Nuclear rDNA Region Research Articles

DESCRIPTIONS AND PHYLOGENETIC AFFINITIES OF TWO NEW SPECIES OF RHABDIAS STILES AND HASSALL, 1905 (NEMATODA: RHABDIASIDAE) FROM NORTH AMERICAN FROGS: ARE WE STILL ONLY SCRATCHING THE SURFACE?

Two new species of lung-dwelling nematodes are described from North American frogs: Rhabdias aurorae n. sp. from Rana aurora and Rhabdias conni n. sp. from Rana clamitans and Rana catesbeiana from Arkansas; the latter species was also found in Oklahoma and Georgia. Rhabdias aurorae n. sp. differs from other Nearctic congeners in the combination of the following characteristics: buccal capsule 22-25 μm wide, elongated tail covered with inflated cuticle, esophagus with prominent dilatation in anterior part and 6 small circumoral lips. Rhabdias conni n. sp. is morphologically closest to Rhabdias ranae Walton, 1929 and Rhabdias joaquinensisIngles, 1936; it differs from them in the shape of lateral pseudolabia, the dimensions of the body, and the egg size. Both new species were found to be significantly different from the Nearctic congeners in the nucleotide sequences of nuclear ribosomal DNA (18S-ITS-28S region), 12S, and CO1 mitochondrial genes. The 2 new species differ from other currently sequenced Nearctic congeners by 1.1-2.7% of nucleotide positions in the nuclear rDNA region, 1.3-3.4% in the 12S gene, and 3.4-9.4% in CO1 gene. Molecular phylogenetic analysis based on nuclear ribosomal DNA sequences placed both new species into the clade consisting of Nearctic and Neotropical Rhabdias spp. The position of Rh. aurorae n. sp. within the clade is uncertain because of a polytomy, but Rh. conni n. sp. is nested within the "Rh. joaquinensis complex" related to Rh. ranae and Rhabdias tarichaeKuzmin, Tkach, and Snyder, 2003. The phylogenetic analysis based on nuclear ribosomal DNA sequences has revealed 3 evolutionary host-switching events from anuran to caudatan hosts among Rhabdias spp. that occurred in the Nearctic and Palearctic. The molecular phylogeny also suggests that Rhabdias may have originally evolved in what is now Africa.

Notes of Five Wood-Decaying Fungi from Juwangsan National Park in Korea

Wood-decaying fungi are essential decomposers in forest ecosystems. They decompose wood substrates by producing various lignocellulolytic enzymes, which have significant industrial and medical applications. A survey was conducted at the Juwangsan National Park from 2018 to 2019 to determine the diversity of macrofungi in Korea. Five previously unrecorded wood-decaying polyporoid and corticioid fungi were identified among the collected specimens: Eichleriella sinensis, Hymenochaete anomala, Hyphoderma subsetigerum, Lyomyces orientalis, and Pseudowrightoporia crassihypha. These species were identified based on morphological, molecular, and phylogenetic analyses of the internal transcribed spacer (ITS) and nuclear large subunit rDNA (nLSU) region. In this study, we provide detailed macro- and micro-morphological figures with phylogenetic trees to support the discovery of five new species in Korea.

First Morphological and Molecular (28S rDNA) Characterization of Eudiplozoon nipponicum (Monogenea, Diplozoidae) parasitizing Cyprinus carpio, Kurdistan Region, Iraq

The present study is the first morphological and molecular characterization of a monogenean Eudiplozoon nipponicum (Goto, 1891) parasitizing gill filaments of common carps (Cyprinus carpio) obtained from the Lesser Zab River in northeastern Iraq in the subdistrict of Altun-Kopru from July to October 2022 and transported to the Laboratory of Zoology Research, Salahaddin University-Erbil, Iraq. Most previous studies regarding the considered parasite have targeted morphological data analysis. However, DNA sequence outline is typically supportive in systematics, since it contains aspects that are absent from morphological research. The main goal was to molecularly identify E. nipponicum utilizing the nuclear 28S rDNA region by PCR and nucleotide sequencing approach. The sequences were obtained and compared to the accessible GenBank sequences. The results justify the validation of E. nipponicum in Iraq using traditional (morphology-based) and modern (molecular-based) parasitological techniques. The latter one showed 99.11% (identity percentage) of E. nipponicum in comparison to the registered sequences of NCBI. Additionally, this was considered the first wide-ranging morphological and molecular study in the studied region. The phylogenetic relationship was concluded using Maximum Likelihood (ML) method. It was concluded that besides of the morphological characterization of E. nipponicum, PCR sequencing was considered a suitable molecular method for recognizing monogenean diplozoid species on the fishes.

Phaeohyphomycosis due to Exophiala in Aquarium-Housed Lumpfish (Cyclopterus lumpus): Clinical Diagnosis and Description.

Phaeohyphomycosis caused by Exophiala species represents an important disease of concern for farmed and aquarium-housed fish. The objective of this study was to summarize the clinical findings and diagnosis of Exophiala infections in aquarium-housed Cyclopterus lumpus. Clinical records and postmortem pathology reports were reviewed for 15 individuals from 5 public aquaria in the United States and Canada from 2007 to 2015. Fish most commonly presented with cutaneous ulcers and progressive clinical decline despite topical or systemic antifungal therapy. Antemortem fungal culture of cutaneous lesions resulted in colonial growth for 7/12 samples from 8 individuals. Amplification of the internal transcribed spacer region (ITS) of nuclear rDNA identified Exophiala angulospora or Exophiala aquamarina in four samples from three individuals. Postmortem histopathologic findings were consistent with phaeohyphomycosis, with lesions most commonly found in the integument (11/15), gill (9/15), or kidney (9/15) and evidence of fungal angioinvasion and dissemination. DNA extraction and subsequent ITS sequencing from formalin-fixed paraffin-embedded tissues of seven individuals identified E. angulospora, E. aquamarina, or Cyphellophora sp. in four individuals. Lesion description, distribution, and Exophiala spp. identifications were similar to those reported in farmed C. lumpus. Antemortem clinical and diagnostic findings of phaeohyphomycosis attributable to several species of Exophiala provide insight on the progression of Exophiala infections in lumpfish that may contribute to management of the species in public aquaria and under culture conditions.

Molecular Phylogeny of Russian Species of the Genus Spiraea (Rosaceae) according to the Nucleotide Variability of the ITS Nuclear rDNA Region

Molecular Phylogeny of Russian Species of the Genus Spiraea (Rosaceae) according to the Nucleotide Variability of the ITS Nuclear rDNA Region

Characterization of Clinostomum (Digenea: Clinostomidae) spp. in India

Platyhelminths belonging to the family Clinostomidae (Digenea) have a worldwide distribution and are known to infect piscivorous birds through their intermediate hosts, usually fish species. In the present study, clinostome metacercariae were collected from fish hosts, including Channa punctata (Bloch 1793) (n = 25) and Trichogaster fasciata Bloch and Schneider 1801 (n = 25), from a freshwater system in India. The experimental infection of cattle egrets, Ardea (Bubulcus) ibis Linnaeus 1758, with some of the live metacercariae found in the present study was successful. Live adult parasites were obtained from the buccal cavity of the birds. Both metacercaria and adult specimens were subjected to molecular studies to obtain the sequences of 28S, ITS1, and ITS2 (nuclear rDNA) regions. The parasites were found to belong to three species, Clinostomum giganticum Agarwal 1959; C. piscidium Southwell and Prashad 1918; and Euclinostomum heterostomum (Rudolphi 1809). Phylogenetic analyses of the sequences obtained from the adults and metacercariae established a link between the metacercariae in the fish hosts and adults in the avian host, which is essential to elucidate their partial life cycle and specify morphological characteristics in the metacercarial stage.

First Report of Sclerotinia minor on lettuce in Serbia.

Lettuce (Lactuca sativa L.) is the world's most popular leafy salad vegetable. One of the major challenges facing lettuce producers are fungal diseases that could, under favorable conditions, devastate the harvest (Raid, 2004). During February 2021, poor growth, plant stunning and blanching of leaves of lettuce plants, cultivated in unheated plastic tunel in Potočanje (Zlatibor region), Serbia, were observed. The crowns were softened with spreading decaying lesions covered with white mycelium, particulary on the leaves near the soil surface. Approximately 2 to 3 weeks before harvest, diseased plants began to wilt and collapse. Estimated disease incidence was 50-55%. In order to identify the causal agent, symptomatic tissues from diseased plants were cut into small pieces, surface sterilized with 70% ethanol for 1 min, rinsed three times in sterile distilled water and placed on potato dextrose agar (PDA). Five isolates with uniform morphology were derived from infected tissue. The colonies had fast-growing, white, cottony aerial mycelium, producing profuse numbers (184 sclerotia/ Petri plate in average) of small, black, irregularly shaped sclerotia, less than 2 mm in diameter. Based on morfological features, the isolates were identified as Sclerotinia minor Jagger (Kohn, 1979). To confirm the species identity, the internal transcribed spacer region of nuclear rDNA of a representative isolate 15-2 was amplified using the primer pair ITS1/ITS4 (White et al. 1990). Sequence analysis of ITS region revealed 100% nucleotide identity between the isolate 15-2 (GenBank Accession No. OL423632.1) and 14 isolates of S. minor from different parts of the world (e.g., accession Nos. MK356551.1, KY707828.1, JF2798801.1). Pathogenicity tests were conducted by artificial inoculation of 55-day-old lettuce plants cv. 'Majska kraljica', grown on commercial growth substrate in l L pots. The obtained isolates were grown on PDA for 7 days and mycelial plugs, 5 mm in diameter, were cut from the margin of the colony and placed mycelium-side down on undamaged ground-level leaves of lettuce plants. Two plugs per isolate were placed onto five plants each for a total of ten replicates per isolate. Negative control plants (5) were inoculated similarly with sterile PDA plugs. Inoculated plants were covered with transparent plastic bags, sprayed with water (under the plastic) twice a day for 3 to 5 days to maintain high humidity, and kept in a growth chamber at 22°C (13 h light). After 7 to 10 days, all pathogen-inoculated plants developed lettuce drop disease symptoms, whereas the control plants remained symptomless. The pathogen was reisolated from symptomatic leaves and Koch's postulates were completed by confirming the identity of the isolates. To our knowledge, this is the first report of S. minor on lettuce in Serbia. More research is needed to better understand this disease, establish control strategies and minimize the spread of the pathogen to other lettuce-producing areas of the country.

Phylogenetic Evidence for the Lissorchiid Concept of the Genus Anarhichotrema Shimazu, 1973 (Trematoda, Digenea)

Anarhichotrema Shimazu, 1973 is a monotypic digenean genus, with the type- and only species, Anarhichotrema ochotense Shimazu, 1973, known to infect North Pacific fishes. This genus was originally described as a member of the Lissorchiidae (Monorchioidea) and later moved to the Zoogonidae (Microphalloidea). Its exact phylogenetic position has remained unresolved due to the lack of molecular data. In this study, we isolated specimens of A. ochotense from the Bering wolffish, Anarhichas orientalis Pallas, 1814 caught in the Sea of Okhotsk, described them morphologically and performed a molecular phylogenetic analysis of their nuclear 18S and 28S rDNA regions. The specimens examined in our study generally corresponded to previous morphological descriptions of A. ochotense but were noticeably smaller, possibly due to the crowding effect. The phylogenetic analysis placed Anarhichotrema within the Lissorchiidae as a sister taxon to the group comprising freshwater lissorchiids. Thus, we restore Anarhichotrema to the Lissorchiidae, as originally assigned.

About diagnostic features of Polygonum L. genus. Perianth

The genus Polygonum is quite difficult to define due to its inherent biological characteristics. Purpose of the work: to analyze the shape of the perianth of representatives of different subsections of the section Polygonum of the genus and to determine its diagnostic value.For diagnostic purposes, in addition to the known signs, it is proposed to use the shape of the perianth, which is determined by the following indicators: the ratio of the length and width of the perianth; the presence and position of the greatest width (in the lower, middle, upper part) of the perianth; the position of the perianth lobes, characterizing the degree of its openness - closed (closed), converging (half-open), erect and diverging (open). Siberian representatives of the genus Polygonum have 8 perianth forms: tubular, water lily, oblong-ovate, ovate, funnel-shaped, bell-shaped, goblet, and cupped. The perianth forms correspond to the subsections of the Polygonum section: tubular - Salsuginea, water lily - Polygonum, funnel-shaped - Arenaria, bell-shaped - Oxysperma, goblet - Humifusa. The presence of an oblong-ovoid perianth in the representatives of the subsections Acetosa, Patula and some species of the subsection Arenaria can be explained by their genetic proximity, and the goblet shape in some species of the subsections Polygonum, Patula - by their hybridogenic nature. The results of the performed analysis of the perianth forms reflect the system of the river. Polygonum. Both the distribution of perianths by subsections of the typical section, and deviations from the typical perianth forms for subsections are explained in the materials on the system and phylogeny of the r. Polygonum, obtained by the methods of factorial and discriminatory analyzes, RAPD-analysis of populations and in the results of the analysis of nucleotide polymorphism of the ITS 1-2 region of nuclear rDNA by the methods of maximum economy (MP) and maximum likelihood (ML).

MOLECULAR IDENTIFICATION OF JUVENILE NEOECHINORHYNCHUS SPP. (PHYLUM: ACANTHOCEPHALA) INFECTING OSTRACOD AND SNAIL HOSTS PROVIDES INSIGHT INTO ACANTHOCEPHALAN HOST USE.

The role of invertebrates in some acanthocephalan life cycles is unclear because juvenile acanthocephalans are difficult to identify to species using morphology. Most reports suggest acanthocephalans from turtle definitive hosts use ostracods as intermediate hosts and snails as paratenic hosts. However, laboratory studies of the life cycle suggest that ostracods and snails are both required hosts in the life cycle. To elucidate the role of ostracods and snails in acanthocephalan life cycles better, we collected 558 freshwater snails of 2 species, including Planorbella cf. Planorbella trivolvis and Physa acuta, from 23 wetlands in Oklahoma, U.S.A., and examined them for acanthocephalan infections. Additionally, we examined 37,208 ostracods of 4 species, Physocypria sp. (morphotype 1), Cypridopsis sp., Stenocypris sp., and Physocypria sp. (morphotype 2) for juvenile acanthocephalans from 2 wetlands in Oklahoma. Juvenile acanthocephalans were morphologically characterized, and the complete internal transcribed spacer (ITS) region of nuclear rDNA was sequenced from acanthocephalans infecting 11 ostracod and 13 snail hosts. We also sampled 10 red-eared slider turtles, Trachemys scripta elegans, and 1 common map turtle, Graptemys geographica, collected from Oklahoma, Arkansas, and Texas and recovered 1,854 adult acanthocephalans of 4 species. The ITS of 17 adult acanthocephalans of 4 species from turtle hosts were sequenced and compared to juvenile acanthocephalan sequences from ostracod and snail hosts from this study and GenBank to determine conspecificity. Of the 23 locations sampled for snails, 7 (30%) were positive for juvenile acanthocephalans in the genus Neoechinorhynchus. The overall prevalence and mean intensity of acanthocephalans in Planorbella cf. P. trivolvis and P. acuta were 20% and 2 (1-6) and 2% and 1 (1), respectively. In contrast, only 1 of 4 species of ostracods, Physocypria sp. (morphotype 1), was infected with larval/juvenile Neoechinorhynchus spp. with an overall prevalence of 0.1% and a mean intensity of 1 (1-2). Although 4 species of acanthocephalans infected turtle definitive hosts, including Neoechinorhynchus chrysemydis, Neoechinorhynchus emydis, Neoechinorhynchus emyditoides, and Neoechinorhynchus pseudemydis, all the ITS sequences from cystacanths infecting snail hosts were conspecific with N. emydis. In contrast, the ITS sequences from larval/juvenile acanthocephalans from ostracods were conspecific with 2 species of acanthocephalans from turtles (N. emydis and N. pseudemydis) and 1 species of acanthocephalan from fish (Neoechinorhynchus cylindratus). These results indicate that N. emydis infects freshwater snails, whereas other species of Neoechinorhynchus appear not to infect snail hosts. We document new ostracod and snail hosts for Neoechinorhynchus species, including the first report of an ostracod host for N. pseudemydis, and we provide novel molecular barcodes that can be used to determine larva, juvenile, and adult conspecificity of Neoechinorhynchus species.

Global Phylogeography of Salmonid Ectoparasites of the Genus Gyrodactylus, with an Emphasis on the Origin of the Circumpolar Gyrodactylus salmonis (Platyhelminthes: Monogenea)

The wageneri species group of Gyrodactylus contains the following molecularly confirmed salmonid parasites in Asia: Gyrodactylus taimeni Ergens, 1971, Gyrodactylus magnus Konovalov, 1967, Gyrodactylus brachymystacis Ergens, 1978, and Gyrodactylus derjavini Mikhailov, 1975; in Europe it contains the following: Gyrodactylus derjavinoides Malmberg, Collins, Cunningham, and Jalali, 2007, Gyrodactylus truttae Gläser, 1974, Gyrodactylus teuchis Lautraite, Blanc, Thiery, Daniel, and Vigneulle, 1999, Gyrodactylus lavareti Malmberg, 1956, Gyrodactylus salvelini Kuusela, Ziętara, and Lumme, 2008 (presented herein as a junior synonym of Gyrodactylus salmonis Yin and Sproston, 1948), and Gyrodactylus salaris Malmberg, 1957, with the lone confirmed North American exception being G. salmonis. The mitochondrial DNA (cox1, 1545 bp) of this group shows a star-like phylogenetic expansion that began 2.05 ± 0.4 million years ago (mya), estimated from the mean distance of the cox1 gene (dMCL = 0.267) using a tentative, potentially high-end, divergence rate of 0.13/Myr. European G. salaris on Thymallus thymallus and Asian G. magnus on Thymallus arcticus have been separated for 1.95 Myr (dMCL = 0.253). The nuclear ITS rDNA region (1,245 bp) of G. salmonis was nearly uniform among North American populations of Oncorhynchus mykiss, Oncorhynchus clarkii, Oncorhynchus nerka, Salvelinus fontinalis, and Salmo salar (and non-native Salmo trutta) as well as on Salvelinus alpinus (under the synonym G. salvelini) from Lake Inari, Finland. Gyrodactylus salmonis is distal in a monophyletic subclade labeled by an apomorphic 56 bp insertion in the ITS1, shared by the European parasites G. lavareti (host: Coregonus lavaretus), Gyrodactylus pomeraniae Kuusela, Ziętara, and Lumme, 2008 (host: Rutilus rutilus), and Gyrodactylus bliccensis Gläser, 1974 (host: Alburnus alburnus). This subphylogeny suggests that a particular host switch from cyprinids to salmonids may have occurred less than 1.8 mya in the Old World [dMCL = 0.234 G. pomeraniae vs (G. salmonis, G. lavareti)] and possibly again among coregonine hosts and Salvelinus 1.2 mya (dMCL = 0.156). Although hypothetical, a transition from coregonines to charr (notably the widely distributed and adaptable Salvelinus alpinus) potentially could have occurred in a proglacial refugium leading to circumpolar distribution of G. salmonis and a secondary transition to other North American hosts. The maximum cox1 genetic distance within G. salmonis on all hosts was dMCL = 0.032, at the same level as in multihosted European G. salaris (dMCL = 0.032), suggesting circa 250,000 yr of population expansion with these parasites since a temporal, coinciding bottleneck.

A new species of Serpentirhabdias Tkach, Kuzmin et Snyder, 2014 (Nematoda: Rhabdiasidae) parasitic in the herald snake, Crotaphopeltis hotamboeia (Laurenti) (Reptilia: Serpentes: Colubridae) in South Africa.

Serpentirhabdias mamlambo n. sp. is described from the lung of the herald snake, Crotaphopeltis hotamboeia (Laurenti) in KwaZulu-Natal Province, South Africa. The new species is characterised by the small lips, the absence of the buccal capsule, the large excretory glands (1.5-2.3 times longer than the oesophagus), and the numerous eggs in uteri. Serpentirhabdias mamlambo n. sp. differs from other Serpentirhabdias spp. in the presence of M-shaped cuticular folds on dorsal and ventral sides of apical surface, the eye-shaped internal labial papillae, and the distinct dilatation of the oesophagus at its mid-length. Morphological differentiation of S. mamlambo n. sp. from its congeners is supported by molecular evidence based on cox1 mitochondrial gene, and ITS and partial 28S region of nuclear rDNA. Serpentirhabdias mamlambo n. sp. is the first species of the genus Serpentirhabdias described from the Afrotropical Realm.

First report of root rot and damping off disease in soybean (Glycine max) caused by Pythium deliense in India.

Seedling rot symptoms were observed at Research Farm of ICAR-Indian Institute of Soybean Research, Indore, India. The infected seedlings had water-soaked lesions on the cotyledons and hypocotyls that gradually developed into brown lesions and further progressed to soft rot. These seedlings could be easily pulled-off from the soil. The diseased seedling samples were rinsed thoroughly in flowing tap water and eventually in double-distilled water and were subjected to surface sterilization with NaOCl(1%). The samples were further washed thrice with sterilized double distilled water. The root fragments were properly sterilized and placed on V8 juice agar as well as potato dextrose agar (PDA) media plates. These plates were incubated at 27± 2°C for 48 hours. After incubation, white fluffy mycelial growth was observed on both the media. The fungus was observed to produce brown round vesicles with mycelial attachment when observed under a compound microscope magnification of 20X. Subcultures of these fungal isolates were placed on PDA media and incubated for 7 days at (27±2°C). The pure fungal culture along with PDA media was cut into small pieces and mixed with a sterilized soil mix (70% soil and 20% sand and 10 % vermicompost) at the rate of one petri dish per pot (plastic pots of 10 cm depth) and covered properly with tin foil. These pots were subjected to substrate colonization for 10 days at room temperature and the substrates were shaken occasionally to improve infection efficiency of pathogen by enhacing inocula production. Seeds of soybean variety, Gaurav were sown in three replicates, each with 10 seeds in the inoculated pots. The control was established by sowing seeds in the soil mix, amended previously with plain PDA. The pots were maintained at 25 to 30 ºC with 45 to 50 % of soil moisture content under glasshouse conditions. In the inoculated pots, the fungus killed soybean seeds before and after germination. Some of the plants that emerged developed lesions were initially yellow and gradually turned to necrotic later. These lesions were found on the roots of the plant and at the base of the hypocotyl region. The soybean seeds planted in un-inoculated soil emerged but did not develop any necrotic lesions. When the causal organism was re-isolated from the diseased plant part it was found to be morphologically and culturally similar to theoriginal culture. The isolated pathogen was thus classified as Pythium deliense based on morphological and cultural characters as well as the pathogenicity test. (Plaats-Niterink 1981). For further confirmation of pathogen's identity, complete genomic DNA of the fungus was extracted using the HiPurA Fungal DNA Purification Kit (HiMedia, India). The nuclear rDNA region of the internal transcribed spacer and 5.8S rDNA was amplified by universal primers ITS 1 (5' TCCGTAGGTGAACCTGCGG 3') and ITS 4 (5' TCCTCCGCTTATTGATATGC 3') as mentioned by White et al. (1990). Amplification was performed in a 12.5 μL reaction volume containing 1.5 μL of 10X PCR buffer, 3 μL of 25 mM MgCl2, 1.2 μL of 2.5 mM deoxyribonucleotide triphosphates (dNTPs), 0.7 μL of 10 pM each primer (ITS 1 and ITS 4), and 1 μL of DNA template, 0.3 μL of 1 units of Taq DNA polymerase. The thermal cycle consisted of 4-minute initial denaturation at 94°C, followed by 35 cycles of 1-minute denaturation at 95°C, 30-second primer annealing at 57 The PCR products were sequenced and submitted to NCBI (GenBank Acc. MT2665888). The BLAST study of the fungal isolate showed 100% similarity with reference sequences of Pythium deliense (MT126658.1) in the GenBank. The isolate was identified as Pythium deliense on the basis of molecular analysis, corroborating the above morphological identification. Further, the beta-tubulin gene (Bt) was amplified with primers BtF (5'GCTGGCCTTGATGTTGTTCG3') and BtR (5'CGTGA AGAGTACCCAGAC CG3'). Similarly, the cytochrome oxidase gene was amplified with primers COXF (5'GGTGCTTTTTCAGGTGTAGTTGG3') and COXR (5'GCTCCTGCTAATACTGGTAATG T3'). The PCR products were sequenced and submitted to GenBank with accession numbers MW196444 and MW196445 respectively. In BLAST analysis, the beta-tubulin gene exhibited 100 percent sequence homology with Pythium deliense (MK752986.1) and cytochrome oxidase gene also showed 100 % sequence homology with Pythium deliense (HQ708566.1). Pythium deliense has been recorded worldwide causing disease in many agricultural crops including soybean but to our knowledge, this is the first study in India of the genus Pythium and Pythium deliense causing root rot and damping off of soybean.

Molecular Detection for Two Abalone Shell-boring Species Polydora haswelli and P. hoplura (Polychaeta, Spionidae) from Korea using 18S rDNA and cox1 Markers

Polydora species (Polychaeta: Spionidae) are morphologically similar and have shell-boring abilities that are harmful to commercially important mollusks; genetic analysis is therefore important for their identification. Here, molecular evidence for Polydora species in Korean cultured abalone (Haliotis discus hannai) is first reported. DNA barcode markers (Nuclear 18S rDNA and mitochondrial cox1 regions) identified Polydora haswelli and P. hoplura in infested abalone shells. The cox1 marker was efficient in detecting Polydora species even in samples contaminated with shell debris. The findings provide useful information for the accurate identification of Polydora species and for monitoring harmful spionids in mollusk aquaculture farms.

Mystery unveiled: Diacanthodes Singer – a lineage within the core polyporoid clade

Diacanthodes (Polyporales, Basidiomycota) is a fungal genus with stipitate basidiomata and a combination of ornamented and dextrinoid basidiospores that is unique among the poroid fungi. Although some hypotheses based on morphological features speculated about the phylogenetic relationships of the taxon, they have never been tested based on molecular data. We performed molecular phylogenetic analyses including specimens of Diacanthodes from the Neotropics and Africa using the internal transcribed spacers (ITS1-5.8S-ITS2 = ITS) and the D1–D2 domains of the 28S gene of the nuclear rDNA regions, as well as the translation elongation factor 1-alpha (TEF-1α) protein-coding gene. Our study revealed Diacanthodes as a member of the ‘core polyporoid’ clade within the Polyporales. Two new species from South America: Diacanthodes cerebriporoides and D. neotropicalis, a new combination D. coffeae from Africa and notes on the other Diacanthodes species are presented. Basidiospore morphology in Diacanthodes and related genera is discussed in the phylogenetic context.

Interfamilial relationships in order Fabales: new insights from the nuclear regions sqd1 and 26S rDNA

Leguminosae, Polygalaceae, Quillajaceae and Surianaceae together comprise the order Fabales. Phylogenetic relationships within Fabales remain an unsolved problem even though interfamilial relationships have been examined in a number of studies using different sampling approaches and both molecular and morphological data. In this study, we gather information from the nuclear 26S rDNA region as well as previously published data from the sqd1, matK and rbcL regions. Phylogenetic analyses were performed by maximum parsimony, maximum likelihood and Bayesian inference. Overall, the best-supported topology for the relationships among families within the order places the pair of Leguminosae and Polygalaceae as sister to the pair of Quillajaceae and Surianaceae. However, our approximately unbiased (AU) test of the combined data results has shown that none of the seven different topologies rejected. Furthermore, three topologies were not significantly different from each other. Therefore, similar to the previous studies, this study did not find well-supported dichotomous relationships among the four Fabales families. The Fabales topology was very sensitive to both data choice and the phylogenetic methods used, which may indicate a rapid-near-simultaneous evolution of the four Fabales families. Our results also show that while nuclear sqd1 can be helpful as a complementary region, both the nuclear sqd1 and rDNA 26S regions could be problematic when analyzed individually.

First Report of Three Lasiodiplodia Species (L. theobromae, L. pseudotheobromae, and L. caatinguensis) Causing Cashew Gummosis in Guinea-Bissau (West Africa)

Since 2013, there have been reports of gummosis on cashew (Anacardium occidentale L.) in Guinea-Bissau; however, identification of the causal agent remains to be addressed (Monteiro et al. 2015, 2017). During harvest season in May 2018, cashew trunks with dark cankers, cracks, and resin-like gum were observed in orchards located in Bolama Island of Bijagos archipelago and in the continental Tombali region of Guinea-Bissau. Samples from healthy to diseased margins of trunk lesions were collected, surface disinfected with 7% sodium hypochlorite, washed twice with sterilized water, placed on potato dextrose agar (DIFCO, Sparks, MD) supplemented with potassium thiocyanate (50 µg/ml, Sigma, Alges, Portugal), and incubated at 24 ± 1°C. Fungi with mycelium immersed and superficial, first white and later dark greenish to grayish black, were consistently isolated after 7 days, developing pycnidia with conidia initially hyaline, later becoming one-septate, dark brown with longitudinal striations and thick-walled. These morphological characteristics fit the Lasiodiplodia species description (Phillips et al. 2013). Pure cultures from two isolates from Bolama (GB78 and GB134) and one from Tombali (GB32) were used for molecular identification. Genomic DNA was extracted from mycelia using a Qiagen Plant DNA Kit (Qiagen), and partial regions of nuclear ITS rDNA (ITS1F, Gardes and Bruns 1993; ITS4R, White et al. 1990), translation elongation factor 1-α (TEF1- α, Alves et al. 2008), and β-tubulin (β-tub, Glass and Donaldson 1995) genes were amplified following previously described conditions (Coutinho et al. 2017) modified with the addition of bovine serum albumin (BSA, 50 mg/ml). Sequences generated were deposited in GenBank under the accession numbers MN952990 to MN952992 for ITS, MN952201 to MN952203 for β-tub, and MN952205 to MN952207 for TEF1-α. Phylogenetic analyses from the combined dataset using maximum-likelihood and Bayesian inference methods placed each isolate in well-supported clades, namely GB78 as L. theobromae, GB32 as L. pseudotheobromae, and GB134 as L. caatinguensis. Pathogenicity tests were performed on 3-month-old cashew plants (eight plants per isolate). Inoculation followed the method of Lima et al. (2013), consisting of excising a 3-mm-diameter tissue bark out and replacing it with a 3-mm-diameter PDA plug removed from the colony margin. The inoculation wound was covered with sterilized wet cotton and sealed with parafilm. Plants inoculated only with PDA plugs with the wound covered and sealed as previously described were used as controls. After 15 days, all inoculated plants displayed similar symptoms to those observed in the field, whereas control plants remained symptomless. The pathogens were successfully reisolated from symptomatic stems, fulfilling Koch’s postulates. Lasiodiplodia spp. have been described as a causal agent of cashew gummosis, an important disease impacting cashew production in northeastern Brazil (Coutinho et al. 2017). Here we report for the first time three Lasiodiplodia species (L. theobromae, L. pseudotheobromae, and L. caatinguensis) as causal agents of cashew gummosis in Guinea-Bissau, where this crop is the most important agricultural commodity, and given its high economic value, a potential reduction in production would negatively impact smallholder livelihoods and annual revenues.

CARDUUS CINEREUS (ASTERACEAE) – NEW TO NORTH AMERICA

Carduus cinereus M.Bieb. populations have been discovered in the Hells Canyon Wilderness of northeastern Oregon and western Idaho. These plants were initially identified as C. pycnocephalus L. They are distinguished from that species by loosely clustered, usually pedunculate, heads and by scarious-margined phyllaries. These plants are genetically distant from other North American Carduus species (<94% similarity) based on DNA sequence comparisons of the internal transcribed spacers between the 18S and 26S nuclear rDNA regions. Carduus cinereus is new to North America. A revised key to the species of Carduus in North America is presented.

Diversity of a phosphate transporter gene among species and isolates of arbuscular mycorrhizal fungi.

Arbuscular mycorrhizal fungi (AMF) are a key group of beneficial obligate biotrophs, establishing a mutualistic symbiosis with the roots of most land plants. The molecular markers generally used for their characterization are mainly based on informative regions of nuclear rDNA (SSU-ITS-LSU), although protein-encoding genes have also been proposed. Within functional genes, those encoding for phosphate transporters (PT) are particularly important in AMF, given their primary ability to take up Pi from soil, and to differentially affect plant phosphate nutrition. In this work, we investigated the genetic diversity of PT1 gene sequences and sequences of the taxonomically relevant SSU-ITS-LSU region in two isolates of the species Funneliformis coronatus, three isolates of the species Funneliformis mosseae and two species of the genus Rhizoglomus, originated from geographically distant areas and cultured in vivo. Our results showed that partial PT1 sequences not only successfully differentiated AMF genera and species like ribosomal gene sequences but also highlighted intraspecific diversity among F. mosseae and F. coronatus isolates. The study of functional genes related to the uptake of key mineral nutrients for the assessment of AMF diversity represents a key step in the selection of efficient isolates to be used as inocula in sustainable agriculture.

&lt;p&gt;&lt;strong&gt;Two new species of &lt;em&gt;Calocybe&lt;/em&gt; (Lyophyllaceae) from northeast China&lt;/strong&gt;&lt;/p&gt;

Two new species of Calocybe (Calocybe erminea sp. nov. and C. badiofloccosa sp. nov.) are described from Liaoning province, China. Calocybe erminea is characterized mainly by its light khaki to dirty white pileus, slightly hygrophanous stipe, small basidiospores and cellular epicutis. The key characters of C. badiofloccosa are its light ocher yellow and rough pileus, villose stipe and large basidiospores. The results of phylogenetic analyses based on the internal transcribed spacer (ITS) and the nuclear large subunit rDNA (nrLSU) region indicated that they belong to Calocybe, but they are distinct from other species in the genus. They are compared morphologically with other species which are phenotypically similar and the phylogenetic relationships between them and allied taxa are discussed. These results confirm the species is new to science.