Neurofibromatosis 1 Gene Research Articles

Neurofibromatosis 2 leads to choroidal hyperfluorescence in fluorescein angiography

For the diagnosis of NF 2, ocular findings like juvenile cataract, retinal and combined hamartomas of the retinal pigment epithelium and the retina as well as tumours of the optic nerve play an important role. An early diagnosis is essential in order to inhibit deafness from bilateral vestibular schwannoma. But sometimes the Manchester diagnostic criteria for NF2 are not completely fulfilled. Frequently, suspicious macular anatomy is found in neurofibromatosis 2 (NF2) patients. We hypothesise that the underlying retinal pigment epithelium or the retina of the macular region alters in NF2 patients. Therefore, we have tested by fluorescence angiography whether NF2 is associated with chorioretinal changes. In a prospective study, 48 patients matching the criteria for NF2 with known genotype underwent a complete ophthalmic examination including funduscopy and fluorescence angiography. The influence of the genotype was statistically analysed by odds ratios and their 95% confidence intervals. Eleven eyes of nine patients showed choroidal hyperfluorescence in the macular region on fluorescence angiography. There was staining spreading from grainy hyperfluorescence to minor variants of a combined hamartoma of the retina and the retinal pigment epithelium. All of these manifestations presented without leakage in the late angiographic phases. These choroidal findings were present in one patient with frameshift mutation, in two patients with nonsense mutations and in six patients with splice site mutations of the NF2 gene. The statistical analysis showed a significant lower risk of choroidal alterations in patients with somatic mosaicism, deletions and unfound mutations. Using fluorescence angiography pathological changes of the macular region can be detected in NF2 patients. The ophthalmic examination, which often is limited to the anterior eye segment, may play a role in finding the diagnosis in incomplete NIH criteria. The presented study shows chorioretinal hyperfluorecences without leakage of the macular region, which might be considered as a forme fruste of a hamartoma. Choroidal hyperfluorescences add to the spectrum of genotype-phenotype correlations in NF2.

The heterogeneous nature of germline mutations in NF1 patients with malignant peripheral serve sheath tumours (MPNSTs)

Malignant peripheral nerve sheath tumours (MPNSTs) are a major cause of mortality in patients with neurofibromatosis 1 (NF1). We have analysed lymphocyte DNA samples from 30 NF1 patients with MPNSTs to determine their underlying constitutional NF1 gene mutations. Mutations were detected in 27/30 (90%) of these patients. NF1 mutations identified included nonsense, missense, frameshift, splice site mutation and single or multi-exonic deletions and with no obvious clustering of the mutations across the gene. Fourteen of the mutations represent novel gene changes. There did not appear to be any relationship between the mutation type and the level of clinical severity observed. Of the 20 patients with high grade MPNSTs, seven patients had small (<20 bp) and multi-exonic deletions and three had small insertions (<20 bp). Several studies have suggested that NF1 patients with a constitutional 1.5 Mb deletion of the NF1 gene have an increased risk of developing malignant peripheral nerve sheath tumours (MPNSTs). None of our patients had a 1.5 Mb deletion. Larger prospective studies are needed to ascertain whether there is a different spectrum of NF1 mutations in NF1 patients with high grade compared to low grade MPNSTs and of patients with the 1.5Mb deletion, in order to determine the true frequency of MPNST in this sub-group of NF1 patients.

Mitority Report: Life Extension by Neurofibromatosis‐1 Over‐expression in Drosophila

Neurofibromatosis-1 (NF1) is one of the most common neurogenetic diseases occurring at a frequency of 1 in 3000 worldwide and involving tumor growth and learning deficits. Neurofibromin, the product of the NF1 gene, is a tumor suppressor that regulates the adenylyl cyclase/cyclic-AMP/protein kinase A (AC/cAMP/PKA) and Ras pathways. Inactivation of the NF1 gene in both Drosophila and mice causes growth abnormalities, learning defects and early aging. Here we demonstrate that over-expression of NF1 in Drosophila significantly increases life span, improves reproductive fitness, and increases resistance to oxidative and heat stress, all mediated via AC/cAMP/PKA signaling. Over-expression of NF1 also increases electron flow through mitochondrial oxidative phosphorylation complex I, decreases mitochondrial reactive oxygen species (ROS) production, and protects mitochondrial aconitase activity. Thus, over-expression of NF1 results in increased longevity without loss of fecundity by up-regulation of cAMP production and reduced mitochondrial ROS production. The novel therapeutic strategy for NF1 disease implicated by this mechanism is currently being tested.

Schwannomin inhibits tumorigenesis through direct interaction with the eukaryotic initiation factor subunit c (eIF3c)

The neurofibromatosis 2 (NF2) tumor suppressor protein, schwannomin or merlin, is commonly lost upon NF2 gene mutation in benign human brain tumors. We identified the p110 subunit of the eukaryotic initiation factor 3 (eIF3c) as a schwannomin interacting protein. The eIF3 complex consists of approximately 10 subunits whose functions are only recently becoming known. Interaction between schwannomin and eIF3c suggests a role for schwannomin in eIF3c-mediated regulation of proliferation related to changes in protein translation. We found that schwannomin was most effective for inhibiting cellular proliferation when eIF3c was highly expressed. When we examined these proteins in 14 meningiomas, we observed high eIF3c abundance in those that had lost schwannomin expression but low eIF3c abundance in those retaining schwannomin. Consequently, eIF3c appears to be involved in NF2 pathogenesis and deserves to be investigated as a prognostic marker for NF2 and target for treatment of NF2 patient tumors.

Molecular, Genetic, and Cellular Pathogenesis of Neurofibromas and Surgical Implications

Neurofibromatosis 1 (NF1) is a common autosomal dominant disease characterized by complex and multicellular neurofibroma tumors. Significant advances have been made in the research of the cellular, genetic, and molecular biology of NF1. The NF1 gene was identified by positional cloning. The functions of its protein product, neurofibromin, in RAS signaling and in other signal transduction pathways are being elucidated, and the important roles of loss of heterozygosity and haploinsufficiency in tumorigenesis are better understood. The Schwann cell was discovered to be the cell of origin for neurofibromas, but understanding of a more complicated interplay of multiple cell types in tumorigenesis, specifically recruited heterogeneous cell types such as mast cells and fibroblasts, has important implications for surgical therapy of these tumors. This review summarizes the most recent NF1 and neurofibroma literature describing the pathogenesis and treatment of nerve sheath tumors. Understanding the biological underpinnings of tumorigenesis in NF1 has implications for future surgical and medical management of neurofibromas.

RAS pathway activation and an oncogenic RAS mutation in sporadic pilocytic astrocytoma

Pilocytic astrocytoma (PA) is the second most common brain tumor found in children, but compared to fibrillary astrocytoma, comparatively less is known about the molecular events associated with its formation and progression. Some insights have derived from the observation that one-third of these tumors arise in children with the neurofibromatosis 1 (NF1) inherited tumor predisposition syndrome, implicating the NF1 gene in the molecular pathogenesis of PA.1 The NF1 gene encodes a protein (neurofibromin) that functions as a RAS inhibitor, such that NF1 inactivation in tumors results in high levels of activated RAS and increased cell growth. However, sporadic PAs lack NF1 gene mutations and do not demonstrate loss of neurofibromin expression.2 In patients with myeloid leukemia,3,4 tumor cells exhibit NF1 inactivation, mutational RAS activation, or mutational activation of a positive RAS regulator ( PTPN11 ), all of which result in high levels of RAS activity (figure, A). In this report, we demonstrate RAS pathway hyperactivation in sporadic PA, and in a subsequent analysis for potential RAS and PTPN11 mutational activation in the absence of NF1 loss, we identify an oncogenic RAS mutation in one sporadic PA. ### Methods. Tissue samples were collected by the Siteman Cancer Center Tissue Procurement Facility, immediately frozen in liquid nitrogen, and processed into …

Analysis of NF1 transcriptional regulatory elements

Mutations of the NF1 locus cause neurofibromatosis 1 (NF1), a clinically variable autosomal dominant disease. Expression of neurofibromin, the protein product of the NF1 gene, is regulated in a tissue- and developmentally-specific fashion, but the basis for this regulation is not understood. We used phylogenetic footprinting and other bioinformatic methods to identify potential transcriptional regulatory regions in the 5' upstream region and intron 1 of the NF1 gene from human, mouse, rat, and pufferfish. Three genomic segments that have equal or higher homology than the coding region were found in the NF1 5' upstream region, and four more very highly homologous regions were found in intron 1. Five of these highly homologous regions are confidently predicted to contain transcription factor binding sites. One highly homologous segment in the 5' upstream region spans the transcription start site and contains several potential transcription factor binding sites. This segment includes a novel 24-bp sequence (acttccggtggggtgtcatggcgg) that lies 310-333 bp upstream of the translation initiation site. This sequence, which is identical in human, mouse, and rat and differs by only 1-bp in Fugu, may contain the core promoter element for NF1 transcription.

Proteomic Analysis Reveals Hyperactivation of the Mammalian Target of Rapamycin Pathway in Neurofibromatosis 1–Associated Human and Mouse Brain Tumors

Individuals with the tumor predisposition syndrome, neurofibromatosis 1 (NF1), are prone to development of nervous system tumors, including neurofibromas and pilocytic astrocytomas. Based on the ability of the NF1 gene product (neurofibromin) to function as a GTPase activating protein for RAS, initial biologically based therapies for NF1-associated tumors focused on the use of RAS inhibitors, but with limited clinical success. In an effort to identify additional targets for therapeutic drug design in NF1, we used an unbiased proteomic approach to uncover unanticipated intracellular signaling pathways dysregulated in Nf1-deficient astrocytes. We found that the expression of proteins involved in promoting ribosome biogenesis was increased in the absence of neurofibromin. In addition, Nf1-deficient astrocytes exhibit high levels of mammalian target of rapamycin (mTOR) pathway activation, which was inhibited by blocking K-RAS or phosphatidylinositol 3-kinase activation. This mTOR pathway hyperactivation was reflected by high levels of ribosomal S6 activation in both Nf1 mutant mouse optic nerve gliomas and in human NF1-associated pilocytic astrocytoma tumors. Moreover, inhibition of mTOR signaling in Nf1-/- astrocytes abrogated their growth advantage in culture, restoring normal proliferative rates. These results suggest that mTOR pathway inhibition may represent a logical and tractable biologically based therapy for brain tumors in NF1.

Erbin Regulates Mitogen-activated Protein (MAP) Kinase Activation and MAP Kinase-dependent Interactions between Merlin and Adherens Junction Protein Complexes in Schwann Cells

Biallelic mutations in the neurofibromatosis 2 (NF2) gene are linked to schwannoma and meningioma tumorigenesis. Cells with NF2 mutations exhibit elevated levels of phosphorylated extracellular signal-regulated kinase (ERK) and aberrant cell-cell and cell-matrix contacts. The NF2 gene product, merlin, associates with adherens junction protein complexes, suggesting that part of its function as a tumor suppressor involves regulating cell junctions. Here, we find that a novel PDZ protein, called erbin, binds directly to the merlin-binding partner, EBP0, and regulates adherens junction dissociation through a MAP kinase-dependent mechanism. Reducing erbin expression using a targeted siRNA in primary cultures of Schwann cells results in altered cell-cell interactions, disruption of E-cadherin adherens junctions, increased cell proliferation, and elevated levels of phosphorylated ERK, all phenotypes observed in cells that lack merlin. Reduction of erbin expression also results in the dissociation of merlin from adherens junction proteins and an increase in the levels of phosphorylated merlin. These phenotypes can be rescued if cells with reduced levels of erbin are treated with a pharmacological inhibitor of ERK kinase. Collectively, these data indicate that erbin regulates MAP kinase activation in Schwann cells and suggest that erbin links merlin to both adherens junction protein complexes and the MAP kinase signaling pathway.

Screening for large mutations of the NF2 gene

Neurofibromatosis 2 (NF2) is a genetic disorder caused by mutational inactivation of the NF2 gene and is characterized by bilateral vestibular schwannomas, spinal tumors, and other benign tumors of the nervous system. Previously, we found intragenic NF2 mutations in 99 of 188 unrelated NF2 patients by exon-scanning-based methods. Tumor analysis of 22 de novo NF2 patients led to the identification of 12 additional constitutive NF2 mutations. The remaining 77 patients were further examined for large alterations using the newly developed gene dosage assay multiplex ligation-dependent probe amplification (MLPA). One deletion of a single exon, seven deletions of multiple exons, seven deletions involving the 3' or 5' end of the NF2 gene, four deletions involving the whole NF2 gene, and one duplication of three exons were detected. For 47 of the 77 patients, mRNA of adequate quality could be obtained, enabling transcript analysis, which confirmed eight alterations detected by MLPA. In addition, in one family, the mRNA analysis detected an insertion of two exons of another gene. Thus, deletions, duplications, and insertions affecting the NF2 gene were found in 21 cases, which is 11% of the 188 unrelated NF2 patients studied, 16% of the 132 mutations identified, and 27% of the 77 cases in which no intragenic small mutations were detected by exon scanning. The combination of multiple screening techniques facilitated a mutation-detection rate of 100% for the 21 inherited cases in this study.

Multiple meningiomas: differential involvement of the NF2 gene in children and adults

Objective: To screen for NF2 mutations in people with meningiomas. Methods: Lymphocyte or tumour DNA was analysed from 46 individuals from 36 families who presented with a meningioma at age...

Glioma Formation in Neurofibromatosis 1 Reflects Preferential Activation of K-RAS in Astrocytes

Children with the tumor predisposition syndrome, neurofibromatosis 1 (NF1), develop optic pathway gliomas. The NF1 gene product, neurofibromin, functions as a negative regulator of RAS, such that NF1 inactivation results in RAS hyperactivation. Recent studies have highlighted the divergent biological and biochemical properties of the various RAS isoforms, which prompted us to examine the consequence of Nf1 inactivation in astrocytes on RAS isoform activation in vitro and in vivo. In this report, we show that only K-RAS is activated in Nf1-/- astrocytes and that activation of K-RAS, but not H-RAS, accounts for the proliferative advantage and abnormal actin cytoskeleton-mediated processes observed in Nf1-/- astrocytes in vitro. Moreover, dominant inhibitory K-RAS corrects these abnormalities in Nf1-/- astrocytes invitro. Lastly, we show that Nf1+/- mice with astrocyte-specific activated K-RAS expression in vivo develop optic pathway gliomas, similar to our previously reported Nf1+/- mice with astrocyte Nf1 inactivation. Collectively, our results show that K-RAS is the primary target for neurofibromin GTPase-activating protein activity in vitro and in vivo and that K-RAS activation in astrocytes recapitulates the biochemical, biological, and tumorigenic properties of neurofibromin loss.

Clinically aggressive central giant cell granulomas in two patients with neurofibromatosis 1

<h3>Background</h3> Neurofibromatosis 1 (NF1) is an autosomal-dominantly inherited genetic disorder caused by a spectrum of mutations affecting the NF1 gene, a gene located at 17q11.2 and spanning more than 350 kilobases. Affected patients develop a number of benign and malignant tumors at an increased frequency. Clinical findings include multiple café-au-lait spots, neurofibromas, axillary freckling, optic gliomas, benign iris hamartomas, scoliosis, and poorly defined hamartomatous lesions of the skeleton. Kerl (1971) first reported the association of NF1 with central giant cell granuloma (CGCG) of the jaws. There have since been 4 additional reports of NF1 patients with multiple CGCG of the jaws. (Molecular analysis of 1 of these cases uncovered a novel NF1 splice mutation in the proband.) An additional case involving the occipital bone and 1 of a patient with multiple peripheral giant cell granulomas have also been reported. <h3>Clinical cases</h3> We report on 2 patients who presented with NF1 and aggressive CGCG of the jaws. In both cases, the clinical course was characterized by numerous recurrences despite surgical treatment. <h3>Conclusion</h3> While the association between NF1 and CGCG could represent a genetic linkage, this association could also be coincidental since both NF1 and CGCG of the jaws are relatively common. For example, NF1 demonstrates phenotypic overlap with Noonan syndrome (short stature, ocular hypertelorism, pulmonic stenosis, webbed neck) in approximately 12% of patients. Watson syndrome, characterized by overlapping mild features of both NF1 and Noonan-like syndrome is linked to the NF1 gene. NF1-Noonan syndrome, an entity in its own right, is believed to be the result of the independent segregation of both a classical NF1 phenotype and a Noonan syndrome phenotype. Interestingly, multiple giant cell lesions have also been reported in a number of patients with Noonan syndrome.

La neurofibromatose 1 (NF1) ou maladie de Von Recklinghausen

Neurofibromatosis 1(NF1) is one of the most common genetic diseases. NF1 is an autosomal dominant genetic disorder and half of affected individuals have NF1 as the result of a new gene NF1 mutation. The offspring of an affected individual have a 50% risk of inheriting the altered NF1 gene. The disease manifestations are extremely variable, even within a family. NF1 is characterized by multiple cafe au lait spots, axillary and inguinal freckling, multiple discrete dermal neurofibromas, and iris Lisch nodules. Learning disabilities are frequent. Less common but potentially more serious manifestations include plexiform neurofibromas, optic and other central nervous system gliomas, malignant peripheral nerve sheath tumors, vasculopathy, and osseous lesions. Since the original National Institutes of Health consensus Development Conference in 1987, there have been significant progress toward a more complete understanding of the molecular-bases for neurofibromatosis 1 and the routine follow-up for the care of the NF1 patients. The authors review the present data on the clinical and molecular aspects of the neurofibromatosis 1. NF1 requires life-long management adapted to age and multidisciplinary structures are particularly well adapted to the diversity of the manifestations of this pathology. The French NF-France Network has been created in 2001 to federate the French multidisciplinary structures for neurofibromatosis and harmonize the follow-up of NF1 patients in France.

Association between the neurofibromatosis-1 (NF1) locus and autism in the Japanese population.

Autistic patients have a 100 to 190-fold increased risk of neurofibromatosis compared to the general population. This suggests that the two diseases may share a common etiological background. Recently, a new allele (or the six-repeat allele) of the (AAAT)(n) repeat polymorphism in an Alu sequence in the neurofibromatosis-1 (NF1) gene was observed exclusively in severe autistic patients, not in controls, in Caucasians of French ancestry. This suggests a role of the NF1 gene in the development of autism. We investigated three microsatellite polymorphisms within the intron-27b and intron-38 of the NF1 region, including the (AAAT)(n) and two (CA)n repeat polymorphisms, in Japanese subjects with autism (n = 74) and controls (n = 122). The six-repeat allele of the (AAAT)(n) polymorphism was not found either in patients or controls, possibly indicating an ethnic difference in the polymorphism. However, significant differences were observed in the allele distributions of the (AAAT)(n) and a (CA)(n), which were located at intron-27b, between patients and controls, although an association was not significant between autism and another polymorphism at intron-38. This may suggest an involvement of the NF1 locus in susceptibility to autism, although further investigations are recommended.

Cutaneous malignant melanoma and neurofibromatosis type 1.

Neurofibromatosis 1 (NF1) is a genetically transmitted disease occurring approximately once in 3000 live births and resulting from mutations of the NF1 gene that encodes a protein named neurofibromin, a negative regulator of the ras-dependent pathway. An excess of neoplasia especially tumours of neuroectodermal origin is classically observed. The occurrence of malignant melanoma in patients with NF1 has already been described in scattered clinical reports but little is known as to the characteristics of melanoma arising in NF1 patients. A multicentric retrospective study was conducted on a panel of French referring centres for a period of 13 years to identify patients with both melanoma and NF1. Patients with mucosal or ocular melanoma were excluded. The diagnosis of malignant melanoma was based on specific histology whereas NF1 was identified according to the criteria proposed by the NIH Consensus Conference. All patient fulfilling criteria for both melanoma and NF1 were investigated using a common procedure recording clinical and histological data along with prognostic factors for the two diseases. Eleven patients were identified with both diseases. The clinical pattern of NF1 was quite similar to the classical form of the disease, but some unusual features were present as regards to the melanoma: a sex-ratio of 10 women for one man and an average age lower than expected (median age=33 years) for melanoma occurrence. Among prognostic factors, median thickness was high compared to large series of melanoma in the literature (3.20 versus 1.5 mm). Another neoplasia occurred in three patients. An increase in melanoma incidence in patients with NF1 remains hypothetical but our small series of malignant melanoma arising in NF1 patients displays a large female preponderance, a higher thickness than expected and a frequent association with a second neoplasia. The peculiar female proneness for cancer whatever its localization and the risk of multiple neoplasias have already been reported in NF1 patients and could be true for malignant melanoma as well.

Screening 500 unselected neurofibromatosis 1 patients for deletions of the NF1 gene.

A total of 500 unselected unrelated neurofibromatosis 1 (NF1) patients were screened for deletions of the NF1 gene. After excluding 67 patients with known intragenic NF1 mutations, the remaining 433 were genotyped using six intragenic and one distal microsatellite marker for the NF1 gene. A total of 28 patients were hemi- or homozygous for all seven markers and were thus considered as candidates for NF1 deletion with a calculated probability of 99.99%. Metaphase or interphase cells were available from 23 of these 28 individuals for molecular cytogenetics. Fluorescence in situ hybridization (FISH) confirmed an NF1 deletion in 22 (96%) of the 23 patients. Thus, a constitutional deletion of the NF1 gene is responsible for the disease phenotype in at least 4.4% of the 500 unselected NF1 patients. Genotyping using multiple microsatellite markers may provide a simple, inexpensive, and efficient strategy for screening deletions of the NF1 gene, and can as well be applied for other large genes.

Chromosome 22q alterations and expression of the NF2 gene product, merlin, in gastrointestinal stromal tumors

Gastrointestinal stromal tumors (GISTs) are the most common mesenchymal tumors of the digestive tract. A characteristic genetic alteration in GISTs is constitutive activation of the c-kit proto-oncogene, but alterations in chromosomes 14 and 22 may also play a role in the molecular pathogenesis. In this study, 42 GISTs were analyzed for loss of heterozygosity (LOH) on the long arm of chromosome 22 (22q). Overall, 69% of the tumors studied showed LOH with at least 1 of the 22q markers. Allele losses were compared with tumor mitotic activity, the most commonly used prognostic marker for this tumor. Interestingly, allele deletion at 22q was significantly more frequent in tumors with high mitotic activity (≥l2 mitoses/10 high-power fields [HPF]) than in tumors with low mitotic activity (<2 mitoses/HPF)—88% versus 56% ( P < 0.01). A total of 26% (11 of 42) of all tumors demonstrated loss of all 22q sites analyzed, consistent with the loss of 1 copy of the entire long arm. Such tumors carried a 4.6-fold (95% confidence interval, 0.5 to 49.8) risk for recurrence compared with tumors with no LOH. LOH was frequently detected at the neurofibromatosis 2 (NF2) tumor-suppressor gene locus at 22q12. Sequencing of the NF2 gene from 5 GISTs did not reveal mutations, however. Furthermore, 16 of 19 tumors (84%) analyzed by immunohistochemistry were positive for the NF2 gene product, merlin. The findings suggest that allelic losses at 22q are associated with high mitotic activity and recurring disease, and that alterations in the NF2 gene are unlikely to participate in the pathogenesis of GIST.

Molecular study of frequency of mosaicism in neurofibromatosis 2 patients with bilateral vestibular schwannomas

Neurofibromatosis 2 (NF2) is a severe autosomal dominant disorder that predisposes to multiple tumours of the nervous system. About half of all patients are founders with clinically unaffected parents. The...

Increased noise as an effect of haploinsufficiency of the tumor-suppressor gene neurofibromatosis type 1 in vitro.

In human diseases related to tumor-suppressor genes, it is suggested that only the complete loss of the protein results in specific symptoms such as tumor formation, whereas simple reduction of protein quantity to 50%, called haploinsufficiency, essentially does not affect cellular behavior. Using a model of gene expression, it was presumed that haploinsufficiency is related to an increased noise in gene expression also in vivo [Cook, D. L., Gerber, A. N. & Tapscott, S. J. (1998) Proc. Natl. Acad. Sci. USA 95, 15641-15646]. Here, we demonstrate that haploinsufficiency of the tumor-suppressor gene neurofibromatosis type 1 (NF1) results in an increased variation of dendrite formation in cultured NF1 melanocytes. These morphological differences between NF1 and control melanocytes can be described by a mathematical model in which the cell is considered to be a self-organized automaton. The model describes the adjustment of the cells to a set point and includes a noise term that allows for stochastic processes. It describes the experimental data of control and NF1 melanocytes. In the cells haploinsufficient for NF1 we found an altered signal-to-noise ratio detectable as increased variation in dendrite formation in two of three investigated morphological parameters. We also suggest that in vivo NF1 haploinsufficiency results in an increased noise in cellular regulation and that this effect of haploinsufficiency may be found also in other tumor suppressors.