Pepper Golden Mosaic Virus Research Articles

A Germin-Like Protein Gene (CchGLP) of Capsicum chinense Jacq. Is Induced during Incompatible Interactions and Displays Mn-Superoxide Dismutase Activity

A germin-like gene (CchGLP) cloned from geminivirus-resistant pepper (Capsicum chinense Jacq. Line BG-3821) was characterized and the enzymatic activity of the expressed protein analyzed. The predicted protein consists of 203 amino acids, similar to other germin-like proteins. A highly conserved cupin domain and typical germin boxes, one of them containing three histidines and one glutamate, are also present in CchGLP. A signal peptide was predicted in the first 18 N-terminal amino acids, as well as one putative N-glycosylation site from residues 44–47. CchGLP was expressed in E. coli and the recombinant protein displayed manganese superoxide dismutase (Mn-SOD) activity. Molecular analysis showed that CchGLP is present in one copy in the C. chinense Jacq. genome and was induced in plants by ethylene (Et) and salicylic acid (SA) but not jasmonic acid (JA) applications in the absence of pathogens. Meanwhile, incompatible interactions with either Pepper golden mosaic virus (PepGMV) or Pepper huasteco yellow vein virus (PHYVV) caused local and systemic CchGLP induction in these geminivirus-resistant plants, but not in a susceptible accession. Compatible interactions with PHYVV, PepGMV and oomycete Phytophthora capsici did not induce CchGLP expression. Thus, these results indicate that CchGLP encodes a Mn-SOD, which is induced in the C. chinense geminivirus-resistant line BG-3821, likely using SA and Et signaling pathways during incompatible interactions with geminiviruses PepGMV and PHYVV.

Characterization ofGeminivirusResistance in an Accession ofCapsicum chinenseJacq.

Pepper golden mosaic virus (PepGMV) and Pepper huasteco yellow vein virus (PHYVV), members of the Geminiviridae family, are important pathogens of pepper (Capsicum annuum L.) and other solanaceous crops. Accession BG-3821 of C. chinense Jacq. was reported earlier as resistant to mixed infection with PepGMV and PHYVV. In this work, we characterized the Geminivirus resistance trait present in BG-3821. Segregation analysis suggested that resistance depends on two genes. Our data showed that PepGMV replication in protoplast of resistant plants is approximately 70% lower when compared with the levels observed in protoplasts from susceptible plants. Additionally, viral movement is less efficient in resistant plants. We also evaluated several characteristics commonly associated with systemic acquired resistance (SAR), which is a conserved defensive mechanism. The concentration of salicylic acid was higher in resistant plants inoculated with PepGMV than in susceptible plants. Marker genes for SAR were induced after inoculation with PepGMV in resistant leaves. Similarly, we found a higher accumulation of reactive oxygen species on resistant leaves compared with susceptible ones. A model for the mechanism acting in the Geminivirus resistance detected in BG-3821 is proposed. Finally, the importance of BG-3821 in Geminivirus resistance breeding programs is discussed.

Tomato yellow leaf distortion virus, a new bipartite begomovirus infecting tomato in Cuba

In Cuba, the monopartite Tomato yellow leaf curl virus (TYLCV) is the most wide-spread begomovirus infecting tomato (Solanum lycopersicum) that causes the major losses in all production areas, although two bipartite begomoviruses affecting tomato have been identified (Martinez et al., 1997; Ramos et al., 1997). In January 2007, symptoms of yellow mottle and leaf distortion appeared on tomato plants across eastern Cuba. These symptoms differ from those caused by TYLCV-IL[CU] in lacking the typical leaf curling. DNA was isolated from 35 leaf samples with symptoms and tested with TYLCV-specific primers (CTGAATGTTTGGATGGAAATGTGC and GCTCGTAAGTTTCCTCAACGGAC) using PCR. The absence of TYLCV was demonstrated in four DNA samples which showed amplification with generic primers for bipartite begomovirus components DNA A and B (amplicons of approximately 1·1 and 1·2 kb, respectively), demonstrating the presence of a bipartite begomovirus (Rojas et al., 1993). These samples showed strong hybridization signals in Southern blots using av1 and bc1/bv1 genes from Pepper golden mosaic virus as probes, under low stringency conditions. The positive samples were amplified by rolling-circle amplification and the DNA-A was cloned in pBlueScript vector using EcoRI, a restriction enzyme with only one restriction site in the genomic component. A single clone was sequenced (GenBank Accession No. FJ174698) and showed the typical genome organization of bipartite begomoviruses. The sequence was compared with those from other begomoviruses using the program CLUSTAL V and showed less than 89% nucleotide sequence identity (the species demarcation threshold) to all previously reported begomoviruses. The highest identity (83·9%) was with Wissadula golden mosaic St Thomas virus (DQ395343). The data indicates that the begomovirus infecting tomato is a new species for which we propose the name Tomato yellow leaf distortion virus (ToYLDV). Additional work is now needed to determine the distribution of this new virus in tomato production areas of the country and to quantify the losses it causes. The authors would like to thank Red Latinoamericana de Botánica for a fellowship (RLB08-P10) to E. Fiallo-Olivé.

RNA Silencing against Geminivirus: Complementary Action of Posttranscriptional Gene Silencing and Transcriptional Gene Silencing in Host Recovery

RNA silencing in plants is a natural defense system mechanism against invading nucleic acids such as viruses. Geminiviruses, a family of plant viruses characterized by a circular, single-stranded DNA genome, are thought to be both inducers and targets of RNA silencing. Some natural geminivirus-host interactions lead to symptom remission or host recovery, a process commonly associated with RNA silencing-mediated defense. Pepper golden mosaic virus (PepGMV)-infected pepper plants show a recovery phenotype, which has been associated with the presence of virus-derived small RNAs. The results presented here suggest that PepGMV is targeted by both posttranscriptional and transcriptional gene silencing mechanisms. Two types of virus-related small interfering RNAs (siRNAs) were detected: siRNAs of 21 to 22 nucleotides (nt) in size that are related to the coding regions (Rep, TrAP, REn, and movement protein genes) and a 24-nt population primarily associated to the intergenic regions. Methylation levels of the PepGMV A intergenic and coat protein (CP) coding region were measured by a bisulfite sequencing approach. An inverse correlation was observed between the methylation status of the intergenic region and the concentration of viral DNA and symptom severity. The intergenic region also showed a methylation profile conserved in all times analyzed. The CP region, on the other hand, did not show a defined profile, and its methylation density was significantly lower than the one found on the intergenic region. The participation of both PTGS and TGS mechanisms in host recovery is discussed.

Functional analysis of bipartite begomovirus coat protein promoter sequences

We demonstrate that the AL2 gene of Cabbage leaf curl virus (CaLCuV) activates the CP promoter in mesophyll and acts to derepress the promoter in vascular tissue, similar to that observed for Tomato golden mosaic virus (TGMV). Binding studies indicate that sequences mediating repression and activation of the TGMV and CaLCuV CP promoter specifically bind different nuclear factors common to Nicotiana benthamiana, spinach and tomato. However, chromatin immunoprecipitation demonstrates that TGMV AL2 can interact with both sequences independently. Binding of nuclear protein(s) from different crop species to viral sequences conserved in both bipartite and monopartite begomoviruses, including TGMV, CaLCuV, Pepper golden mosaic virus and Tomato yellow leaf curl virus suggests that bipartite begomoviruses bind common host factors to regulate the CP promoter. This is consistent with a model in which AL2 interacts with different components of the cellular transcription machinery that bind viral sequences important for repression and activation of begomovirus CP promoters.

Co-Transmission of Pepper huasteco yellow vein virus and Pepper golden mosaic virus in Chili Pepper by Bemisia tabaci (Genn.)

Co-Transmission of Pepper huasteco yellow vein virus and Pepper golden mosaic virus in Chili Pepper by Bemisia tabaci (Genn.)

Preliminary identification and coat protein gene phylogenetic relationships of begomoviruses associated with native flora and cultivated plants from the Yucatan Peninsula of Mexico

A number of native and cultivated eudicots in the Yucatan Peninsula of Mexico (YPM) exhibit symptoms associated with virus infection. Symptomatic leaves were collected and assessed for begomoviral detection using polymerase chain reaction (PCR), and universal primers that amplify a fragment of the coat protein gene (core Cp). Begomovirus were detected in nine native and seven cultivated species, representing seven eudicot families. DNA extracts from the 16 hosts were used for PCR amplification and sequencing of a fragment containing the coat protein (Cp) gene. The complete Cp sequence was used to establish provisional species identification. Results indicated that 13 distinct begomovirus species were represented. Among these, five potentially new begomovirus species were identified, for which we propose the names Anoda golden mosaic virus (AnGMV), Boerhavia yellow spot virus (BoYSV), Papaya golden mosaic virus (PaGMV), Desmodium leaf distortion virus (DeLDV), and Hibiscus variegation virus (HiVV). Five previously described begomoviral species were provisionally identified for the first time in the YPM; these include Euphorbia mosaic virus (EuMV), Melon chlorotic leaf curl virus (MCLCuV), Okra yellow mosaic Mexico virus (OkYMMV), Sida golden mosaic virus (SiGMV), and Tobacco apical stunt virus (TbASV). Additionally, viruses previously reported from this region, Bean golden yellow mosaic virus (BGYMV), Pepper golden mosaic virus (PepGMV), and Tomato mottle virus (ToMoV) were provisionally identified in cultivated hosts. Phylogenetic analysis provisionally placed all isolates from the YPM in a Western Hemisphere begomovirus clade.

Symptom Remission and Specific Resistance of Pepper Plants After Infection by Pepper golden mosaic virus

ABSTRACT Pepper golden mosaic virus (PepGMV) is an important begomovirus infecting solanaceous crops in Mexico and Central America. Under controlled conditions for growth and inoculation with a low-pressure biolistic device, PepGMV-infected pepper plants consistently showed symptom remission or host recovery 12 to 15 days postinoculation (dpi). Inoculated plants initially developed the characteristic PepGMV symptoms; however, newer leaves presented a significant decrease or disappearance of symptoms. Younger asymptomatic, recovered leaves accumulated lower quantities of viral DNA and transcripts than the ones found in the symptomatic tissue. Nonetheless, viral DNA did not disappear during the evaluation period (up to 35 dpi), suggesting that a population of viral molecules escape from plant defensive mechanisms to maintain a subliminal, symptomless infection. Recovery was correlated with a specific resistance to PepGMV but not to Pepper huasteco yellow vein virus, a different gemi-nivirus commonly found in mixed infections with PepGMV. Virus-related small interfering RNAs were detected in practically all tissues (from symptomatic to recovered leaves) but it was not possible to establish a correlation between concentration and symptom severity. The participation of a posttranscriptional gene silencing mechanism in the recovery process and specific resistance is discussed.

A new begomovirus infecting pepper plants in Cuba

Diseases caused by begomoviruses are a major threat to vegetable production for countries in the Caribbean and Central America. In 1996, an isolate of Tomato yellow leaf curl virus (TYLCV) was reported to be affecting tomato plants (Lycopersicon esculentum) throughout Cuba (Martínez et al., 1996). In 2002, the same virus was detected in pepper (Capsicum annuum) in Camagüey, Sancti Spíritus and Havana provinces and in bean (Phaseolus vulgaris) plants in Havana province (Martínez et al., 2002; Quiñones et al., 2002). During a survey in 2005, in the pepper production areas of eastern Cuban, about 70% of pepper plants growing at an Experimental Station in Holguin province, showed symptoms that differed from those previously described for TYLCV in pepper. Symptoms consisted of plant stunting and a severe leaf yellow mosaic with crinkling and curling. Ten representative plants with symptoms were collected and leaf samples analyzed by transmission electron microscopy. Total nucleic acid was extracted and assayed by non-radioactive nucleic acid hybridisation, using a TYLCV intergenic region probe under low stringency conditions (Quiñones et al., 2002) and by polymerase chain reaction (PCR). All leaf samples showed the presence of typical geminivirus particles, whereas none exhibited hybridisation signals. Using PCR with degenerate primers that specifically amplify the coat protein region from begomoviruses (Wyatt & Brown, 1996), all samples produced amplicons of the expected size (576 bp). PCR amplicons from three samples were cloned in pGEM T-Easy vectors (Promega). The clones were sequenced and BLAST analysis showed the highest identity (98%) within clones; between 93% and 94% identity with Cabbage leaf curl virus (U65529 and AF065815, respectively) and between 87% and 90% identity with Pepper yellow vein virus (AF 063139), Pepper golden mosaic virus (AY368336) and Texas pepper mosaic virus (AF077025). However there was only 68% identity with TYLCV (AJ223505). One of the sequences was deposited in GenBank (DQ207808) as representative of the three clones. This report shows the occurrence of a new begomovirus in pepper plants in Cuba. This work was support by an INCO BETOCARIB project (PL ICA4-2000-10328) and the Cuban Agriculture Biotechnology programs.

A Begomovirus Isolated from Chlorotic and Stunted Soybean Plants in Mexico is a New Strain of Rhynchosia golden mosaic virus.

Soybean (Glycine max Merr.) is an alternative crop during the summer in Sinaloa, a northern state of Mexico. During the last 4 years, symptoms of yellowing, curled leaves, and stunting have been observed on soybean plantings, and a scrutiny of field samples collected in 2003 identified a begomovirus related to Pepper golden mosaic virus in symptomatic plants (4). A new survey was conducted during the summer of 2004 when the soybean disease was prevalent in the region. Affected plants appeared as patches displaying symptoms ranging from mild to severe yellow mosaic with leaf deformation and stunted growth in several parcels of commercial fields of northern Sinaloa. More than 100 samples from symptomatic soybean plants and weeds growing within the same fields were collected and analyzed for the presence of begomoviruses using DNA hybridization with the coat protein gene of Pepper huasteco yellow vein virus as a probe. Thirty-eight soybean, 12 Rhynchosia sp., and 14 sunflower hybridization-positive samples were subsequently used for polymerase chain reaction (PCR) amplification with the degenerate primers pRep-DGR and pCP70-Mot (1). PCR products were cloned into pGEM-T Easy vector (Promega, Madison, WI) and sequenced. The amplified viral DNA (915 nt) from two soybean plants, Sb1 and Sb2 (GenBank Accession Nos. AY955101 and AY957561, respectively), one isolate from Rhynchosia minima (GenBank Accession No. AY955102), and one from Heliantus annum (GenBank Accession No. AY957560) were sequenced and compared with DNA sequences available at NCBI database using BLAST. The highest sequence similarity was obtained with the two known isolates of Rhynchosia golden mosaic virus, RhGMV [Honduras] (GenBank Accession No. AF239671), and RhGMV [Chiapas] (GenBank Accession No. AF408199), displaying a nucleotide identity of approximately 89% with the Sinaloa isolates. Sequence comparisons of the latter isolates showed that viruses in the weeds were 97% identical to one of the soybean isolates, RhGMV-Sb1, but differed significantly (88% of nucleotide identity) from the second soybean isolate, RhGMV-Sb2. The complete genome A sequence of RhGMV-Sb1 was determined using PCR amplification of viral DNA with four degenerate primers recently described (2), cloning of overlapping PCR products into pGEM-T Easy vector (Promega) and sequencing. The 2,604-bp DNA-A of RhGMV-Sb1 (GenBank Accession No. DQ347950) was compared with the homologous genome of RhGMV [Chiapas] and RhGMV [Honduras] using the CLUSTAL alignment method (MegAlign, DNASTAR software, London) and an overall nucleotide identity of 89.2 and 88.6%, respectively, was determined. Current taxonomic criteria for begomoviruses establish that a DNA-A sequence identity lower than 93% with other isolates of a virus is indicative of a separate strain (3). Therefore, the virus identified in this study is a new strain of RhGMV that is provisionally named Rhynchosia golden mosaic virus-Soybean [Mexico:Sinaloa:2004]. This is the first soybean-infecting begomovirus from the American continent whose genome A has been completely characterized as of today.

A Begomovirus Associated with Leaf Curling and Chlorosis of Soybean in Sinaloa, Mexico is Related to Pepper golden mosaic virus.

Since June 2001, symptoms of yellowing, leaf curling, crumpling, and stunted growth were observed on soybean (Glycine max Merr.) plants in Sinaloa, Mexico. These symptoms and the presence of whiteflies (Bemisia tabaci Gennadius) in the affected fields suggested a viral etiology. Samples from symptomatic plants were collected from commercial fields and analyzed for the presence of begomoviruses using DNA hybridization, and as a probe, the DNA A of Pepper huasteco virus at low stringency (2). Thirty-five positive samples were subsequently used for polymerase chain reaction (PCR) amplification with the degenerate primers RepMot and CPMot (1). These primers direct the amplification of a DNA A segment comprising the entire intergenic region (IR) and the first 210 bp of the coat protein (CP) gene, which is highly variable in size and nucleotide sequence among begomoviruses. PCR products were obtained for 25 of 35 samples and five of these were cloned into the pGEM-T easy vector (Promega, Madison, WI) and sequenced. The 571-bp DNA sequence (GenBank Accession No. AY905553) was compared with sequences of other begomoviruses in GenBank using the Clustal alignment method (MegAlign, DNASTAR software, London). The sequence was 74 and 70% identical to the Pepper golden mosaic virus (PepGMV; GenBank Accession No. U57457) and Cabbage leaf curl virus (CaLCuV; GenBank Accession No. U65529) sequences, respectively. Interestingly, the partial coat protein gene sequence (210 nt) of this soybean-infecting virus was 98% identical to the CP gene of Tobacco apical stunt virus (TbASV; GenBank Accession No. AF076855). Nonetheless, the known sequence of TbASV intergenic region (GenBank Accession No. AF077744) is very different from the homologous region of the soybean virus (34% of nucleotide identity). Analysis of the soybean virus intergenic region revealed that it harbors almost identical iterons (i.e., Rep-binding sites) to PepGMV, suggesting a close relationship between these two viruses. Soybean-infecting geminiviruses have been previously reported only from Asia; however, the partial sequence of a begomovirus isolated from soybean in Brazil was recently deposited in Genbank (Accession No. AY436328). Sequence comparisons between the Brazilian and Mexican isolates showed these viruses are less related with a nucleotide identity of 46%. Taken together, our data indicate that the virus identified in this study might be either a different strain of PepGMV adapted to leguminous plants or a new begomovirus species. To our knowledge, this is the first report of a begomovirus infecting soybean in Mexico.

Genetic and Phenotypic Variation of the Pepper golden mosaic virus Complex

ABSTRACT Three isolates of the bipartite begomovirus Pepper golden mosaic virus (PepGMV) were characterized for genomic and biological properties. The complete nucleotide sequences of the DNA-A and DNA-B components were determined from infectious clones of PepGMV-Serrano (PepGMV-Ser), PepGMV-Mosaic (PepGMV-Mo), and PepGMV-Distortion (PepGMV-D). Nucleotide sequence identity among PepGMV components ranged from 91 to 96% for DNA-A and from 84 to 99% for DNA-B, with each PepGMV component most closely related to the corresponding component of Cabbage leaf curl virus (CaLCV). However, phylogenetic relationships among begomovirus components were incongruent because DNA-A of PepGMV and CaLCV share an inferred evolutionary history distinct from that of DNA-B. The cloned components of PepGMV-Ser, -Mo, and -D were infectious by biolistic inoculation to pepper but differed in symptom expression: PepGMV-Ser exhibited a bright golden mosaic, PepGMV-Mo produced a yellow-green mosaic, and PepGMV-D caused only a mild mosaic and foliar distortion followed by a "recovery" phenotype in which leaves developing after initial symptom expression appeared normal. Differences in symptoms also were observed on tomato, tobacco, and Datura stramonium. Progeny virus derived from clones of PepGMV-Ser and -Mo were transmitted from pepper to pepper by the B biotype of Bemisia tabaci; progeny virus derived from PepGMV-D clones was not transmissible by the B biotype. Reassortant genomes derived from heterologous DNA components of the three isolates were infectious in all possible pairwise combinations, with symptom phenotype in pepper determined by the DNA-B component. Collectively, these results indicate that the three virus isolates examined may be considered distinct strains of PepGMV that have the capacity to exchange genetic material.

Genetic diversity and mixed infections of begomoviruses infecting tomato, pepper and cucurbit crops in Nicaragua

Begomoviruses were detected in Nicaraguan fields of tomato (Lycopersicon esculentum) and adjacently growing plants of pepper (Capsicum annuum), chilli pepper (C. baccatum), cushaw (Cucurbita argyrosperma) and Mexican fireplant (Euphorbia heterophylla) using polymerase chain reaction (PCR) and universal begomovirus primers. All tomato and Mexican fireplant plants showing symptoms were infected with begomoviruses, while only 30–46% of the pepper, chilli pepper and cushaw plants showing symptoms tested virus‐positive. No begomoviruses were found in potato. The virus species were provisionally identified by sequencing 533 bp of the viral coat protein gene (AV1). Tomato severe leaf curl virus (ToSLCV), Tomato leaf curl Sinaloa virus (ToLCSinV) and Pepper golden mosaic virus (PepGMV) were found to infect both tomato and pepper. A new provisional species designated Tomato leaf curl Las Playitas virus (ToLCLPV) was detected in a tomato plant. Squash yellow mottle virus (SYMoV) and PepGMV were found in cucurbits, the latter for the first time in this host. Euphorbia mosaic virus (EuMV) was detected in Mexican fireplant. Sequencing of a larger number of PCR‐amplified clones from selected plants revealed intraspecific viral sequence variability, and also multiple begomovirus infections which could represent up to three species in a single tomato or cushaw plant. Phylogenetic grouping of virus sequences did not correlate with the host of origin.

A New Begomovirus Causes Tomato Leaf Curl Disease in Baja California Sur, Mexico.

More than 10,000 ha of tomatoes are grown in the field and greenhouses on the Baja California Peninsula of Mexico. Information about the etiology of geminivirus-like diseases affecting tomato crops in all horticultural regions in the area has been difficult to obtain and assess. From 2001 through 2003, stunting, foliar discoloration, reduced leaf size, and leaf crumpling symptoms were observed and analyzed in one large area of tomato plantings in El Carrizal (near the city of La Paz in Baja California Sur). This leaf curl disease resembled that caused by Chino del tomate virus and has been observed at levels of incidence ranging from 60 to 90%. DNA isolated from symptomatic plants was analyzed using DNA hybridizaton and polymerase chain reaction (PCR) amplification of the 5' regions of the replication and coat protein genes, including the intergenic region (3). Comparisons of the nucleotide sequence (GenBank Accession No. AY339619) with corresponding sequences in GenBank resulted in 84.2% identity with Tomato mild mottle virus and 61.7% with Tomato severe leaf curl virus; both isolates originate from Central America. The relatively low nucleotide sequence identities from its closest relatives suggested that the virus may be a new begomovirus species of unambiguous American ancestry. In a phylogenetic analysis using PAUP 4.0 software, the Baja California isolate clustered in a separate group from other Mexican sequences. Moreover, the iteron (iterative sequences motifs associated in virus replication) arrangements (1) are unique among known New World begomoviruses, but identical to analogous elements from a tobacco-infecting begomovirus from China. On the other hand, it is well known that there are interactions between geminiviruses in mixed infections in some horticultural areas of Mexico (2). To determine the identity of the putative geminivirus involved in the disease, we used selected restriction enzyme (EcoRI, HindIII and XbaI) analysis and PCR with specific primers. No evidence of mixed infections with other geminiviruses was obtained. DNA fragments of the expected size (1.1 kb) showed different digestion patterns compared with other well-characterized geminiviruses isolated from Mexico such as Chino del tomate virus, Pepper huasteco yellow vein virus, Tomato leaf curl Sinaloa virus, and Pepper golden mosaic virus. Epidemiological, experimental, and natural host range studies indicated that the Baja California isolate has a relatively narrow host range infecting tomatoes, peppers (Capsicum annuum L.), and Peruvian apple (Nicandra physalodes L.). Reproduction of characteristic leaf curling symptoms in tomato seedlings infected with viruliferous whiteflies (Bemisia tabaci Genn.) and inoculated biolistically using infectious DNA (0.5 μg/ml) as inoculum were obtained. Koch's postulates were completed using PCR and DNA hybridization to confirm virus identity. These results confirm that the Baja California isolate is different from other begomoviruses isolated from Mexico. The virus is tentatively named Tomato chino Baja California virus (ToChBCV), genus Begomovirus, family Geminiviridae.

Pepper golden mosaic virus Affecting Tomato Crops in the Baja California Peninsula, Mexico.

In the state of Baja California Sur, tomatoes (Lycopersicon esculentum Mill.) are cultivated on approximately 1,000 ha. Occurrence of viral diseases is currently causing low yields and severe losses. Virus-like symptoms (severe leaf curling, stunting, reduced leaf size, and mosaic patterns) were observed on 99% of tomato plants in 2002 in La Paz, Baja California Sur. Whiteflies (Bemisia tabaci Gennadius) were present in affected fields and appeared to be associated with the disease. The virus was experimentally transmitted from infected plants to tomato and peppers seedlings by whiteflies and as infectious DNA (replicative form) by mechanical and biolistic inoculation. Symptoms similar to those found in the field were observed in experimental transmission assays. DNA from inoculated plants was extracted and analyzed by DNA hybridization and polymerase chain reaction (PCR) using degenerate (1) and specific (2) primers. The PCR products (1.1 kb) obtained from the common region (GenBank Accession No. AY368336) suggested the presence of a bipartite geminivirus. The nucleotide sequence of the PCR products showed a 98% identity to Pepper golden mosaic virus-Tamaulipas strain (PepGMV-Tam) in the intergenic region (IR). Similar identities (97%) were obtained by using the predicted amino acid sequences of the amino termini of the coat proteins. Identities in the replication proteins (92%) and IR iterative sequence analyses show that the PepGMV-La Paz isolate is a closely related strain of PepGMV-Tam. To our knowledge, this is the first report of PepGMV affecting tomato crops in Baja California Sur, Mexico.

IDENTIFICATION OF RESISTANCE TO SINGLE AND MIXED INFECTIONS OF PEPPER GOLDEN MOSAIC VIRUS (PepGMV) AND THE HUASTECO PEPPER VIRUS IN CHILI PEPPERS (Capsicum chinense Jacq.).

In this study, resistance to single and mixed infections to pepper golden mosaic virus (PepGMV) in Capsicum chinense Jacq. individuals were evaluated. Plant inoculation was carried out by biolistics and grafting. To 140 plants from seven accessions of C. chinense Jacq., inoculations were preformed with PepGMV. Of these plants, 99 were asymptomatic, although the virus was detected by ELISA and PCR techniques. Additionally, resistance to geminivirus (PepGMV and Pepper huasteco virus or PHV) mixed infections, was evaluated in these accessions. Thirty-one plants from the accessions with the best characteristics of resistance to single infections by PepGMV were evaluated, and 15 individuals displayed resistance in different degrees. Resistance to geminivirus mixed infections was grouped as: delayed symptoms, symptom remission and asymptomatic plants. DNA levels of both geminiviruses correlated positively with symptom severity.

Resistance to Geminivirus Mixed Infections in Mexican Wild Peppers

Screening for resistance to mixed infections with pepper huasteco virus (PHV) and pepper golden mosaic virus (PepGMV) was carried out on plants representing wild pepper accessions collected in different states of México. One accession collected in Yucatán (BG-3821) corresponded to Capsicum chinense Jacq., and three collected from Michoacán (BG-3818), Tamaulipas (BG-3820), and Sinaloa (BG-3819) were identified as C. annuum L. Forty-eight plants were initially inoculated with a 1:1 mix of PHV and PepGMV DNAs by a biolistic method. Those plants that did not show typical symptoms after the biolistic method, were inoculated by grafting. Half of the plants (24) were highly susceptible, while the other half expressed different degrees of resistance. Of the resistant individuals, eight plants were asymptomatic and viral DNA of both viruses was detected in low levels. Two individuals showed delayed symptoms 34 days after symptom expression in the control plants. This delay was correlated with an increase in PHV DNA levels when plants became symptomatic. The remaining 14 plants showed symptom remission in newly developed leaves at 31 days postinoculation, and this asymptomatic effect was correlated diminished PHV DNA within the plants. Our results suggest that the resistance shown by some individuals to geminivirus mixed infections (PHV and PepGMV) is likely due to constrains in viral movement.

Interactions Between Geminiviruses in a Naturally Occurring Mixture: Pepper huasteco virus and Pepper golden mosaic virus

ABSTRACT Pepper huasteco virus (PHV) and Pepper golden mosaic virus (PepGMV) are found in mixtures in many horticultural crops in Mexico. This combination constitutes an interesting, naturally occurring model system to study several aspects of virus-virus interactions. Possible interactions between PHV and PepGMV were studied at four levels: symptom expression, gene expression, replication, and movement. In terms of symptom expression, the interaction was shown to be host-dependent because antagonism was observed in pepper, whereas synergism was detected in tobacco and Nicotiana benthamiana. PHV and PepGMV did not generate viable pseudorecombinant viruses; however, their replication is increased during mixed infections. An asymmetric complementation in movement was observed because PHV was able to support the systemic movement of PepGMV A whereas PepGMV did not support the systemic distribution of PHV A. Heterologous transactivation of both coat protein promoters also was detected. Several conclusions can be drawn from these experiments. First, viruses coinfecting the same plant can interact at several levels (replication, movement) and in different manners (synergism, antagonism); some interactions might be host dependent; and natural mixed infections could be a potential source of geminivirus variability by generating viable tripartite combinations that could facilitate recombination events.

Pepper huasteco virus and Pepper golden mosaic virus are Geminiviruses Affecting Tomatillo (Physalis ixocarpa) Crops in Mexico.

Whitefly-transmitted geminivirus diseases cause important losses in several horticultural crops in all areas in Mexico (1). Tomatillo is important in the Mexican diet since it is widely used to prepare many types of salsas and other dishes. As a result, tomatillo, also known as tomate verde (green tomato), is cultivated in 29 of 32 states in Mexico, with the main production areas located in the states of Morelos, Puebla, and Michoacán. Leaf samples of 105 tomatillo plants exhibiting yellowing, yellowing mosaic, leaf curl, bunchy top, and stunting were collected from the states of Puebla, Morelos, Estado de México, and Sinaloa. Symptomatic plants were associated with the presence of whiteflies in many fields and suggested a viral etiology. Total DNA extracted from symptomatic tomatillo plants was used as a template in a polymerase chain reaction (PCR)-based geminivirus detection procedure. MP16 and MP82 primers (2) were used to direct the amplification of a segment from the stem-loop structure in the intergenic region (IR) to a conserved region in the coat protein (CP) of begomoviruses (2). Sixty-nine percent (72/105) of the samples produced the expected PCR fragment (400 to 450 bp). Similar results were obtained with a dot-blot hybridization procedure using as a probe the component A of Pepper huasteco virus (PHV) under low stringency conditions. More than 50 PCR products were cloned and sequenced. Sequence analysis (nucleotide level for the IR; amino acid level for the CP) revealed that the tomatillo-infecting geminiviruses clustered into two main groups. The first group showed a high percent identity (average of 95.3% at the CP N terminus) to PHV, whereas the second showed a similarly high percent (average 93.8%) identity to Pepper golden mosaic virus (PepGMV, previously called Texas pepper geminivirus. Both PepGMV and PHV were found in all sampled areas. Although mixed infections (differentiated by the respective IR probes) of PHV and PepGMV were common (61%), single infections were also detected (PHV 27%; PepGMV 10%). The presence of begomoviruses in tomatillo crops has been previously reported (1); however, their identity as PHV and PepGMV was not confirmed.