ND2 Gene Research Articles

Ancient reindeer mitogenomes reveal island-hopping colonisation of the Arctic archipelagos

Climate warming at the end of the last glacial period had profound effects on the distribution of cold-adapted species. As their range shifted towards northern latitudes, they were able to colonise previously glaciated areas, including remote Arctic islands. However, there is still uncertainty about the routes and timing of colonisation. At the end of the last ice age, reindeer/caribou (Rangifer tarandus) expanded to the Holarctic region and colonised the archipelagos of Svalbard and Franz Josef Land. Earlier studies have proposed two possible colonisation routes, either from the Eurasian mainland or from Canada via Greenland. Here, we used 174 ancient, historical and modern mitogenomes to reconstruct the phylogeny of reindeer across its whole range and to infer the colonisation route of the Arctic islands. Our data shows a close affinity among Svalbard, Franz Josef Land and Novaya Zemlya reindeer. We also found tentative evidence for positive selection in the mitochondrial gene ND4, which is possibly associated with increased heat production. Our results thus support a colonisation of the Eurasian Arctic archipelagos from the Eurasian mainland and provide some insights into the evolutionary history and adaptation of the species to its High Arctic habitat.

A new odorous frog species of Odorrana (Amphibia, Anura, Ranidae) from Guizhou Province, China.

The frog genus Odorrana is distributed across east and southeastern Asia. Based on morphological differences and molecular phylogenetics, a new species of the genus occurring from Leigong Mountain in Guizhou Province, China is described. Phylogenetic analyses based on DNA sequences of the mitochondrial 12S rRNA, 16S rRNA, and ND2 genes supported the new species as an independent lineage. The uncorrected genetic distances between the 12S rRNA, 16S rRNA, and ND2 genes between the new species and its closest congener were 5.0%, 4.9%, and 16.3%, respectively. The new species is distinguished from its congeners by a combination of the following characters: body size moderate (SVL 39.1-49.4 mm in males, 49.7 mm in female); head width larger than head length; tympanum distinctly visible; small rounded granules scattered all over dorsal body and limbs; dorsolateral folds absent; heels overlapping when thighs are positioned at right angles to the body; tibiotarsal articulation reaching the level between eye to nostril when leg stretched forward; vocal sacs absent in male and nuptial pads present on the base of finger I.

A new species of the Cyrtodactyluschauquangensis species group (Squamata, Gekkonidae) from Lao Cai Province, Vietnam.

We describe a new species of the genus Cyrtodactylus based on five adult specimens from Bac Ha District, Lao Cai Province, northern Vietnam. Cyrtodactyluslucisp. nov. is distinguished from the remaining Indochinese bent-toed geckos by a combination of the following morphological characteristics: medium size (SVL up to 89.5 mm); dorsal tubercles in 17-19 irregular transverse rows; ventral scales in 32-34 longitudinal rows at midbody; precloacal pores present in both sexes, 9 or 10 in males, 8 or 9 in females; 12-15 enlarged femoral scales on each thigh; femoral pores 9-12 in males, 5-10 in females; postcloacal tubercles 2-4; lamellae under toe IV 21-23; dorsal pattern consisting of 5 or 6 irregular dark bands, a thin neckband without V-shape or triangle shape in the middle, top of head with dark brown blotches; subcaudal scales transversely enlarged. Molecular phylogenetic analyses recovered the new species as the sister taxon to C.gulinqingensis from Yunnan Province, China, with strong support from all analyses and the two taxa are separated by approximately 8.87-9.22% genetic divergence based on a fragment of the mitochondrial ND2 gene. This is the first representative of Cyrtodactylus known from Lao Cai Province.

Comparative mitochondrial genome brings insights to slight variation in gene proportion and large intergenic spacer and phylogenetic relationship of mudskipper species

Fish mitochondrial genome have been largely studied worldwide for evolutionary and other genetic purposes and the structure and gene organization are commonly conservative. However, several studies have demonstrated that this scenario may present variations in some taxa, showing differentiation on the gene rearrangement. In this study, the complete mitogenome of terrestrial fish Boleophthalmus dussumieri was generated and compared with other species of the Exudercidae fishes. The newly complete mitogenome generated is circular and 16,685 bp of length, and it contained 13 protein-coding genes (PCGs), two ribosomal RNA (rRNAs), 22 transfer RNA genes (tRNAs), and one control region (CR), with high conservative structure, like other Mudskippers. Most of the PCG showed similar codon usage bias. The gene length was found to be different specially for the CR, 12S rRNA gene and ND5 gene in some taxon. All the Boleophthalmus species showed a gene duplication in the CR, except for B. dussumieri, and they presented a long intergenic spacer specially on the tRNA-Pro/ OH Tandem duplication/random loss (TDRL) and dimer-mitogenome and nonrandom loss (DMNL) are suitable to explain the mitogenome rearrangement observed in this study. The phylogenetic analysis well supported the monophyly of all mudskipper species and the analysis positioned the Periophthalmus clade as the most basal of the terrestrial fishes. This finding provides basis and brings insights for gene variation, gene rearrangements and replications showing evidence for variety of mitochondrial structure diversity within mudskippers.

Discovery of a new species of kangaroo lizard (Squamata: Agamidae: Agasthyagama) from the southern Western Ghats of India

Abstract We describe a new species of Agasthyagama from Idukki district, Kerala, India. The new species is distinguished from its sister species Agasthyagama beddomii by a combination of scale characters and are also genetically different from each other with 11% uncorrected pairwise difference in ND2 gene and 3% in 16S gene. The two species are also geographically separated, the closest distributional records are approximately 80 km apart.

Description of a new karst-adapted species of the subgenus Japonigekko (Squamata: Gekkonidae: Gekko) from Guangxi, southern China

Abstract A new species of the genus Gekko Laurenti, 1768, Gekko paucituberculatussp. nov., is described here, based on two specimens from Tianyang District, Baise City, Guangxi Zhuang Autonomous Region, China. It was placed in subgenus Japonigekko on the basis of morphological and molecular phylogenetic analysis and can be distinguished from all congeners in this subgenus by significant divergences in the mitochondrial 16S and ND2 genes and by a combination of the following morphological characters: Moderate body size, SVL 77.2 mm in the adult male and SVL 85.9 mm in the adult female; tubercles only present along dorsolateral trunk and absent on other regions; fingers and toes with weak webbing; continuous precloacal pores 12 in the male, absent in the female; a single postcloacal tubercle on each side; a light-coloured vertebral line from nape to tip of tail; dorsum greyish-brown, with 7–8 dirty-white bands between nape and sacrum. Meanwhile, the distribution of G. palmatus in China has been confirmed as occurring in Guangxi and Guangdong Provinces. This study brings the total species of the subgenus Japonigekko in China to 19.

Friend turned foe: selfish behavior of a spontaneously arising mitochondrial deletion in an experimentally evolved Caenorhabditis elegans population.

Selfish mitochondrial DNA (mtDNA) mutations are variants that can proliferate within cells and enjoy a replication or transmission bias without fitness benefits for the host. mtDNA deletions in Caenorhabditis elegans can reach high heteroplasmic frequencies despite significantly reducing fitness, illustrating how new mtDNA variants can give rise to genetic conflict between different levels of selection and between the nuclear and mitochondrial genomes. During a mutation accumulation experiment in C. elegans, a 1,034-bp deletion originated spontaneously and reached an 81.7% frequency within an experimental evolution line. This heteroplasmic mtDNA deletion, designated as meuDf1, eliminated portions of 2 protein-coding genes (coxIII and nd4) and tRNA-thr in entirety. mtDNA copy number in meuDf1 heteroplasmic individuals was 35% higher than in individuals with wild-type mitochondria. After backcrossing into a common genetic background, the meuDf1 mitotype was associated with reduction in several fitness traits and independent competition experiments found a 40% reduction in composite fitness. Experiments that relaxed individual selection by single individual bottlenecks demonstrated that the deletion-bearing mtDNA possessed a strong transmission bias, thereby qualifying it as a novel selfish mitotype.

Characterization of Four Complete Mitogenomes of Monolepta Species and Their Related Phylogenetic Implications.

Monolepta is one of the diverse genera in the subfamily Galerucinae, including 708 species and 6 sub-species worldwide. To explore the information on the mitogenome characteristics and phylogeny of the section "Monoleptites", especially the genus Monolepta, we obtained the newly completed mitochondrial genomes (mitogenomes) of four Monolepta species using high-throughput sequencing technology. The lengths of these four new mitochondrial genomes are 16,672 bp, 16,965 bp, 16,012 bp, and 15,866 bp in size, respectively. All four mitochondrial genomes include 22 transfer RNA genes (tRNAs), 13 protein-coding genes (PCGs), 2 ribosomal RNA genes (rRNAs), and one control region, which is consistent with other Coleoptera. The results of the nonsynonymous with synonymous substitution rates showed that ND6 had the highest evolution rate, while COI displayed the lowest evolution rate. The substitution saturation of three datasets (13 PCGs_codon1, 13 PCGs_codon2, 13 PCGs_codon3) showed that there was no saturation across all datasets. Phylogenetic analyses based on three datasets (ND1, 15 genes of mitogenomes, and 13 PCGs_AA) were carried out using maximum likelihood (ML) and Bayesian inference (BI) methods. The results showed that mitogenomes had a greater capacity to resolve the main clades than the ND1 gene at the suprageneric and species levels. The section "Monoleptites" was proven to be a monophyletic group, while Monolepta was a non-monophyletic group. Based on ND1 data, the newly sequenced species whose antennal segment 2 was shorter than 3 were split into several clades, while, based on the mitogenomic dataset, the four newly sequenced species had close relationships with Paleosepharia. The species whose antennal segment 2 was as long as 3 were split into two clades, which indicated that the characteristic of "antennal segment 2 as long as 3" of the true "Monolepta" evolved multiple times in several subgroups. Therefore, to explore the relationships among the true Monolepta, the most important thing is to perform a thorough revision of Monolepta and related genera in the future.

Discovery of a new species of the subgenus Japonigekko (Squamata, Gekkonidae, Gekko) from the Hengduan Mountains, southwestern China: the best Japonigekko mountaineer.

A new Gekko (subgenus Japonigekko) species, Gekkoalpinus sp. nov., is described from the Jinsha River Basin in southwestern China, between the border of Mangkang County, Xizang Autonomous Region and Batang County, Sichuan Province, according to the integrative taxonomic results combining molecular data and morphological characters obtained from the type series comprising 11 specimens. Our molecular phylogeny inferred from the mitochondrial 16S and ND2 gene fragments indicated that this new species is most closely related to Gekkojinjiangensis, but a considerable amount of genetic divergence exists between them (p-distance: 3.6%-4.1% (16S) and 7.1%-9.1% (ND2)). The new species can be distinguished from its congeners via a combination of series morphological characters. The discovery of this new species marks the highest altitudinal range (2400 to 2542 m a.s.l.) recorded for the subgenus Japonigekko and also represents a new provincial record for the genus in Xizang Autonomous Region.

Development of real-time polymerase chain reaction for analysis of rat meat (Bandicota bengalensis) in beef meatballs for halal authentication.

Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like rat meat (RM). This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs. This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples. The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R 2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples. The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.

A new species of Hemiphyllodactylus (Squamata, Gekkonidae) from southwest Yunnan, China.

A new species of gekkonid, Hemiphyllodactylusgengmaensissp. nov., is described based on six specimens from Gengma Dai and Wa Autonomous County, Yunnan, China. The new species can be distinguished from its congeners by a significant genetic divergence of greater than 9.7% in the mitochondrial ND2 gene and a combination of the following characters: a maximum SVL of 43.24mm; 8 or 9 chin scales; six circumnasal scales; 2 or 3 internasal scales; 9-11 supralabial scales; 8 or 9 infralabial scales; 11-18 dorsal scales; 8-10 ventral scales; a manual lamellar formula of 5-5-5-4 or 5-6-5-4 and a pedal lamellar formula of 5-5-6-5; 20-25 precloacal and femoral pore-bearing scales contiguous in males; dark postorbital stripes or striping on body; dark dorsal transverse blotches present; and a brown postsacral mark bearing anteriorly projecting arms. The discovery of this new species brings the number of Hemiphyllodactylus species in China to 15.

Molecular and morphometric data provide evidence of intraspecific variation in shape and pigmentation pattern in Otocinclus cocama (Siluriformes: Loricariidae) across major river drainages.

Otocinclus cocama, a uniquely colored species of the loricariid catfish genus Otocinclus described solely from the type locality in the lower Ucayali River in northern Peru, is reported occurring in the Tigre River, a tributary to the Marañón River that drains a different section of the Andean Mountain range in the western Amazon. Both populations differ in the number of dark bars spanning the flanks of the body, and we investigated whether these morphotypes constitute distinct species. The body shapes of populations from the Tigre and Ucayali rivers were compared using geometric morphometrics. Although principal component analysis detected a broad overlap between populations, multivariate analysis of variance and linear driscriminat analysis revealed a subtle differentiation between the populations of the two hydrographic basins. Average body shape of the Ucayali River population tend to be slightly higher than that of the Tigre River, with the caudal peduncle stretched vertically in the Ucayali population. Multivariate regression of shape and centroid size revealed an allometric effect of 10.7% (p < 0.001), suggesting that the variation between Tigre and Ucayali populations was purely shape variation. Molecular data of coI, cytb, nd2, and 16S mitochondrial genes indicated a nucleotide diversity range from 0.001 to 0.003, and haplotypic diversity range from 0.600 ± 0.11 to 0.79 ± 0.07. The median-joining haplotype network for the concatenated matrix exhibited two divergent haplogroups related to the geographic area and separated by <10 mutational steps. The molecular species delimitation methods based on distance (automatic barcode gap discovery and assemble species by automatic partitioning) recovered two molecular lineages evolving independently, being one of the lineages formed by individuals from both populations. Tree-based methods (generalized mixed Yule coalescent and Bayesian implementation of the Poisson tree process) recovered similar topologies and supported single lineage recognition. Methods of molecular delimitation of species disclosed the high similarity between the two populations of Otocinclus cocama, further supported by the presence of old haplotypes common to both groups which could indicate that the populations still maintain gene flow. Although the morphological data reveal a subtle variation between both river basins, the molecular data suggest a weak population structuration based on hydrographic areas, but not different species lineages, therefore Otocinclus cocama is composed of a single lineage with two distinct morphotypes.

Genetic Diversity of Kırklareli Honey Bee (Apis mellifera L.) Populations in Thrace Region of Turkey: Identification of Mitochondrial COI and ND5 Gene Regions

The main goal of genetic resource conservation is to keep as much genetic diversity as possible within each species. In this respect, some difficulties in the protection of honey bee gene resources make it necessary to reveal the genetic structures of the subspecies and the genetic relationships between the subspecies. In this study, Kırklareli honey bee populations which were officially registered as an ecotype of Turkey’s honey bee (Apis mellifera L.) gene resources by the Republic of Turkey, Ministry of Agriculture and Forestry, were examined in the COI and ND5 genes of mitochondrial DNA. The restriction fragment length polymorphism (RFLP) together with the polymerase chain reaction (PCR) was used to define Apis mellifera populations. A total of 117 worker bee samples were used which were collected from mostly the Kırklareli province. A newly found single nucleotide polymorphism (SNP), G→A transition in the COI gene region formed a novel NcoI restriction site resulting in a new haplotype. This new haplotype has been abbreviated as haplotype C. As a result of the COI/SspI digestion, the previously reported C haplotype was determined. No restriction was found with the treatment of COI/StyI enzyme. On the other hand, as a result of ND5/AluI restriction, 2 restriction site and previously reported haplotype C was obtained in all of the studied samples. No restriction was screened with ND5/FokI and ND5/HincII enzymes in the whole samples, only a reported uncut B haplotype was observed. Within this study, novel genetic information has been revealed for the Kırklareli honey bee ecotype registered as the Thrace honey bee of Turkey’s honey bee gene resources. Moreover, detailed studies with larger sample sizes should be conducted to characterize the origin and the subspecies of Kırklareli honey bees in detail. It is thought that this study will be useful in the identification and registration of the Kırklareli honey bees to be carried out in the future, and also in the creation of a database.

Taxonomic review of the Calotesversicolor complex (Agamidae, Sauria, Squamata) in China, with description of a new species and subspecies.

Caloteswangisp. nov., a new species of the agamid genus Calotes Cuvier, 1817, from southern China and northern Vietnam, is described. This species can be distinguished from all known congeners by a combination of morphological characteristics and genetic divergence in the mitochondrial tRNA, ND2, and CO1 genes. Molecular phylogenetic analysis revealed that the new species was formed as a monophyletic group and that considerable genetic divergence existed between its congeners (minimum p-distance, 4.6%). Caloteswangisp. nov. is distinguished by a combination of the following characteristics: average SVL < 90 mm for adult males; 10-14 dorsal eyelid scales; scales on side of neck and adjacent shoulder area pointing obliquely upward; keels on neck scales weakly to strongly developed; fold in front of the shoulder absent; pair of dark triangular patches extending from the front of the shoulder to the jaw angles; and orange coloration of the tongue. Caloteswangisp. nov. is similar to C.irawadi but differs in having scales between the nasal shield and the orbit and a fourth toe with a claw that can reach between the eyes and tympanum (even to the snout when hind the limbs are adpressed forward). Phylogenetic analyses revealed two well-supported subspecies, Lineages A and B in C.wangisp. nov., with mean uncorrected p-distances between them of 2%. We propose that Lineage A, which is mainly from the central and southern Wuzhi Mountains on Hainan Island, is a subspecies, C.w.hainanensisssp. nov. Lineage B mainly comprises individuals from other sites on the island plus the adjacent mainland, and is described as subspecies, C.w.wangissp. nov. A diagnostic key to all Calotes species of China is also provided.

On the specific status of Scelimena spicupennis and a new record of S. discalis from China with mitochondrial genome characterization (Orthoptera, Tetrigidae)

The genus Scelimena Serville (Orthoptera: Tetrigidae) from China is reviewed. One species, Scelimena spicupennis Zheng &amp; Ou, 2003 (China: Yunnan) is redescribed, and a new record of Scelimena discalis (Hancock, 1915) from China is given. An annotated identification key for Chinese species of the genus Scelimena is provided. Mitochondrial genes of S. spicupennis and S. discalis were sequenced and annotated. The sizes of the two sequenced mitogenomes are 17,552 bp (S. discalis), and 16,069 bp (S. spicupennis), respectively. All of the PCGs started with the typical ATN (ATT, ATC or ATG) or TTG codon and most ended with complete TAA or TAG codon, with the exception of the ND5 gene, which terminated with an incomplete T. The mitochondrial genomes for these two recorded species are provided, and the constructed phylogenetic tree supports their morphological taxonomic classification. The topology of the phylogenetic tree showed that three species of Scelimena were clustered into one branch and formed a monophyletic and a holophyletic group.

Leber's hereditary optic neuropathy: Update on the novel genes and therapeutic options.

A maternal inheritance disorder called Leber's hereditary optic neuropathy (LHON) is the most common primary mitochondrial deoxyribonucleic acid (DNA) disorder. In most studies, there are more male patients than female patients, which contradicts the usual pattern in mitochondrial hereditary diseases. This suggests that nuclear DNA (nDNA) may influence the degeneration of retinal ganglion cells (RGCs) in LHON. The primary cause of this is dysfunction in complex I of the electron transport chain, leading to ineffective adenosine triphosphate (ATP) production. In addition to MT-ND4 or MT-ND1 mutations, genes such as PRICKLE3 , YARS2 , and DNAJC30 , which come from nDNA, also play a role in LHON. These three genes affect the electron chain transport differently. PRICKLE3 interacts with ATP synthase (complex V) at Xp11.23, while YARS2 is a tyrosyl-tRNA synthetase 2 involved in mitochondria . DNAJC30 mutations result in autosomal recessive LHON (arLHON). Understanding how genes impact the disease is crucial for developing new treatments. Idebenone has been approved for treating LHON and has shown safety and efficacy in clinical trials. Mesenchymal stem cell-based therapy has also emerged as a potential treatment for LHON by transferring mitochondria into target cells. Gene therapy research focuses on specific gene mutations, and the wild-type ND4 gene target in the adeno-associated viruses (AAV) vector has shown promise in clinical trials as a potential treatment for LHON.

Saint Patrick, what about legless lizards? Tracing the mitochondrial affiliation and possible origin of Anguis (Squamata: Anguidae) population in Ireland

Abstract Ireland is home to only one native lizards’ species, the viviparous lizard and one of the few areas of the world where there are no native snakes. However, since the end of the 19th century, there have been reports indicating the presence of legless lizards, Anguis fragilis Linnaeus, 1758 population whose origin is unknown. As this genus has been intensively studied genetically and taxonomically in the past decade, we have decided to investigate newly obtained mtDNA sequences (ND2 gene) to trace affiliation of the Anguis population in Ireland. We genetically examined 12 individuals from the Burren area (western Ireland) and compared them to available data. The Irish population was identified as belonging to A. fragilis, specifically to the most common haplotype of the Illyrian-Central European haplogroup. This genetic affiliation is shared by populations across a wide European region, including the western Balkans, Spain, France, western Hungary, Austria, Germany, Latvia, Poland, the Czech Republic, Russia, Sweden, Norway, and Great Britain. Our findings showed that the Irish population does not exhibit unique mitochondrial variability. This haplotype is present across the range of the species, including Great Britain, which is not in contrast with the earlier hypothesis that nearby populations from this area, along with human-mediated introductions, could be the source of Anguis populations in Ireland. This is thus potentially the first documented case of Anguis introduction out of the native range. However, further research, including broader sampling in Great Britain and genomics, is required to determine and trace its exact origin.

Its all in the name: Another new Cyrtodactylus Gray (Squamata: Gekkonidae) from northern Mizoram, North-east India.

A new species of Cyrtodactylus is described from Vairengte town, situated in the Kolasib District of Mizoram State, north-eastern India. The new species is found to be a member of Indo-Burman Cyrtodactylus khasiensis clade based on ND2 gene sequences and morphological parameters, such as number of precloacal pores, mid-ventral scale rows, paravertebral tubercles on the trunk, dorsal tubercle rows, subdigital lamellae on pes and subcaudal scalation, making it the sixth endemic Cyrtodactylus from Mizoram and twenty second from north-east India. Moreover, phylogenetic evidence suggests the new species to be sister to the recently described C. aaronbaueri, and morphological analyses also reveal marginal separation between the two species based on the PCA of infralabials, lamellae on fingers and toes, paravertebral tubercles on the trunk, and dorsal tubercle rows.

A new species of the genus Cnemaspis Strauch, 1887 (Squamata: Gekkonidae) from the higher elevations of Tamil Nadu, India

In this study, we present the description of a previously undocumented species of Cnemaspis found in the region of Tamil Nadu, India. Molecular analysis of the species reveals its placement within the Cnemaspis beddomei Theobald, 1876 clade, with a range of genetic divergence on the ND2 gene, spanning from 9.5% to 30.2% in comparison to its congeners. Although bearing a resemblance to the well-known Cnemaspis ornata Beddome, 1870, the new species exhibits a distinct set of non-overlapping morphological characteristics that set it apart. These findings are supported by molecular data, solidifying the distinction between the newly described species and its close relatives.

Adaptive evolution of mitochondrial genomes in Triplophysa cavefishes

Extreme conditions in caves pose survival challenges for cave dwellers, who gradually develop adaptive survival features. Cavefishes are one of the most successful animals among cave dwellers. Triplophysa cavefishes are an important group of cavefishes, and they show remarkable adaptability to the extreme environments of caves. However, there is a limited understanding of their adaptation mechanisms. In this study, eight complete mitochondrial genomes of Triplophysa cavefishes were newly obtained, and their genomic characteristics, including the base composition, base bias, and codon usage, were analyzed. Phylogenetic analysis was carried out based on 13 mitochondrial protein-coding genes from 44 Nemacheilidae species. This showed that Triplophysa cavefishes and non-cavefishes separate into two reciprocally monophyletic clades, suggesting a single origin of the cave phenotype. Positive selection analysis strongly suggested that the selection pressure in cavefishes is higher than that in non-cavefishes. Furthermore, the ND5 gene in cavefishes showed evidence of positive selection, which suggests that the gene may play an important role in the adaptation of cavefishes to the cave environment. Protein structure analysis of the ND5 subunit implied that the sites of positive selection in cavefishes might allow them to acquire lower ND5 protein stability, compared to that in non-cavefishes, which might help the accumulation of nonsynonymous (mildly deleterious) mutations. Together, our study revealed the genetic signatures of cave adaptation in Triplophysa cavefishes from the perspective of energy metabolism.