Permeability Mutants Research Articles

Interaction of Teleost Fish TRPV4 with DEAD Box RNA Helicase 1 Regulates Iridovirus Replication.

Viral diseases are a significant risk to the aquaculture industry. Transient receptor potential vanilloid 4 (TRPV4) has been reported to be involved in regulating viral activity in mammals, but its regulatory effect on viruses in teleost fish remains unknown. Here, the role of the TRPV4-DEAD box RNA helicase 1 (DDX1) axis in viral infection was investigated in mandarin fish (Siniperca chuatsi). Our results showed that TRPV4 activation mediates Ca2+ influx and facilitates infectious spleen and kidney necrosis virus (ISKNV) replication, whereas this promotion was nearly eliminated by an M709D mutation in TRPV4, a channel Ca2+ permeability mutant. The concentration of cellular Ca2+ increased during ISKNV infection, and Ca2+ was critical for viral replication. TRPV4 interacted with DDX1, and the interaction was mediated primarily by the N-terminal domain (NTD) of TRPV4 and the C-terminal domain (CTD) of DDX1. This interaction was attenuated by TRPV4 activation, thereby enhancing ISKNV replication. DDX1 could bind to viral mRNAs and facilitate ISKNV replication, which required the ATPase/helicase activity of DDX1. Furthermore, the TRPV4-DDX1 axis was verified to regulate herpes simplex virus 1 replication in mammalian cells. These results suggested that the TRPV4-DDX1 axis plays an important role in viral replication. Our work provides a novel molecular mechanism for host involvement in viral regulation, which would be of benefit for new insights into the prevention and control of aquaculture diseases. IMPORTANCE In 2020, global aquaculture production reached a record of 122.6 million tons, with a total value of $281.5 billion. Meanwhile, frequent outbreaks of viral diseases have occurred in aquaculture, and about 10% of farmed aquatic animal production has been lost to infectious diseases, resulting in more than $10 billion in economic losses every year. Therefore, an understanding of the potential molecular mechanism of how aquatic organisms respond to and regulate viral replication is of great significance. Our study suggested that TRPV4 enables Ca2+ influx and interactions with DDX1 to collectively promote ISKNV replication, providing novel insights into the roles of the TRPV4-DDX1 axis in regulating the proviral effect of DDX1. This advances our understanding of viral disease outbreaks and would be of benefit for studies on preventing aquatic viral diseases.

Cell death regulation but not abscisic acid signaling is required for enhanced immunity to Botrytis in Arabidopsis cuticle-permeable mutants.

Prevailing evidence indicates that abscisic acid (ABA) negatively influences immunity to the fungal pathogen Botrytis cinerea in most but not all cases. ABA is required for cuticle biosynthesis, and cuticle permeability enhances immunity to Botrytis via unknown mechanisms. This complex web of responses obscures the role of ABA in Botrytis immunity. Here, we addressed the relationships between ABA sensitivity, cuticle permeability, and Botrytis immunity in the Arabidopsis thaliana ABA-hypersensitive mutants protein phosphatase2c quadruple mutant (pp2c-q) and enhanced response to aba1 (era1-2). Neither pp2c-q nor era1-2 exhibited phenotypes predicted by the known roles of ABA; conversely, era1-2 had a permeable cuticle and was Botrytis resistant. We employed RNA-seq analysis in cuticle-permeable mutants of differing ABA sensitivities and identified a core set of constitutively activated genes involved in Botrytis immunity and susceptibility to biotrophs, independent of ABA signaling. Furthermore, botrytis susceptible1 (bos1), a mutant with deregulated cell death and enhanced ABA sensitivity, suppressed the Botrytis immunity of cuticle permeable mutants, and this effect was linearly correlated with the extent of spread of wound-induced cell death in bos1. Overall, our data demonstrate that Botrytis immunity conferred by cuticle permeability can be genetically uncoupled from PP2C-regulated ABA sensitivity, but requires negative regulation of a parallel ABA-dependent cell-death pathway.

Translational Inhibition of CTX-M Extended Spectrum β-Lactamase in Clinical Strains of Escherichia coli by Synthetic Antisense Oligonucleotides Partially Restores Sensitivity to Cefotaxime.

Synthetic antisense oligomers are DNA mimics that can specifically inhibit gene expression at the translational level by ribosomal steric hindrance. They bind to their mRNA targets by Watson-Crick base pairing and are resistant to degradation by both nucleases and proteases. A 25-mer phosphorodiamidate morpholino oligomer (PMO) and a 13-mer polyamide (peptide) nucleic acid (PNA) were designed to target mRNA (positions -4 to +21, and –17 to –5, respectively) close to the translational initiation site of the extended-spectrum β-lactamase resistance genes of CTX-M group 1. These antisense oligonucleotides were found to inhibit β-lactamase activity by up to 96% in a cell-free translation-transcription coupled system using an expression vector carrying a blaCTX-M-15 gene cloned from a clinical isolate. Despite evidence for up-regulation of CTX-M gene expression, they were both found to significantly restore sensitivity to cefotaxime (CTX) in E. coli AS19, an atypical cell wall permeable mutant, in a dose dependant manner (0-40 nM). The PMO and PNA were covalently bound to the cell penetrating peptide (CPP; (KFF)3K) and both significantly (P < 0.05) increased sensitivity to CTX in a dose dependent manner (0-40 nM) in field and clinical isolates harboring CTX-M group 1 β-lactamases. Antisense oligonucleotides targeted to the translational initiation site and Shine-Dalgarno region of blaCTX-M-15 inhibited gene expression, and when conjugated to a cell penetrating delivery vehicle, partially restored antibiotic sensitivity to both field and clinical isolates.

Venus Flytrap HKT1-Type Channel Provides for Prey Sodium Uptake into Carnivorous Plant Without Conflicting with Electrical Excitability

The animal diet of the carnivorous Venus flytrap, Dionaea muscipula, contains a sodium load that enters the capture organ via an HKT1-type sodium channel, expressed in special epithelia cells on the inner trap lobe surface. DmHKT1 expression and sodium uptake activity is induced upon prey contact. Here, we analyzed the HKT1 properties required for prey sodium osmolyte management of carnivorous Dionaea. Analyses were based on homology modeling, generation of model-derived point mutants, and their functional testing in Xenopus oocytes. We showed that the wild-type HKT1 and its Na+- and K+-permeable mutants function as ion channels rather than K+ transporters driven by proton or sodium gradients. These structural and biophysical features of a high-capacity, Na+-selective ion channel enable Dionaea glands to manage prey-derived sodium loads without confounding the action potential-based information management of the flytrap.

Encoding the Light-Sensitivity of Channelrhodopsin-2

Microbial rhodopsins are routinely used as light-controlled switches in neurobiology. Their versatile applicability relies on the simplicity of the optogenetic approach. Light-sensitivity is promoted to the host cell encoded in genetic information. However, the signal output is limited by the expression level and the molecular properties of the rhodopsins. The light-sensitivity of the system can set a limit for its usage. Different strategies might be envisaged how to tune and increase the responsiveness on a molecular level in the case of channelrhodopsin-2 (ChR2), a light-gated cation channel from Chlamydomonas reinhardtii: 1) increased absorption cross-section and quantum efficiency, 2) increased single channel conductance, 3) increased lifetime of the open state and 4) an amplification system. Here, we follow up the different strategies in a combined biophysical and neurobiological approach. As a first step we have developed the tools to study the different properties to have experimental access to the molecular properties from a spectroscopic and electrophysiological side. Especially, the development of fusing different rhodopsins into a single entity allows the discrimination between effects on the expression level and an increased single channel current by using one of the rhodopsins as a molecular ruler. In a next step we looked into the light-induced dynamical changes that accompany the photocycle of ChR2. This strategy allows us to map the conformational changes connected to the open state of the channel. We further generated a more calcium permeable mutant (CatCh, L132C) whose action on tuning the light sensitivity is different. Here, we propose a model that a local calcium concentration increase at the cytoplasmic membrane screens negative surface charges leading to a higher probability of opening the voltage-dependent sodium channels responsible for the onset of action potentials in neurons.

Trehalose accumulation from cassava starch and release by a highly thermosensitive and permeable mutant of Saccharomycopsis fibuligera

Highly thermosensitive and permeable mutants are the mutants from which intracellular contents can be released when they are incubated both in low osmolarity water and at non-permissive temperature (usually 37°C). After mutagenesis by using nitrosoguanidine, a highly thermosensitive and permeable mutant named A11-b was obtained from Saccharomycopsis fibuligera A11-12, a trehalose overproducer in which the acid protease gene has been disrupted. Of the total trehalose, 73.8% was released from the mutant cells suspended in distilled water after they had been treated at 37°C overnight. However, only 10.0% of the total trehalose was released from the cells of S. fibuligera A11-12 treated under the same conditions. The cell volume of the mutant cells suspended in distilled water and treated at 37°C overnight was much bigger than that of S. fibuligera A11-12 treated under the same conditions. The cell growth and trehalose accumulation of the mutant were almost the same as those of S. fibuligera A11-12 during the cultivation at the flask level and in a 5-l fermentor. Both could accumulate around 28.0% (w/w) trehalose from cassava starch. After purification, the trehalose crystal from the aqueous extract of the mutant was obtained.

A Screen for Spore Wall Permeability Mutants Identifies a Secreted Protease Required for Proper Spore Wall Assembly

The ascospores of Saccharomyces cerevisiae are surrounded by a complex wall that protects the spores from environmental stresses. The outermost layer of the spore wall is composed of a polymer that contains the cross-linked amino acid dityrosine. This dityrosine layer is important for stress resistance of the spore. This work reports that the dityrosine layer acts as a barrier blocking the diffusion of soluble proteins out of the spore wall into the cytoplasm of the ascus. Diffusion of a fluorescent protein out of the spore wall was used as an assay to screen for mutants affecting spore wall permeability. One of the genes identified in this screen, OSW3 (RRT12/YCR045c), encodes a subtilisin-family protease localized to the spore wall. Mutation of the active site serine of Osw3 results in spores with permeable walls, indicating that the catalytic activity of Osw3 is necessary for proper construction of the dityrosine layer. These results indicate that dityrosine promotes stress resistance by acting as a protective shell around the spore. OSW3 and other OSW genes identified in this screen are strong candidates to encode enzymes involved in assembly of this protective dityrosine coat.

Single cell protein production from yacon extract using a highly thermosensitive and permeable mutant of the marine yeast Cryptococcus aureus G7a and its nutritive analysis

The intracellular protein in the highly thermosensitive and permeable mutant can be easily released when they are incubated both in the low-osmolarity water and at the non-permissive temperature (usually 37 degrees C). After the mutant was grown in the yacon extract for 45 h, the crude protein content in the highly thermosensitive and permeable mutant Z114 was 59.1% and over 61% of the total protein could be released from the cells treated at 37 degrees C. The mutant cells grown in the yacon extract still contained high level of essential amino acids and other nutrients. This means that the yacon extract could be used as the medium for growth of the highly thermosensitive and permeable mutant which contained high content of crude protein.

A Highly Thermosensitive and Permeable Mutant of the Marine Yeast Cryptococcus aureus G7a Potentially Useful for Single-Cell Protein Production and its Nutritive Components

The highly thermosensitive and permeable mutants are the mutants from which intracellular contents including proteins can be released when they are incubated both in the low osmolarity water and at the nonpermissive temperature (usually 37 degrees C). After mutagenesis by using nitrosoguanidine, a highly thermosensitive and permeable mutant named Z114 was obtained from the marine yeast Cryptococcus aureus G7a. Of the total protein, 65.3% was released from the mutant cells suspended in distilled water after they were treated at 37 degrees C overnight. However, only 12.3% of the total protein was released from the mutant cells suspended in 1.0 M sorbitol solution after they were treated at 37 degrees C overnight. We found that intracellular density of the mutant treated at 37 degrees C was greatly decreased, and cell volume of the mutant treated at 37 degrees C was increased due to the increased protein release. However, no significant changes in the intracellular density and cell volume of the mutant were observed when its cells suspended in 1.0 M sorbitol solution were treated at 37 degrees C. It was found that no big changes in cell growth, protein content, vitamin C content, nucleic acid content, fatty acids, and amino acid compositions of both the mutant and its wild type were detected. Therefore, the highly thermosensitive and permeable mutant still can be a good candidate as single-cell protein. This means that the method used in this study is a simple and efficient way to release protein from the highly thermosensitive and permeable yeast mutant cells with high protein content.

Mutation in the Bacillus subtilis RNA Polymerase β′ Subunit Confers Resistance to Lipiarmycin

Lipiarmycin (Lprm) (8), a macrocyclic antibiotic also known as tiacumicin (2), is currently under development under the name of OPT-80 (Optimer Pharmaceuticals, Inc., San Diego, Calif.) as a narrow-spectrum antibacterial agent to treat Clostridium difficile-associated diarrhea (1, 7). Lprm is a transcription inhibitor, but unlike rifampin and streptolydigin, it preferentially inhibits holoenzyme transcription at a much greater rate than it inhibits transcription of the core enzyme (5, 6). Genetic mapping experiments in Bacillus subtilis indicate that mutants are located between loci determining rifampin resistance and streptolydigin resistance (6). To precisely identify the positions of the mutations, we selected lipiarmycin-resistant colonies and sequenced the domains of the RNA polymerase located between these two loci. Lprm was produced and purified by fermentation of Actinoplanes deccanensis (DSMZ 43806) by the method of Talpaert et al. (8). Mutant strains were isolated as spontaneous variants of Bacillus subtilis CIP 52.62 that were able to form colonies on nutrient agar plates containing Lprm (40 μg/liter). At this concentration the frequency of resistant colonies was less than 10−7. Among the 10 resistant colonies selected, 8 exhibited an increased MIC for several classes of antibiotics and were likely to be permeability mutants (Table ​(Table1).1). Two mutants (mut1 and mut2) were highly resistant to Lprm. TABLE 1. Antibiotic resistance and transcription activity of Lprm-resistant Bacillus subtilis To correlate the resistance phenotypes with the activity of Lprm on the RNA polymerase, we tested enzymes from the wild-type and mutant colonies in an in vitro transcription assay by the method of Sonenshein et al. (6). The parent cells (CIP 52.62) and mutant cells specifically resistant to Lprm (mut1 and mut2) showed the same pattern of sensitivity to rifampin. In contrast, the transcription activity of the wild-type cells was more strongly affected by the addition of Lprm than was the activity of either mut1 or mut2. This confirmed the link between resistance to Lprm resistance and transcription. mut3 to mut10 strains were equally sensitive to rifampin and Lprm, suggesting that the resistance was not due to a mutation in the polymerase. After purification of the genomic DNA, we PCR amplified and sequenced the regions located between the loci determining rifampin and streptolydigin resistance. The following primers were used: 5′-1285CGTGTGGTTCGTGAGAGAATGT1306-3′, 5′-3257TAAGCTTCAAGTGCCCAAACCT3236-3′, and 5′-2524CTTGTTGGTAAAGTAACGCCTA2545-3′ for rpoB and 5′-1163CGTTTCGCACTCTTAATGTTGTG1141-3′, 5′-593CACAAGGACAACGCCGTAC611-3′, and 5′-2804GTTAACTGTGTACCAGGCTCACC2782-3′ for rpoC. A point mutation resulting in the substitution of the R326 of rpoC by L (CG[T/C]TT) was found in mut1 and mut2 in a highly conserved region; no mutation was detected in mut3 to mut10. When the PCR product harboring the R326L mutation was transfected into B. subtilis CIP 52.62, the frequency of lipiarmycin-resistant bacteria was 100-fold higher than the frequency observed for bacteria with the wild-type fragment. By analogy with the three-dimensional structure of the Thermus aquaticus enzyme (3), R326 is located in proximity to region 3.2 of σ, which in turn occupies the same space as the exiting RNA transcript (3). This could delineate a new binding site for transcription inhibitors.

The effect of alpha-amanitin on the Arabidopsis seed proteome highlights the distinct roles of stored and neosynthesized mRNAs during germination.

To investigate the role of stored and neosynthesized mRNAs in seed germination, we examined the effect of alpha-amanitin, a transcriptional inhibitor targeting RNA polymerase II, on the germination of nondormant Arabidopsis seeds. We used transparent testa mutants, of which seed coat is highly permeable, to better ascertain that the drug can reach the embryo during seed imbibition. Even with the most permeable mutant (tt2-1), germination (radicle protrusion) occurred in the absence of transcription, while subsequent seedling growth was blocked. In contrast, germination was abolished in the presence of the translational inhibitor cycloheximide. Taken together, the results highlight the role of stored proteins and mRNAs for germination in Arabidopsis and show that in this species the potential for germination is largely programmed during the seed maturation process. The alpha-amanitin-resistant germination exhibited characteristic features. First, this germination was strongly slowed down, indicating that de novo transcription normally allows the synthesis of factor(s) activating the germination rate. Second, the sensitivity of germination to gibberellic acid was reduced 15-fold, confirming the role of this phytohormone in germination. Third, de novo synthesis of enzymes involved in reserve mobilization and resumption of metabolic activity was repressed, thus accounting for the failure in seedling establishment. Fourth, germinating seeds can recapitulate at least part of the seed maturation program, being capable of using mRNAs stored during development. Thus, commitment to germination and plant growth requires transcription of genes allowing the imbibed seed to discriminate between mRNAs to be utilized in germination and those to be destroyed.

Critical Regions for Activation Gating of the Inositol 1,4,5-Trisphosphate Receptor

To understand the molecular mechanism of ligand-induced gating of the inositol 1,4,5-trisphosphate (IP(3)) receptor (IP(3)R)/Ca(2+) release channel, we analyzed the channel properties of deletion mutants retaining both the IP(3)-binding and channel-forming domains of IP(3)R1. Using intrinsically IP(3)R-deficient cells as the host cells for receptor expression, we determined that six of the mutants, those lacking residues 1-223, 651-1130, 1267-2110, 1845-2042, 1845-2216, and 2610-2748, did not exhibit any measurable Ca(2+) release activity, whereas the mutants lacking residues 1131-1379 and 2736-2749 retained the activity. Limited trypsin digestion showed that not only the IP(3)-gated Ca(2+)-permeable mutants lacking residues 1131-1379 and 2736-2749, but also two nonfunctional mutants lacking residues 1-223 and 651-1130, retained the normal folding structure of at least the C-terminal channel-forming domain. These results indicate that two regions of IP(3)R1, viz. residues 1-223 and 651-1130, are critical for IP(3)-induced gating. We also identified a highly conserved cysteine residue at position 2613, which is located within the C-terminal tail, as being essential for channel opening. Based on these results, we propose a novel five-domain structure model in which both N-terminal and internal coupling domains transduce ligand-binding signals to the C-terminal tail, which acts as a gatekeeper that triggers opening of the activation gate of IP(3)R1 following IP(3) binding.

Evaluation of the Wider system, a new computer-assisted image-processing device for bacterial identification and susceptibility testing.

The Wider system is a newly developed computer-assisted image-processing device for both bacterial identification and antimicrobial susceptibility testing. It has been adapted to be able to read and interpret commercial MicroScan panels. Two hundred forty-four fresh consecutive clinical isolates (138 isolates of the family Enterobacteriaceae, 25 nonfermentative gram-negative rods [NFGNRs], and 81 gram-positive cocci) were tested. In addition, 100 enterobacterial strains with known beta-lactam resistance mechanisms (22 strains with chromosomal AmpC beta-lactamase, 8 strains with chromosomal class A beta-lactamase, 21 broad-spectrum and IRT beta-lactamase-producing strains, 41 extended-spectrum beta-lactamase-producing strains, and 8 permeability mutants) were tested. API galleries and National Committee for Clinical Laboratory Standards (NCCLS) microdilution methods were used as reference methods. The Wider system correctly identified 97.5% of the clinical isolates at the species level. Overall essential agreement (+/-1 log(2) dilution for 3,719 organism-antimicrobial drug combinations) was 95.6% (isolates of the family Enterobacteriaceae, 96.6%; NFGNRs, 88.0%; gram-positive cocci, 95.6%). The lowest essential agreement was observed with Enterobacteriaceae versus imipenem (84.0%), NFGNR versus piperacillin (88.0%) and cefepime (88.0%), and gram-positive isolates versus penicillin (80.4%). The category error rate (NCCLS criteria) was 4.2% (2.0% very major errors, 0.6% major errors, and 1. 5% minor errors). Essential agreement and interpretive error rates for eight beta-lactam antibiotics against isolates of the family Enterobacteriaceae with known beta-lactam resistance mechanisms were 94.8 and 5.4%, respectively. Interestingly, the very major error rate was only 0.8%. Minor errors (3.6%) were mainly observed with amoxicillin-clavulanate and cefepime against extended-spectrum beta-lactamase-producing isolates. The Wider system is a new reliable tool which applies the image-processing technology to the reading of commercial trays for both bacterial identification and susceptibility testing.

Computer simulation of particle separation based on non-equilibrium swelling

Steric/hyperlayer field-flow fractionation (FFF) is an established analytical technique for separating and characterizing particles in the 1–100 μm diameter range. The separation can be based on differences in size, density, shape and mechanical properties of the particles. In the course of an analysis of the water transporter system of Chinese hamster ovary (CHO) cells and one of their high permeability mutants, the first successful attempt was made to use the steric/hyperlayer FFF system for the purpose of separating particles based on a time-dependent property, namely, the differential swelling of the two cell types. The present study was undertaken to simulate numerically the separation in a steric/hyperlayer FFF system of particles with different swelling kinetics. Its purpose was to optimize the separation and suggest selection of operating conditions to minimize repetitive experiments. The computer simulation was developed using Maple V, a symbolic computing environment. It is shown that the model is able to predict an optimal velocity of carrier buffer that maximizes resolution. Predicted velocity/resolution pairs are in good agreement with available experimental data. Empirical models for the lift forces encountered in such FFF experiments, and for the zone broadening observed in work with cell sized particles, form the basis for this model.

Functional expression of mouse Mdr1 in an outer membrane permeability mutant of Escherichia coli.

Functional expression of the multidrug resistance protein P-glycoprotein (P-gp) in Escherichia coli is providing an appropriate system for structure/function studies and might provide an invaluable tool to screen potential P-gp substrates and inhibitors. The major problem encountered in such studies, however, is the impermeability of the outer membrane of Gram-negative bacteria, which protects microorganisms against the cytotoxic effects of many lipophilic cancer drugs and blocks accessibility of P-gp reversal agents. In the present study we have constructed, by mutagenesis, a "leaky" (containing a permeable outer membrane) strain of E. coli, which is significantly more susceptible to the toxic effect of known P-gp substrates and cytotoxic agents. Expression of mouse Mdr1 in the mutant confers cross-resistance to daunomycin, quinidine, chloroquine, rhodamine 6G, and puromycin. Most importantly, reserpine and doxorubicin completely abolish Mdr1-mediated rhodamine resistance. The results provide strong support for previous observations, suggesting that Mdr1 can be expressed functionally in E. coli and indicate that the leaky mutant will be useful for further structure/function studies of the heterologously expressed eukaryotic drug efflux protein.

Target for bacteriostatic and bactericidal activities of beta-lactam antibiotics against Escherichia coli resides in different penicillin-binding proteins

The relationship between cell-killing kinetics and penicillin-binding protein (PBP) saturation has been evaluated in the permeability mutant Escherichia coli DC2 in which the antimicrobial activity of beta-lactams has been described as being directly related to the extent of saturation of the PBP target(s). Saturation of a single PBP by cefsulodin (PBP 1s), mecillinam (PBP 2), and aztreonam (PBP 3) resulted in a slow rate of killing (2.5-, 1.5-, and 0.8-log-unit decreases in the number of CFU per milliliter, respectively, in 6 h). Saturation of two of the three essential PBPs resulted in a marked increase in the rate of killing, which reached the maximum value when PBPs 1s and 2 were simultaneously saturated by a combination of cefsulodin and mecillinam (4.7-log-unit decrease in the number of CFU per milliliter in 6 h). Inactivation of all three essential PBPs by the combination of cefsulodin, mecillinam, and aztreonam further increased the killing kinetics (5.5-log-unit decrease in the number of CFU per milliliter), and this was not significantly changed upon additional saturation of the nonessential PBPs 5 and 6 by cefoxitin. Similar relationships between PBP saturation and killing kinetics were obtained with imipenem and meropenem at concentrations which inhibited only one PBP (PBP 2), only two PBPs (PBP 1s and 2), or all three essential PBPs. Saturation of one or more PBPs also resulted in a different rate of bacteriolysis, the highest rate being obtained by the cefsulodin-mecillinam combination and by 5 micrograms of either imipenem or meropenem per ml. All of these conditions caused saturation of PBP 2 and saturation or extensive binding of PBP 1s. However, none of these conditions caused determined the fastest possible rate of killing, which occurred only when all three essential PBPs were saturated. It was concluded that the actual killing effect of beta-lactams is reflected by killing rates that approach the fastest possible rate for the given microorganism and that the targets for the bactericidal activity are precisely those PBPs whose saturation or binding occurs under conditions.

Activity of Isepamicin and Selection of Permeability Mutants to -Lactams during Aminoglycoside Therapy of Experimental Endocarditis Due to Klebsiella pneumoniae CF104 Producing an Aminoglycoside Acetyltransferase 6' Modifying Enzyme and a TEM-3 -Lactamase

The pharmacokinetics and efficacy of isepamicin were compared with those of amikacin and gentamicin in a rabbit model of endocarditis due to Klebsiella pneumoniae CF104 producing beta-lactamase TEM-3 and aminoglycoside acetyltransferase AAC(6')-IV. Only isepamicin and gentamicin, alone or combined with ceftriaxone, were effective as determined by titration of viable bacteria in vegetations. Variants highly resistant to ceftriaxone without change in MICs of aminoglycosides were isolated at the end of each therapeutic regimen except with the most effective one (ceftriaxone plus gentamicin). Examination of the bacterial outer membrane proteins as well as the 50% inhibition of the beta-lactamase activity in intact and sonified cells suggested a permeability defect as being responsible for the increased MICs of ceftriaxone. The activity of isepamicin was superior to that of amikacin against the TEM-3-AAC(6')-IV-producing strain. The combination of gentamicin plus ceftriaxone was the most effective regimen in terms of efficacy and prevention of emergence of resistant strains. Suboptimal aminoglycoside monotherapy might be responsible for selection of permeability mutants to beta-lactams.

Activity of cefepime and other beta-lactam antibiotics against permeability mutants of Escherichia coli and Klebsiella pneumoniae.

Permeability mutants were obtained, under selection pressure with cefoxitin, from five strains each of Escherichia coli and Klebsiella pneumoniae. Most mutants showed alterations to their outer membrane protein profiles. In general, the porins OmpC and F were lost from E. coli mutants, and one or both components of a 40 kD doublet were lost from K. pneumoniae mutants. Additional minor changes to outer membrane proteins, of unknown significance, were detected in many of the mutants. MICs of cefepime, ceftazidime and cefpirome for the porin-deficient mutants were up to 128-fold above those for their parent strains, but remained < or = 4 mg/L, whereas those of cefoxitin, cefuroxime, and penicillins were raised above accepted breakpoints. The detection of reduced susceptibility to third- and fourth-generation cephalosporins is in contrast to the findings of other groups. Most (9/10) mutants with high-level cefoxitin resistance were reasonably stable during sequential batch culture in rich media, but susceptible variants tended to overgrow under nutrient depletion in continuous culture. These variants were not true revertants, having failed to regain the major porins: rather they appeared to have undergone compensatory mutations. Their instability probably explains why porin-deficient enterobacteria have not become a significant clinical problem, despite the ease with which they can be selected in vitro.

Mutants carrying conditionally lethal mutations in outer membrane genes omsA and firA (ssc) are phenotypically similar, and omsA is allelic to firA.

We have previously identified the gene (the ssc gene) defective in the thermosensitive and antibiotic-supersusceptible outer membrane permeability mutant SS-C of Salmonella typhimurium and shown that this gene is analogous to the Escherichia coli gene firA (L. Hirvas, P. Koski, and M. Vaara, EMBO J. 10:1017-1023, 1991). Others have tentatively implicated firA in a different function, mRNA synthesis. Here we report that the defect in the thermosensitive outer membrane omsA mutant of E. coli (T. Tsuruoka, M. Ito, S. Tomioka, A. Hirata, and M. Matsuhashi, J. Bacteriol. 170:5229-5235, 1988) is due to a mutation in firA; this mutation changed codon 271 from serine to asparagine. The omsA-induced phenotype was completely reverted by plasmids containing wild-type firA or ssc. Plasmids carrying the omsA allele, or an identical mutant allele prepared by localized mutagenesis, under the control of lac elicited partial complementation. Transcomplementation studies with plasmids carrying various mutant alleles of the S. typhimurium gene indicated that the ability of these plasmids to complement the omsA mutation was similar to their ability to complement the ssc mutation. The antibiotic-supersusceptible phenotype of the omsA mutant closely resembled that of the ssc mutant, i.e., the omsA mutant was supersusceptible to hydrophobic antibiotics and large-peptide antibiotics against which the intact outer membrane is an effective permeability barrier. As previously demonstrated with the omsA mutant, the outer membrane of the ssc mutant became selectively ruptured after incubation for 1 h at the growth-nonpermitting temperature; 82% of the periplasmic beta-lactamase and less than 3% of the cytoplasmic marker enzyme were released into the medium. All of these findings are consistent with our concept that firA is an essential gene involved in generation of the outer membrane.

Effects of chlorhexidine diacetate on Candida albicans, C. glabrata and Saccharomyces cerevisiae.

The effects of chlorhexidine diacetate (CHA) on Candida albicans, C. glabrata and wild-type and mannan, and permeability mutants of Saccharomyces cerevisiae have been studied. A CHA concentration of 10 micrograms/ml had little lethal activity against the Candida strains, but was more effective against S. cerevisiae. Concentrations of 100 and especially 1000 micrograms/ml brought about a much more rapid death of cells. 2-Mercaptoethanol enhanced the activity of CHA to some extent. Some of the mutant strains of S. cerevisiae were rather more sensitive than the wild-type strain. The age of cultures of C. albicans and C. glabrata influenced their response to CHA.