Tomato chlorosis virus (ToCV) severely threatens tomato production worldwide. P27 is known to be involved in virion assembly, but its other roles in ToCV infection are unclear. In this study, we found that removal of p27 reduced systemic infection, while ectopic expression of p27 promoted systemic infection of potato virus X in Nicotiana benthamiana. We determined that Solanum lycopersicum catalases (SlCAT) can interact with p27 in vitro and in vivo and that amino acids 73 to 77 of the N-terminus of SlCAT represent the critical region for their interaction. p27 is distributed in the cytoplasm and nucleus, and its coexpression with SlCAT1 or SlCAT2 changes its distribution in the nucleus. Furthermore, we found that silencing of SlCAT1 and SlCAT2 can promote ToCV infection. In conclusion, p27 can promote viral infection by binding directly to inhibit anti-ToCV processes mediated by SlCAT1 or SlCAT2.

AMF species do matter: Rhizophagus irregularis and Funneliformis mosseae affect healthy and PVY-infected Solanum tuberosum L. in a different way.

Arbuscular mycorrhizal fungi (AMF) were documented to positively influence plant growth and yield, which is extremely important for the production of many crops including potato. However, the nature of the interaction between arbuscular mycorrhiza and plant virus that share the same host is not well characterized. In this study, we examined the effect of different AMF, Rhizophagus irregularis and Funneliformis mosseae, on healthy and potato virus Y (PVY)-infected Solanum tuberosum L. The analyses conducted included the measurement of potato growth parameters, oxidative stress indicators, and photosynthetic capacity. Additionally, we evaluated both the development of AMF in plant roots and the virus level in mycorrhizal plants. We found that two AMF species colonized plant roots to varying degrees (ca. 38% for R. irregularis vs. 20% for F. mosseae). Rhizophagus irregularis had a more positive effect on potato growth parameters, causing a significant increase in the total fresh and dry weight of tubers, along with virus-challenged plants. Furthermore, this species lowered hydrogen peroxide levels in PVY-infected leaves and positively modulated the levels of nonenzymatic antioxidants, i.e., ascorbate and glutathione in leaves and roots. Finally, both fungal species contributed to reduced lipid peroxidation and alleviation of virus-induced oxidative damage in plant organs. We also confirmed an indirect interaction between AMF and PVY inhabiting the same host. The two AMF species seemed to have different abilities to colonize the roots of virus-infected hosts, as R. irregularis showed a stronger drop in mycorrhizal development in the presence of PVY. At the same time, arbuscular mycorrhiza exerted an effect on virus multiplication, causing increased PVY accumulation in plant leaves and a decreased concentration of virus in roots. In conclusion, the effect of AMF-plant interactions may differ depending on the genotypes of both symbiotic partners. Additionally, indirect AMF-PVY interactions occur in host plants, diminishing the establishment of arbuscular mycorrhiza while changing the distribution of viral particles in plants.

P3/P3N-PIPO of PVY interacting with BI-1 inhibits the degradation of NIb by ATG6 to facilitate virus replication in N. benthamiana.

Autophagy not only plays an antiviral role but also can be utilized by viruses to facilitate virus infection. However, the underlying mechanism of potato virus Y (PVY) infection against plant autophagy remains unclear. BI-1, localizing to the endoplasmic reticulum (ER), is a multifunctional protein and may affect the virus infection. In this study, Y2H, BiFC, qRT-PCR, RNA-Seq, WB and so on were used for research. P3 and P3N-PIPO of PVY can interact with the Bax inhibitor 1 (BI-1) of N. benthamiana. However, BI-1 knockout mutant showed better growth and development ability. In addition, when the BI-1 gene was knocked out or knocked down in N. benthamiana, the PVY-infected mutant showed milder symptoms and lower virus accumulation. Analysis of transcriptome data showed that the deletion of NbBI-1 weakened the gene expression regulation induced by PVY infection and NbBI-1 may reduce the mRNA level of NbATG6 by regulated IRE1-dependent decay (RIDD) in PVY-infected N. benthamiana. The expression level of the ATG6 gene of PVY-infected WT was significantly down-regulated, relative to the PVY-infected mutant. Further results showed that ATG6 of N. benthamiana can degrade NIb, the RNA-dependent RNA polymerase (RdRp) of PVY. NbATG6 has a higher mRNA level in PVY-infected BI-1 knockout mutants than in PVY-infected WT. The interaction of P3 and/or P3N-PIPO of PVY with BI-1 decrease the expression of the ATG6 gene might be mediated by RIDD, which inhibits the degradation of viral NIb and enhances viral replication.

Engineering aphid transmission of foxtail mosaic virus in the presence of potyvirus helper component proteinase through coat protein modifications.

Biotechnologies that use plant viruses as plant enhancement tools have shown great potential to flexibly engineer crop traits, but field applications of these technologies are still limited by efficient dissemination methods. Potyviruses can be rapidly inoculated into plants by aphid vectors due to the presence of the potyviral helper component proteinase (HC-Pro), which binds to the DAG motif of the coat protein (CP) of the virion. Previously it was determined that a naturally occurring DAG motif in the non-aphid-transmissible potexvirus, potato aucuba mosaic virus (PAMV), is functional when a potyviral HC-Pro is provided to aphids in plants. The DAG motif of PAMV was successfully transferred to the CP of another non-aphid-transmissible potexvirus, potato virus X, to convey aphid transmission capabilities in the presence of HC-Pro. Here, we demonstrate that DAG-containing segments of the CP from two different potyviruses (sugarcane mosaic virus and turnip mosaic virus), and from the previously used potexvirus, PAMV, can make the potexvirus, foxtail mosaic virus (FoMV), aphid-transmissible when fused with the FoMV CP. We show that DAG-containing FoMVs are transmissible by aphids that have prior access to HC-Pro through potyvirus-infected plants or ectopic expression of HC-Pro. The transmission efficiency of the DAG-containing FoMVs varied from less than 10 % to over 70 % depending on the length and composition of the surrounding amino acid sequences of the DAG-containing segment, as well as due to the recipient plant species. Finally, we show that the engineered aphid-transmissible FoMV is still functional as a plant enhancement resource, as endogenous host target genes were silenced in FoMV-infected plants after aphid transmission. These results suggest that aphid transmission could be engineered into non-aphid-transmissible plant enhancement viral resources to facilitate their field applications.

Topical application of coat protein specific dsRNA molecules confers resistance against cognate Potato virus Y (PVY) infecting potato of North-East India

Sustainable agriculture relies on techniques and technology that combine efficiency with the smallest possible ecological and environmental impact. RNA interference (RNAi), a post-transcriptional eukaryotic pathway in eukaryotes can be co-opted for the control of plant pathogens in the topical application system. RNAi is the biological mechanism of mRNA degradation triggered by endogenous or exogenous double-stranded small interfering RNAs (dsRNA/siRNA) and regulates the target gene expression. Topically applied double-stranded RNA (dsRNA) molecules on plants imitate the viral RNA intermediate which is involved in plant virus replication and thereby triggers post-transcriptional gene silencing via., RNAi pathway and reducing viral replication. In this study, a non-transgenic-based RNAi approach was adopted to induce resistance against PVY in potato crop. dsRNA was successfully produced through in vitro transcription and hybridization. To test the effect of dsRNA molecules, in vitro synthesized dsRNA were applied on potato leaves along with PVY. dsRNA-treated plants showed higher resistance to viral disease and exhibited normal growth compared with PVY-treated plants. Therefore, the topical application of dsRNA molecules from the PVY CP gene could serve as a promising method for suppressing PVY infection and ultimately enhancing potato yield.

Naturally occurring substitution of an amino acid in a plant virus gene-silencing suppressor enhances viral adaptation to increasing thermal stress.

Cereal yellow dwarf virus (CYDV-RPV) encodes a P0 protein that functions as a viral suppressor of RNA silencing (VSR). The strength of silencing suppression is highly variable among CYDV-RPV isolates. In this study, comparison of the P0 sequences of CYDV-RPV isolates and mutational analysis identified a single C-terminal amino acid that influenced P0 RNA-silencing suppressor activity. A serine at position 247 was associated with strong suppressor activity, whereas a proline at position 247 was associated with weak suppressor activity. Amino acid changes at position 247 did not affect the interaction of P0 with SKP1 proteins from Hordeum vulgare (barley) or Nicotiana benthamiana. Subsequent studies found P0 proteins containing a P247 residue were less stable than the P0 proteins containing an S247 residue. Higher temperatures contributed to the lower stability and in planta and the P247 P0 proteins were subject to degradation via the autophagy-mediated pathway. A P247S amino acid residue substitution in P0 increased CYDV-RPV replication after expression in agroinfiltrated plant leaves and increased viral pathogenicity of P0 generated from the heterologous Potato virus X expression vector system. Moreover, an S247 CYDV-RPV could outcompete the P247 CYDV-RPV in a mixed infection in natural host at higher temperature. These traits contributed to increased transmission by aphid vectors and could play a significant role in virus competition in warming climates. Our findings underscore the capacity of a plant RNA virus to adapt to climate warming through minor genetic changes in gene-silencing suppressor, resulting in the potential for disease persistence and prevalence.

Bio-Mass Production of Spirulina Platensis and Its use in Inducing Hostility Resistance Against Potyvirus Potato virus y

The study aimed to produce Spirulina platensis as a local preparation for the first time in Iraq and to know its effect on the resistance of the potato virus y as well as the study of evaluating the efficiency of three types of algae (Spirulina platensis, Alga300, Alga600) and the application on three varieties of the potato crop in stimulating resistance to a rate of infection. It reached 14.45% compared to the positive control treatment, the infection rate was 29.36%, the infection rate was 80.73%. The percentage of love, which amounted to 184.0 g.