RUNX1 Mutations Research Articles

Acute Leukemias of Ambiguous Lineage Have Durable Response to Hypomethylating Agents Plus Venetoclax in Older Patients

Background: The standard of care for frontline therapy of acute leukemias of ambiguous lineage (ALAL) remains controversial due to their rarity; however, outcomes are generally poor. Intensive chemotherapy (IC) regimens are standard, with evidence suggesting that acute lymphoblastic leukemia regimens are more effective than those used for acute myeloid leukemia (AML). Strategies for treating older or frail patients are limited. Although treatment with a hypomethylating agent plus venetoclax (HMA/Ven) is standard therapy for IC-ineligible AML patients, the role of HMA/Ven in ALAL remains poorly characterized. We performed a retrospective chart review of patients at our institution with Philadelphia-negative ALAL, comparing the outcomes of those treated with HMA/Ven and those who received IC. Method: Patients ≥ 18 years treated at Weill Cornell Medical Center with newly diagnosed, pathologically confirmed acute undifferentiated leukemia (AUL), T/myeloid, or Philadelphia chromosome-negative B- and B/T-myeloid leukemia were included. Frontline HMA/Ven was defined as Ven plus azacytydine, decitabine, or oral decitabine/cedazuridine (one patient had initial HMA monotherapy followed by HMA/Ven). Intensive chemotherapy included patients who received variations of standard ALL or AML IC regimens (hyper- or mini-hyper-CV[A]D, cytarabine plus daunorubicin or idarubicin, or cladribine plus idarubicin and cytarabine) with or without Ven. Tyrosine kinase inhibitors including midostaurin or gilteritinib were added for patients with fms-like tyrosine kinase 3 ( FLT3) mutations. Baseline and disease characteristics were collected as well as disease response, subsequent lines of therapy, whether the patient proceeded to allogeneic hematopoietic cell transplantation (HCT), rate of morphologic complete remission (CR), and overall survival (OS). Results: Of 16 patients, 7 received frontline HMA/Ven. B/myeloid was the most common disease type (n=8), followed by T/myeloid (n=4), AUL (n=3), and 1 patient with B/T/myeloid disease. The median age was 74 years (interquartile range [IQR] 62-80). Patients who received HMA/Ven were older than those who received IC, with median ages of 79 (IQR: 77-82) and 62 (IQR: 56-70; p = 0.01), respectively. Baseline white blood cell, hemoglobin, platelet counts, and lactate dehydrogenase, as well as blast percentages in both peripheral blood and bone marrow were similar between the groups. Although not validated in ALAL, markers of adverse myeloid disease as per the ELN 2022 schema were prevalent in both groups, including mutations in RUNX1, ASXL1, SRSF2, and TP53 (Figure A). One HMA/Ven patient and 3 IC patients underwent HCT. Of evaluable patients, 83% and 88% of HMA/Ven and IC patients achieved CRs, respectively. At 2 years, both groups had 50% overall survival (95% CI 22.5-100 in both). Among HMA/Ven recipients, overall survival ranged from 10-56 months, not including two patients with ongoing follow-up at 3 and 46 months (Figure B). Discussion: The treatment of ALAL remains a challenge, particularly in older patients who may be unfit for intensive treatment strategies. In our study, patients who received HMA/Ven had similarly durable disease control to younger patients who received IC in the frontline setting. Prolonged responses were seen in both AUL and MPAL. Multicenter registry and prospective analyses are needed; however, given the rarity of these diagnoses, our findings suggest that HMA/Ven should be considered as a frontline therapy for unfit patients with ALAL.

Impact of Mutations in Blood Cancer-Related Genes on Clinical Outcomes in Chronic Myeloid Leukemia in Chronic Phase (CML-CP) after ≥2 Tyrosine Kinase Inhibitors (TKIs) in the Ascembl Trial

CONCLUSIONS Somatic mutations in blood cancer-related genes are commonly detected in CML-AP. The most frequently mutated genes are RUNX1, ASXL1IKZF1 (submicroscopic deletions), and BCR:: ABL1 (kinase domain mutations). ASXL1 is the most frequently detected mutation at CML diagnosis (≈9%). However, the incidence and impact of mutations in blood cancer-related genes in patients (pts) with CML-CP previously treated with ≥2 TKIs have not been described since genomic studies have focused on pts at diagnosis or at progression. With >2 years of follow-up in the phase 3 ASCEMBL study, asciminib (ASC) has continued to demonstrate superior efficacy vs bosutinib (BOS) in pts with CML-CP after ≥2 prior TKIs, and analysis of cancer gene somatic mutations in this population has the potential to reveal additional insights into pts' response to study treatments or characteristics of the disease in later lines of therapy. Here we present a descriptive analysis of variants in the ASCEMBL pt population, including frequencies, co-occurrences, and association of mutations with clinical outcomes, specifically major molecular response (MMR) and treatment failure (TF; defined as discontinuation due to lack of efficacy or intolerance). Adults with CML-CP previously treated with ≥2 TKIs with intolerance of their last TKI or lack of efficacy per 2013 European LeukemiaNet recommendations and without BCR:: ABL1 T315I or V299L mutations were randomized 2:1 to ASC 40 mg twice daily or BOS 500 mg once daily. DNA was isolated from blood collected at baseline (BL) and end of treatment (EOT; defined as treatment discontinuation for any reason or completion of the study). A next-generation sequencing panel of 89 commonly mutated genes in blood cancers, including ABL1 and IKZF1 deletion, was used to detect somatic mutations that met criteria for pathogenicity. Only samples with BCR::ABL1IS ≥2%, which was the level demonstrated to detect mutations in leukemic cells, were tested. A multivariable Cox proportional hazards regression model adjusted for age, sex, treatment, and reason for prior TKI discontinuation (intolerance vs lack of efficacy) was used to determine the prognostic value of BL mutations. A total of 233 pts were randomized to ASC (n=157) or BOS (n=76). Of 162 pts (ASC, n=110; BOS, n=52) with available sequencing data at BL, 102 had ≥1 mutation: 69 (63%) on ASC and 33 (63%) on BOS. Overall, 159 mutations were detected in 23 genes at BL, ranging from 0 to 5 per pt. The median variant allele frequency (VAF) was 19.6% (range, 0.9%-58%). ASXL1 (in 31% of pts) and ABL1 kinase domain (in 17% of pts) mutations were the most frequently detected. Of 27 pts with ≥1 ABL1 mutation at BL, 85% had ≥1 other mutated cancer gene. Co-occurrence of ASXL1 and ABL1 mutations at BL was reported in 12 of 162 pts (7.4%), which was higher than the expected 2.9% based on these genes' individual frequencies in this data set. RUNX1 and IKZF1 mutations were rare in CML-CP at BL. Of 162 pts tested at BL, 73 had TF and available samples for analysis at EOT with only 3 pts discontinuing due to disease progression. The presence of any mutation at BL was significantly prognostic of TF in the total cohort of 162 pts (Figure 1). In an unadjusted analysis, the presence of an ASXL1 mutation with VAF >5% at BL was a prognostic factor of TF. In 73 pts with TF, most BL mutations were also detected at EOT (110/116 mutations in 48/54 carriers) (Figure 2). Of 15 pts who acquired ≥1 mutation at EOT, 9 acquired ABL1 mutations. No single mutations at an individual or gene level were prognostic of MMR. Mutations were not predictive of MMR or TF when pts were examined by their assigned treatment of ASC or BOS. ASXL1 mutations are most frequently detected at CML diagnosis and were enriched at BL in this study of pts with CML-CP previously treated with ≥2 TKIs, which is consistent with a role in TKI resistance. RUNX1 and IKZF1 mutations, which are associated with progression to accelerated or blast phase in CML, were very rare in this pt population, supporting their role in CML disease progression. The high frequency of co-occurrence of BCR:: ABL1 mutations and blood cancer gene mutations in CML-CP is an important finding since cancer gene mutations could modify response to TKIs in individual pts. The presence of any somatic blood cancer mutation at BL was prognostic of TF. These mutations may serve as potential biomarkers that can identify pts who may be at higher risk of TF in later lines of therapy.

RTK-RAS Signaling Pathway Was Enriched in Rare Acute Myeloid Leukemia Patients with t(16;21)(p11;q22)/ FUS::ERG

Introduction: t(16;21)(p11;q22)/ FUS::ERG is a rare recurrent abnormality in acute myeloid leukemia (AML) and confers a poor prognosis in AML patients. Previous studies analyzed the role of allogeneic hematopoietic stem cell transplantation (HSCT) in these patients but the results were discordant. AML is characterized by concurrent mutations, which cooperated in the leukemogenesis and refractory/relapse mechanism. However, few studies described the mutational landscape of FUS::ERG AML. Olshanskaya et al. discovered concomitant DNMT3A, ASXL1, RUNX1 and BCOR mutations in the FUS::ERG AML patients but the study was limited to the small case number. Therefore, we aim to assess genomic alterations and clinical outcome of FUS::ERG AML patients with a larger cohort. Methods: We reviewed medical records of 12328 AML patients diagnosed between December, 2011 and February, 2022 in our hospital. A total of 39 consecutive AML patients with karyotype or reverse transcription-polymerase chain reaction analysis proven t(16;21)(p11;q22)/ FUS::ERG were identified. Whole exome sequencing was performed in 4 patients and targeted sequencing was performed in 20 patients. Patients with follow-up time longer than 30 days were included in the survival analysis. Overall survival (OS) was calculated from the date of diagnosis to the date of death or censoring. Event free survival (EFS) was calculated from the date of diagnosis to the date of refractory, relapse, death or censoring, whichever came first. Results: M5 was the predominant subtype according to French-American-British classification systems. CD56 (91.9%) and CD123 (81.1%) were found to be expressed in most FUS::ERG AML patients. Six patients had central nervous system involvement diagnosed by flowcytometry (FCM) analysis of cerebrospinal fluid at the time of first lumbar puncture. One patient was diagnosed central nervous system involvement at relapse (Table 1). The most prevalent somatic variants of our FUS::ERG AML patients were PTPN11 (25%), NRAS (20%), RELN (15%), CENPB (10%), RUNX1 (10%) and SH2B3 (10%) mutations (Figure 1). Five patients had no somatic mutation detected by targeted sequencing. Notably, RTK-RAS signaling pathway was the most involved pathway after clustering the aberrated genes according to the Gene Ontology terms, which included PTPN11, NRAS, ABL1 and JAK2 aberrations. All but one PTPN11 mutations affected the amino terminal (N)-SH2 domain. NRAS mutation were found mutated at amino acid G12 and Q61. The median EFS of the patients was 9.3 months (95% CI: 9.2-NA) and OS was 18.2 months (95%CI: 13.1-NA). Due to the poor outcome of this subtype of AML, allogeneic HSCT was highly recommended. A total of 14 patients underwent allogeneic HSCT. Notably, seven of ten patients were positive for minimal residual disease assessed by FCM at the time of transplantation. We did not observe the statistically significant effect of HSCT on improving the EFS (p = 0.24) or OS (p=0.26) of our patients. Conclusions: PTPN11 and NRAS were the most frequent mutations and RTK-RAS signaling pathway was the most involved pathway in rare AML patients with t(16;21)(p11;q22)/ FUS::ERG. The addition of signaling pathway inhibitors followed by HSCT might be an effective strategy to overcome the dismal outcome of this subtype. Larger cohort studies are warranted to investigate the molecular characteristics further as well as evaluate the clinical activity of the SHP2 (PTPN11) inhibitors in FUS::ERG AML patients.

Impact of Typical and Atypical Complex Karyotype Subgroups on Outcome of AML Patients Undergoing Allogeneic Stem Cell Transplantation

Introduction Acute myeloid leukemia (AML) with a complex karyotype (CKT) confers an adverse prognosis, even within the subgroup of patients (pts) with adverse risk according to European LeukemiaNet 2022 (ELN22) risk stratification. Mrózek et al. further characterized CKT pts according to distinct mechanisms of leukemogenesis into balanced (presence of ≥1 balanced rearrangement), and unbalanced CKT (CKT ub, exclusively unbalanced cytogenetic abnormalities). Considering the high incidence of deletions (del) of 5q, 7q, and 17p in CKT, CKT ub were further divided in typical CKT ub (with latter abnormalities present), and atypical CKT ub (with exclusively other abnormalities). In the context of consolidating chemotherapy, typical CKT ub was associated with shorter event-free survival (EFS) and overall survival (OS) compared to atypical CKT ub. However, we lack data in the context of allogeneic hematopoietic stem cell transplantation (HSCT) which remains the preferred treatment in eligible pts. Here we aimed to investigate this classification in CKT AML pts consolidated by HSCT. Methods We analyzed 263 pts with AML who were classified as ELN22 adverse risk and underwent an allogeneic HSCT. 105 had a CKT, while 158 fulfilled other ELN22 adverse risk criteria. Of the pts harboring a CKT, median age at HSCT was 61 (range 20 - 76) years. Remission status at HSCT was first complete remission with or without count recovery (CR/CRi, 62%) or refractory AML (38%). Conditioning intensity according to EBMT criteria were myeloablative (19%), reduced intensity (31%) or non-myeloablative (50%). Donors were matched related (16%), haploidentical (2%) or matched (65%) or mismatch unrelated (17%).Cytogenetic analyses at diagnosis were performed using standard techniques of banding and in situ hybridization. Pretreatment genomic DNA was screened for genes recurrently mutated in myeloid malignancies using next generation sequencing. Median follow-up alive was 1.3 years. Results Pts with a CKT had a significantly shorter EFS ( P<.01) and OS ( P<.01) than other ELN22 adverse risk pts. Of all pts harboring a CKT, 17% had a balanced CKT, and 83% a CKT ub. Among CKT ub, 85% were classified as typical (67% with del(5q), 49% with del(7q), 26% with del(17p), Figure 1). Comparing typical and atypical CKT ub, pts with typical CKT ub more often had a monosomal karyotype ( P<.01), had more cytogenetic abnormalities (in typical CKT ub median 8 [range 3-39] vs atypical CKT ub median 6 [range 3-9], P=.04), more often TP53 mutations ( P=.02), less often RUNX1 mutations ( P=.03) and a lower LDH at diagnosis ( P=.03). They also had a higher expression of the leukemic stem cell markers CD34+/CD38- ( P=.01) and GPR56 ( P<.01). However, after allogeneic HSCT, EFS ( P=.50) and OS ( P=.50) did not differ between pts with typical and atypical CKT ub (Figure 2). Next, we looked for other adverse prognostic factors within CKT pts receiving HSCT, which in univariate analyses were the presence of a del(5q) (EFS P<.01 and OS P=.03), a del(17p) (EFS P=.10 and OS P=.02), the presence of ≥5 vs <5 cytogenetic aberrations (EFS P=.03 and OS P=.06), a concomitant TP53 mutation (EFS P=.01 and OS P=.01), and a higher age at HSCT (≥60 years, EFS P=.04 and OS P=.08). In contrast, neither the presence of a del(7q) nor a monosomal karyotype impacted EFS or OS within pts with a CKT. In multivariate analyses for CKT pts, the presence of ≥ 5 cytogenetic aberrations (Hazard Ratio. [HR] 1.7, 95% Confidence Interval [CI] 1.0-3.0, P=.05), higher age at HSCT (HR 1.6, 95% Ci 1.1-2.5, P=.02), and no CR/CRi at HSCT (HR 1.7, 95% CI 1.1-2.7, P=.01) were adverse factors for EFS, while the presence of a del(17p) (HR 2.0, 95% CI 1.2-3.4, P=.01), higher age at HSCT (HR 1.8, 95% CI 1.1-3.0, P=.02), and no CR/CRi at HSCT (HR 1.8, 95% CI 1.1-2.9, P=.02) were adverse factors for OS. Conclusion The presence of a CKT retains its negative prognostic impact after HSCT and differentiates within the ELN22 adverse risk group. However, in contrast to chemotherapy consolidation alone, the subgroup of pts harboring a typical CKT ub did not perform worse than pts with an atypical CKT ub, indicating a potential immune-mediated beneficial effect of HSCT. Within pts with a CKT receiving HSCT, we identified additional prognostic factors including the presence of ≥5 cytogenetic aberrations. These pts are in urgent need for novel post HSCT approaches.

Impact of Mutational Status on Clinical Response to Imetelstat in Patients with Lower-Risk Myelodysplastic Syndromes in the IMerge Phase 3 Study

CONCLUSIONS Imetelstat, a first-in-class telomerase inhibitor, showed higher rates of red blood cell (RBC) transfusion independence (TI) for ≥8 weeks, ≥24 weeks, and ≥1 year (39.8%, 28.0%, and 17.8%) than placebo (15.0%, 3.3%, and 1.7%) in the IMerge (NCT02598661) phase 3 study of patients with RBC transfusion-dependent non-del(5q) lower-risk myelodysplastic syndromes (LR-MDS) relapsed/refractory to erythropoiesis-stimulating agents (Platzbecker et al. EHA 2023. Abstr S165). To evaluate the impact of MDS-associated mutations on clinical efficacy of imetelstat, we performed next-generation sequencing of a panel of 36 genes, recurrently mutated in MDS, using DNA samples from peripheral blood collected at study entry. Further analysis of TI responses to imetelstat was performed across different mutation subgroups, defined based on genes involved in different biological functions, including the splicing process, epigenetic modifiers, transcription regulation, and receptors/kinases. Baseline mutation data were available in 165 of 178 patients (imetelstat, n = 110; placebo, n = 55; 93.2% and 91.7% of total in each group, respectively). Of patients with mutation data, 161 (97.6%) had ≥1 mutation detected, among whom, 75 (70.1%), 33 (30.8%), and 9 (8.4%) patients in the imetelstat group and 38 (70.4%), 15 (27.8%), and 7 (13%) patients in the placebo group had >1, >2, and >3 mutations, respectively. The ≥8-week TI rates in the imetelstat vs placebo groups were 42.7% vs 15.8% ( P = .006) for patients with >1 mutation, 45.5% vs 6.7% ( P = .012) for patients with >2 mutations, and 55.6% vs 14.3% ( P = .089) for patients with >3 mutations, respectively. The ≥24-week TI rates were 26.7% vs 2.6% ( P = .003), 33.3% vs 0% ( P = .014), and 33.3% vs 0% ( P = .117), respectively. In patients with mutations associated with poor prognosis ( TP53, ETV6, RUNX1, ASXL1 or EZH2), 31.8% and 9.1% of patients in the imetelstat group achieved ≥8-week and ≥24-week TI vs 0 of those in the placebo group. TP53 mutations were detected in 2 patients in each group; both patients in the imetelstat group and none in the placebo group had ≥8-week TI. Among patients with ASXL1 mutations, 5 of 18 patients (27.8%) in the imetelstat and 0 of 6 (0) in placebo group had ≥8-week TI. Among patients with ETV6 mutations, 1 of 2 (50%) in the imetelstat group and 0 of 1 patients in the placebo group had ≥8-week TI. Two patients in each group had RUNX1 mutations; none achieved TI. Imetelstat ≥8-week TI rates were 43.8%, 37.7%, 40.0%, and 80.0% for patients harboring mutated genes in the RNA spliceosome, epigenetic modifiers, transcription regulation, and receptors/kinases, respectively; ≥24-week TI was 30.2%, 27.5%, 20.0%, and 80.0%, respectively. The most frequently mutated gene was SF3B1 (125 of 165; 75.8%), the ≥8-week and ≥24-week TI rates were 48.8% vs 16.3% ( P = .001) and 35.4% vs 2.3% ( P < .001) with imetelstat vs placebo. In the imetelstat group, ≥8-week TI was achieved in patients with different spectrum of SF3B1 hot-spot mutations: 2 of 8 patients (25.0%) with E622D, 4 of 7 (57.1%) with R625C/L/G, 7 of 12 (58.3%) with H662Q/N/D/Y, 2 of 2 (100%) with T663P, 2 of 6 (33.3%) with K666R/T/Q/N, 18 of 41 (43.9%) with K700E, 2 of 2 (100%) with A744P, and 1 of 2 patients (50.0%) with E783K. Durable ≥24-week TI was also observed in patients with these hot-spot mutations. Other genes with mutation frequency >10% were TET2 (32.7%), DNMT3A (17.0%), ASXL1 (14.5%), and CUX1 (12.7%). The ≥8-week TI rates in the imetelstat group vs placebo group were 50% vs 21.4% for TET2 mutations; 31.6% vs 22.2% for DNMT3A mutations; 27.8% vs 0 for ASXL1 mutations; 35.7% vs 14.3% for CUX1 mutations (Figure). The ≥24-week TI rates were 40% vs 0, 26.3% vs 11.1%, 11.1% vs 0, and 14.3% vs 0, respectively, for those mutations (Figure). Higher RBC-TI rates were observed in patients with various baseline mutational profiles treated with imetelstat compared with placebo in IMerge. While the sample size for specific mutations was small, consistent with the observation that patients with LR-MDS have a low number of specific mutations, TI responses in patients receiving imetelstat occurred regardless of the presence of mutations associated with poor prognosis or the number of mutations. Imetelstat showed comparable TI rates across different molecularly defined subgroups, suggesting that clinical benefit of imetelstat in patients with LR-MDS is independent of the underlying molecular pattern.

Comparison of the 2022 ICC and Who Classification Systems of Myelodysplastic Neoplasms

Introduction: Recently, the World Health Organization (WHO) updated the 5th edition classification of myelodysplastic neoplasms (MDS) and the International Consensus Classification (ICC) of myeloid neoplasms and acute leukemia was published. In this study, we aimed to compare several differences between WHO 2022 and ICC classifications. Methods: Our study consisted of 989 newly-diagnosed primary MDS subjects classified using the WHO 2016 criteria from 08/2016 to 07/2022. CD34 and CD117 immunostaining were used in 30 of 38 subjects with low blasts and BM fibrosis to evaluate a proportion of immature myeloid precursors. All subjects were negative for CD117+ cells. CD34+ BM cells ranged from 0% to 5%. Results: According to WHO 2022 classification, 36 MDS subjects with NPM1 mutation were reclassified as AML and 10 MDS-U subjects were reclassified as clonal cytopenia of undetermined significance (CCUS). Applying to the ICC criteria, 20 MDS subjects with NPM1 mutation were reclassified as AML and 8 MDS-U subjects were reclassified as CCUS. We analyzed the remaining patients. Among the 81 subjects classified as MDS-biTP53 according to WHO 2022, 10 subjects did not meet ICC criteria for MDS or MDS/AML with mutated TP53 because the VAF of TP53 mutation(s) was less than 10%. Subjects not qualifying for MDS or MDS/AML with mutated TP53 had lower Revised International Prognostic Scoring System (IPSS-R) scores, better IPSS-R-defined cytogenetics, a higher frequency of SF3B1 mutations and longer survival compared with subjects with MDS or MDS/AML with mutated TP53 according to ICC (All P-values＜ 0.005, Figure 1 Left). Our data suggested that TP53 mutational burden should also be considered in the diagnostic classification and the cut-off value of 10% seems reasonable. An additional difference between these two classifications is that ≥15% ring sideroblasts may be a surrogate for SF3B1 mutation in WHO 2022. But only those with SF3B1 mutation (VAF≥10%), without 5q-, -7 or complex karyotype and RUNX1 mutation can be diagnosed as MDS with mutated SF3B1(MDS- SF3B1) according to ICC. 23 of 76 subjects (30.3%) with MDS- SF3B1 according to the WHO 2022 classification did not meet the ICC criteria for MDS- SF3B1. Subjects not meeting the ICC for MDS- SF3B1 had lower WBCs ( P = 0.003) ,platelet concentrations ( P = 0.001), higher IPSS-M categories ( P = 0.024) and shorter survival compared with those with MDS- SF3B1 according to ICC( P = 0.003, Figure 1 middle). Therefore, our study shown that SF3B1-unmutated MDS-RS cases have different clinical features and outcome in comparison with SF3B1-mutated subjects and ICC criteria defined a more homogeneous disease entity of MDS- SF3B1. Apart from MDS with defining genetic abnormalities, substantial differences in morphologically defined MDS subtypes between WHO 2022 and ICC also need to be addressed. According to the WHO 2022 classification, only MDS-EB patients were furtherly categorized into MDS-EB with or without BM fibrosis. Here, we explore the impact of BM fibrosis in patients with MDS-LB. Among MDS patients without excess blasts and specific genetic abnormalities, 38 patients had fibrosis. Subjects with low blasts and fibrosis (MDS-LBf) had lower platelet concentrations ( P = 0.002), worse IPSS-R-defined cytogenetics and IPSS-R categories ( P ＜0.05) compared with those without excess blasts and myelofibrosis. MDS-LBf had worse survival compared with those with low blasts and without fibrosis (Figure 1 right, P = 0.007). Conclusion: Both the WHO 2022 and ICC criteria allow more accurate diagnoses and risk stratification. However, the presence of two separate classifications leads to the dilemma in clinical application. When it comes to MDS with defining genetic abnormalities, our analyses suggest ICC defines more homogeneous disease entities of MDS-SF3B1, MDS or MDS/AML with mutated TP53 subjects compared with WHO 2022. Although WHO 2022 places an emphasis on morphologically defined MDS and listed hypoplastic MDS (MDS-h) and MDS with fibrosis (MDS-f) as new entities. Our data shown that fibrosis is a poor prognostic factor in MDS subjects without excess blasts. These subjects tend to have more aggressive clinical manifestations than other MDS subjects with low blasts. Collectively, we propose to integrate these two classifications into one pipeline for diagnosis of MDS (Figure 2), avoiding disadvantages for each one. Bing Liand Zhijian Xiao were co-corresponding authors

Leukemic Driver Clones Can Arise Independently and Outcompete MPN Cells in Post-MPN Secondary AML

The JAK2V617F variant is an acquired somatic mutation recurrently found in myeloproliferative neoplasm (MPN) patients and is used as a diagnostic marker. While considered a strong MPN driver mutation, this variant is sometimes absent in secondary acute myeloid leukemia (sAML) samples which transform from antecedent JAK2-mutant MPNs. The transformative evolution of MPN to sAML is thought to be driven by acquisition of additional genetic mutations affecting epigenetic modifiers (e.g. TET2), tumor suppressor genes (e.g. TP53), and splicing regulation, but the contribution and sequence of onset for these specific genetic events is not well understood. It is currently unknown why or how patients with a JAK2-mutant MPN may develop a JAK2 wild-type sAML. This transformation sequence is coupled with very limited treatment options and a survival of less than 6-months. Elucidating the evolutionary trajectory of secondary leukemic mutation occurrence is paramount for disease monitoring and early detection. To understand this evolutionary trajectory, we employed single cell proteogenomic analysis for three separate paired MPN patient samples (2 MF; 1 PV) who progressed to sAML stage. Clinical sequencing data indicated presence of the JAK2 V617F mutation in all three samples at the MPN stage whereas this mutation was not detected at the sAML stage. We employed the MissionBio Tapestri platform to delineate the clonal trajectory of transformation to determine if sAML and MPN driver clones share a common founder clone or if they arise through independent, non-clonally related founders. Utilization of this single-cell platform enabled us to investigate two potential models of transformation. First, two distinct mutation phases of MPN to sAML occur wherein the JAK2 -mutant clone and sAML driver mutations originate form a shared founder clone. In this model, an MPN phenotype driven by JAK2-mutant clones arises in patients first, followed by the sAML disease stage driven by leukemic mutations. An alternative tested model is that MPN and sAML originate as separate clones wherein the JAK2 mutant hematopoietic stem cells (HSCs) give rise to an MPN phenotype first, while the independent sAML clone(s) grow slowly yet separately in the background of the existing MPN. Both models provide a plausible explanation which results in leukemic blast stage clones harboring leukemic mutations but lacking the MPN driving mutation JAK2V617F. Single-cell analysis detected the JAK2V617F mutation in both the MPN (MF) as well as the sAML stage in one of the paired patient samples in which JAK2 was previously reported as wild-type at the sAML stage. This sample also contained a RUNX1 mutation at the sAML stage as well as a clonally unrelated ATM mutation (Figure 1A). The single-cell data for the remaining two paired patient samples (1MF; 1PV) demonstrated that pre-leukemic driver mutations were not detected within the JAK2-mutant clones at the MPN stage or during a middle time-point stage before AML diagnosis. Single-cell sequencing from the sAML time point for both samples demonstrated loss of the JAK2-mutant clone (verified by ddPCR analysis), amidst presence of leukemic driver mutant clones (Figure 1B). This clonal hierarchy suggests that the leukemic mutations were not present within the JAK2-mutant clones during the MPN stage and arose in the background of the MPN where they outcompeted the MPN driver clone during sAML transformation. Further, this hierarchy suggests that the AML driver mutations do not share a clonal intermediate ancestor with the JAK2 mutant cells which drove the MPN. These data demonstrate that one clonal trajectory of JAK2-mutant MPN to JAK2 wild-type sAML is through independent leukemic clones arising in the background of MPN and outcompeting the JAK2-mutant clones. In these instances, it is more appropriate to view these patients as de novo AML cases arising in a background of pre-existing MPN, which could influence treatment decisions and disease surveillance.

Maintenance Therapy with Chidamide Decreases the Relapse in Fusion Gene-Positive AML Patients with MRD-Positive or ELN-High Risk

Purpose: Acute myeloid leukemia (AML) patients with fusion gene-positive including core binding factor (CBF), mixed-lineage leukemia (MLL) gene rearrangement have a high incidence of relapse if they are continious measurable residual disease (MRD)-positive or in ELN-high risk and could not be bridged to allogenetic heamatopoitic stem cell transplantation (allo-HSCT). As known histone deacetylase (HDAC) is abnormally recruited in these fusion gene-positive AML, also RUNX1 mutated AML, and could be a therapy target. Aim of this study is to assess the effect and safety of HDAC inhibitor chidamide as maintemance therapy in these AML patients. Methods: A multi-center retrospective study was performed. Patients with MRD-positive CBF-AML, MLL rearrangement or RUNX1 mutation AML, without being bridged to allo-HSCT were included. Maintemance with chidamide was started one to three months after consolidation for at least six months, at a dose of 10mg/day or 30mg twice a week. Results: Twelve patients were enrolled, included 8 with AML1-ETO-positive, 3 with RUNX1 mutation, 1 with MLL rearrangement. The median age was 33(16-62) years old. The ratio of male to female was 6 to 5. They previously experienced median 6(4-8) cycles of chemotherapy, included one with allo-HSCT, one with autologous-HSCT. They were all maintemanced with chidamide, except one with chidamide plus sorafenib. Eleven patients were available for outcome assessment. With a median follow-up of 14(2-67) months, among the 9 patients with MRD-positive, 6(66.7%) achieved MRD-negative, 1 stable disease, 2 relapsed and died. The median time to achieved MRD-negative was 2.5(1-12) months. The other 2 patients was contenious MRD-negative. The cumulative incidence of relapse was 2/11(18.2%). The rate of MRD-nagetive was 8/11(72.7%). The mortality rate was 2/11(18.2%). During the maintemance, 4 patients underwent bone marrow suppression, including 2 with grade 3, 2 with grade 1/2. One patients had an anorexia of grade 2. Conclusion: Maintenance therapy with chidamide might decrease the relapse in fusion gene-positive AML patients with MRD-positive or ELN-high risk, who could not take allo-HSCT, and prolong their survival, with a well toleration. Key words: chidamide, maintenance, fusion gene, acute myeloid leukemia

Frameshift Mutations in Leukemia Associated Genes Correlate with Superior Outcomes in Patients Undergoing Allogeneic Stem Cell Transplant for De Novo Acute Myeloid Leukemia Compared to Other Types of Mutations

Background Allogeneic stem cell transplant (allo-SCT) is a mainstay of treatment for acute myeloid leukemia (AML) and offers the only chance of cure. The success of allo-SCT hinges greatly on the immune response of donor T lymphocytes against leukemia cells, known as graft versus leukemia effect (GvL). One of the key potential drivers of GvL is immune response to mutation derived neoantigens. Previous studies in solid tumors have demonstrated enhanced immunogenicity of frameshift derived peptides vs those from other mutation types (e.g. substitutions) due to the propensity of frameshifts to precipitate long novel amino acid strings distal to the site of mutation. We therefore hypothesized that AML cases bearing somatic frameshift mutations (FS) in leukemia associated genes would be more immunogenic than those with only other types of mutations (non-FS), and thus benefit more from allo-SCT via more robust GvL. Methods We retrospectively searched our institutional electronic medical records for de Novo AML patients who had undergone allo-SCT between 2009 and 2022 and had next generation sequencing data available on diagnostic specimens using a 42 gene hot spot panel. Via the Kaplan-meier method, we analyzed and compared the impact of tumor mutations present at diagnosis on overall survival and relapse free survival based on frameshift versus no frameshift status. Frameshift mutations only in DNMT3A, TET2 or ASXL1 (DTA) were not included in the frameshift group as previous studies have demonstrated DTA mutations to reflect mere clonal hematopoiesis and not to be strongly blast associated. Results 89 de Novo AML patients were identified who had at least one mutation detected by NGS or PCR fragment analysis. Frameshifted genes identified included RUNX1, WT1, TP53, BCOR, CEBPA, STAG2, PHF6, ZRSR2, TET2, ASXL1 and NPM1. Our data shows superior overall survival (p=0.038; HR 2.1) post-transplant in patients who have at least one gene with frameshift mutations (n=22) other than DTA or NPM1versus those with only other types of mutations [FIGURE 1]. Relapse free survival was also significantly better (HR 3.8) in the frameshift group by Gehan-Breslow-Wilcox analysis (p=0.038) but not by the log rank test (p=0.058). Patients with non DTA frameshifts other than NPM1 further showed superior overall survival to patients whose only frameshift was NPM1 (HR 2.3, p=0.045). Three patients showed both non-frameshift and frameshift mutations in the same gene and showed significantly poorer overall survival than those with at least one exclusively frameshifted gene (HR=4.3, p=0.013). Additionally, among patients with RUNX1 mutations (n=15) specifically, those with exclusively frameshifted RUNX1 (n=9) demonstrated superior overall survival (HR 4.8, p=0.042) to those who harbored non-frameshifted RUNX1 (n=6) [Figure 2]. Other mutations occurred with insufficient frequency to individually compare FS vs non-FS survival effects at the level of single genes. Conclusion Though limited by small sample size, our data suggest that frameshift mutated AML cases may benefit more from allo-SCT than those with only non-FS mutations, possibly due to increased generation of immunogenic neoepitopes. If validated in larger studies, incorporation of somatic frameshift mutation status in AML risk stratification models could improve existing patient selection algorithms for bone marrow transplant and thereby lead to superior outcomes.

Data-Driven Harmonization of 2022 Who and ICC Classifications of Myelodysplastic Syndromes/Neoplasms (MDS): A Study By the International Consortium for MDS (icMDS)

Background. The inclusion of gene mutations and chromosomal abnormalities in the 2022 WHO and ICC Classifications of MDS has enhanced diagnostic precision and is expected to improve clinical decision-making process. Although these two systems share similarities, clinically relevant discrepancies still exist and potentially cause inconsistency in their adoption in a clinical setting. In this study on behalf of the International Consortium for MDS (icMDS), we adopted a data-driven approach to provide a harmonization roadmap between the 2022 WHO and ICC classification for MDS. A modified Delphi Process consensus approach is currently ongoing among icMDS experts to finalize a harmonized MDS classification scheme. Methods. We analyzed retrospective international cohorts of patients with a diagnosis of MDS (n=7017) and AML (n=1002) according to WHO 2016 criteria. Hierarchical Dirichlet Processes were applied to define clusters capturing broad dependencies among all gene mutations and cytogenetic abnormalities. To investigate the features of importance and their impact on the clustering process, we employed the SHapley Additive exPlanations approach (SHAP). This allowed to define harmonized labels for each clinical entity. The clinical relevance of the unsupervised clustering was assessed through the analysis of phenotypic features and outcomes among each group. ( Blood 2022;140: 9828-9830) Results. Patients' characteristics are summarized in Table 1. We identified 9 clusters, defined by specific genomic features. The cluster of highest hierarchical importance was characterized by biallelic inactivation of TP53 (biTP53). According to SHAP analysis, bi TP53 was defined as 2 or more TP53 mutations, or 1 mutation with copy number loss or cnLOH. Most patients assigned to bi TP53 cluster had TP53 VAF>10% (77.9%) and complex karyotype (70.1%). Assignment to bi TP53 cluster was irrespective of blast count. Patients with monoallelic TP53 mutation segregated into other clusters. Hierarchically, the second cluster included patients with del(5q). SHAP analysis highlighted 5q deletion alone, or with one other chromosomal abnormality other than -7, and absence of bi TP53, as the most relevant features. Most of these patients had blast counts <5% (88.1%). The third distinct cluster included patients with SF3B1 mutations (in the absence of concurrent del(7q), abn3q26.2, complex karyotype or RUNX1 mutation). Most patients with MDS and SF3B1 mutation had <5% blasts (94.2%). Common co-mutated variants in the SF3B1 cluster included mutant DNMT3A (25.2%) and TET2 (38.3%). Morphologically defined MDS cases (i.e., not meeting criteria for bi TP53, del(5q) or SF3B1) were preferentially assigned to the following additional clusters: SF3B1 and concurrent higher-risk mutations (e.g., RUNX1 and ASXL1); SRSF2 and concomitant TET2 mutations; U2AF1 mutations with del(20q), del(7q) or -7; SRSF2 with TET2 mutations and co-mutational patterns including RUNX1 and ASXL1; and AML-like genomic signatures. Our analyses suggest that morphologically defined MDS is characterized by a large heterogeneity in terms of mutation profiles, not entirely captured by the presence of unilineage versus multilineage dysplasia, percentage of bone marrow blasts, and presence of hypocellularity and fibrosis. To better investigate the continuum between high risk MDS (i.e., patients with ≥10% blasts) and AML, an exploratory comparison was made using a cohort of AML (defined according to WHO 2016) patients analyzed using the same statistical methods. Only a partial overlap in genetic signatures was observed between MDS with ≥10% blasts and AML. However, similarities were observed between the AML-like MDS clusters (characterized by mutant NPM1, bZIP CEBPA, and Core Binding Factor abnormalities) and AML clusters defined by the same genetic signature, thus supporting the classification of these entities as AML, irrespective of blast count. Conclusion. Our study demonstrated the utility of a data-driven approach based on advanced statistical methods to generate a harmonized classification for MDS. Table 2 shows a provisional, hierarchical classification algorithm. Further refinement of entity labels and classification criteria is the subject of the ongoing modified Delphi Process consensus approach among icMDS experts.

Distinct Immune and Molecular Profiles of Hepatitis-Associated Aplastic Anemia

Background: Hepatitis-associated aplastic anemia (HAAA) is characterized by the development of hematopoietic failure within months following an acute episode of non-infectious hepatitis. Although disease presentation with pancytopenia and a hypocellular marrow in HAAA is similar to non-hepatitis immune AA (non-HAAA), the immune and molecular profile in HAAA has not been completely elucidated. Here, we aimed to assess HAAA patients for cytokines and presence of clonal events linked to AA, the presence of paroxysmal nocturnal hemoglobinuria (PNH) clones and somatic mutations in peripheral blood mononuclear cells (PBMC) subpopulations, and compared to a non-HAAA cohort. Methods: A cohort of HAAA patients (n=30), age and sex-matched non-HAAA patients (n=24) and healthy controls (n=23) seen at the National Institutes of Health since 2003 were retrospectively screened for a panel of inflammatory cytokines and growth factors by Luminex, and somatic mutations in sorted CD3-, CD3+CD4+, and CD3+CD8+ PBMC fractions by error-corrected DNA sequencing. A customized panel with 42 myeloid-related and 49 autoimmunity-related genes at minimum limited of detection of 0.1% were used. All samples were before any immunosuppressive treatment (IST). Cytokine levels and frequencies of PNH clones and clonal hematopoiesis (CH) in different fractions were compared among groups. Results: HAAA patients were in average young (median age=23); 37% were at age < 18 (Table 1). Although disease severity and blood counts were similar to the non-HAAA cohort, immune and molecular markers of immune AA were distinct among cohorts. The frequency of PNH clones was significantly lower in HAAA compared to the non-HAAA cohort (15% v 58%, p=0.0008). The median size of PNH clones in HAAA and non-HAAA was 1.4% and 7.4%, respectively (p =0.03). The cytokine profiles performed in the sera of 22 HAAA before IST were marked by significantly higher levels of IL-1ra (p=0.0008), CXCL-10 (p=0.0038), and VEGF (p=0.0023) in comparison to 31 non-HAAA assessed patients; IL-6 (p=0.0002) and CD40L (p=0.0001) levels were significantly lower than in non-HAAA. As reported in immune AA, HAAA patients had higher levels of TPO (p=0.0001), G-CSF (p=0.0001), and EPO (p=0.0001) than controls; lower levels of CCL-5 (p=0.0001) and CCL-11 (p=0.0025) were seen in the HAAA. FLT3-L levels were markedly elevated in both AA cohorts when compared to HC. The clonal landscape was also strikingly different between HAAA and non-HAAA in all fractions evaluated (Figure 1). In HAAA, 3 out of 21 assessed patients (14%) had CH in the CD3- fraction at maximum variant allele frequency (VAF) of 1.8%; one patient had two RUNX1 mutations while a JAK2 and DNMT3A mutation were found in the other two patients. No mutations were found in CD4+ and CD8+ compartments in subjects with HAAA. In contrast, 13 of 24 non-HAAA patients (54%) had CH in the CD3- populations, which was dominated by PIGA, BCOR, and DNMT3A clones, a pattern consistent with the known clonal landscape of immune AA. The frequency of non-HAAA with CH in the CD4+ and CD8+ compartments was 7/24 (29%) and 8/24 (30%) patients, respectively; CH in these fractions was similar to those found in CD3- dominated by mutations in PIGA, BCOR, and DNMT3A at VAFs ranging from 0.2% to 15% (Figure 1). CH in lymphoid-related genes was only found in a single patient with a STAT3 p.S614Rmutation at VAF of 3% exclusive to the CD8+ fraction. Conclusion: HAAA has a distinct immunologic and molecular profile than non-HAAA patients. PNH clones were less frequent in HAAA and patterns of cytokines were significantly different than the non-HAAA cohort. CH in PIGA and BCOR, highly associated with AA, were not present in our small HAAA cohort. Our results indicate a distinct underlying pathophysiology that initiates the immune destruction resulting in marrow failure in HAAA patients. Confirming these findings in a larger cohort and correlating with clinical outcomes is ongoing.

Clonal Derivation and Dynamics in Rhesus Macaques Following Hematopoietic Stem Cell Transplantation and the Impact of Clonal Hematopoiesis

Microglia (MG) are the resident macrophages of the central nervous system (CNS). Under steady-state conditions, MG play essential roles in immune surveillance; phagocytosis and processing of pathogens, dying cells and protein aggregates; and synaptic pruning to maintain neuronal health. MG dysfunction has been linked to various CNS disorders, including neurodegenerative disorders such as Alzheimer's disease, with multiple pathways implicated, including increased and prolonged activation with excessive release of pro-inflammatory mediators. Lineage tracing studies in mice have demonstrated that yolk sac macrophages form the CNS MG compartment during development, with little ongoing replacement from circulating monocyte/macrophages at steady state or even following hematopoietic stem/progenitor cell (HSPC) transplantation. However, improvements in disease outcomes in human patients with CNS disorders such as adrenoleukodystrophy and metachromatic leukodystrophy following HSPC gene therapies have suggested that adult HSPC-derived cells can contribute to MG function. Recently, Bouzid et al reported that individuals with somatic HPSC mutations in hematopoietic expansion driver genes (clonal hematopoiesis/CH) had a significantly lower risk of Alzheimer's disease (AD). The same study utilized nuclear chromatin profiling of a small set of postmortem brain samples to suggest substantial contribution of CH-derived HSPC to the MG compartment. The authors suggested that enhanced function of CH-derived MG enables them to better clear AD plaques. To more directly investigate the replacement and clonal source of adult CNS resident MG/myeloid cells by HSPC-derived cells and to and assess the impact of CH mutations on MG replacement, we utilized clinically-relevant rhesus macaque (RM) models. Fresh MG and other tissue-resident myeloid cells were purified from the brains of RM that had undergone autologous transplantation 2- 9 years previously with HSPCs transduced with a barcoded lentiviral vector expressing GFP following ablative total body irradiation (TBI, n=6) (Koelle et al, Blood, 2017) or busulfan (n=1, vector without GFP)(Abraham et al, MTMCD, 2023); or HSPCs engineered to carry TET2 mutations using CRISPR/Cas9 (n=2)(Shin et al, Blood, 2022). In addition, we studied an aged RM with natural CH ( RUNX1 mutation) in order to investigate MG replacement in the absence of conditioning and transplantation. We optimized RM MG (CD45+CD11b+CX3CR1+) and CNS myeloid cell (CD45+CD11B+CX3CR1-) purification. To ensure separation of bona fide tissue-resident CNS cells away from perivascular cells or contaminating blood, we incorporated CD45-specific antibody serial intravascular staining (SIVS) (Mortlock et al., 2022) and sorted SIVS- parenchymal MG, SIVS- perivascular MG, and SIVS+ myeloid cells. In all 6 TBI-conditioned lentiviral-barcoded animals, at most 2% of tissue-resident SIVS- MG cells were GFP+ (Fig 1A), with a mean ratio of <0.01 compared to the level of GFP+ circulating blood monocytes in each animal (Fig 1B). Barcode analyses demonstrated similar clonal derivation of GFP+ MG cells to peripheral blood (PB) monocytes, representing output from stable long-term multipotent HSPC clones. A higher MG repopulation level was found in the busulfan-conditioned animal by vector copy number. MG replacement with CH-derived cells was no higher absolutely or relative to blood monocytes in the two engineered TET2-CH animals nor in the aged animal with natural CH (Fig 1B). These results demonstrate only low-level replacement of MG from HSPCs even many years following ablative conditioning and autologous transplantation, and no evidence for enhanced repopulation in the setting of engineered or natural clonal hematopoiesis. The clonal ontogeny of the HSPC-derived MG cells matched that of blood myeloid cells. Further characterization of MG derived from transplanted HSPCs versus control MG is ongoing, as is functional characterization of CH versus unmutated macrophages, asking whether mutated cells are hyper-functional. Our clinically-relevant macaque model provides insights into MG ontogeny, and information relevant to improving CNS-directed HSPC gene therapies, as well as information relevant to interpreting a potential protective impact of CH on human AD.

A Large Cohort Study of 412 Patients with SRSF2/TET2 Co-Mutated Myeloid Neoplasms: The Molecular Landscape and Clinical Outcomes

Introduction: Serine and arginine-rich splicing factor 2 ( SRSF2) and tet methylcytosine dioxygenase 2 ( TET2) are early mutations that drive the development of myeloid neoplasms and monocytosis. SRSF2/ TET2 co-mutations are most common in chronic myelomonocytic leukemia (CMML). However, they can also be seen in myelodysplastic syndrome (MDS), acute myeloid leukemia from CMML (AML-CMML), other AML (AML-Other, mostly de novo AML), and myeloproliferative neoplasms (MPN). Previous studies have investigated these co-mutations in myeloid diseases separately and as a subset (CMML) or small subset (MDS or AML) of the patients. Additionally, these studies mainly compared the clinical difference between patients with and without these double mutations. A large cohort study of patients with both mutations, irrespective of the morphologic diagnosis, has not been reported. Methods: Out of the Moffitt NextGen sequencing database of more than 8000 patients, we identified 412 patients with both SRSF2 and TET2 mutations and with diagnosed or suspected myeloid neoplasms. The demographics and clinical parameters were collected. Overall survival (OS) was defined as the time from sequencing to the last visit at Moffitt or death. Two experienced hematopathologists confirmed the final diagnosis according to the 5 th edition of the World Health Organization classification of hematological malignancies. Chi-squared tests of independence were used to compare the association between gene mutation and diagnosis, and a post hoc test based on adjusted standardized residuals was used. Cox proportional hazards models were used to compare the OS within and across diagnoses and included gender, age, gene mutation, and diagnosis (when comparing across diagnoses) as covariates. Results: Of the 412 patients, 284 (69%) were male, 128 (31%) were female, and the average age was 75 years. The five most common diagnoses, in descending order, were CMML (41%), AML-Others (23%), MDS (12%), AML-CMML (9%), and MPN (6%). The ten most common additional mutated genes, in descending order, were ASXL1 (44%), RUNX1 (28%), CUX1 (13%), JAK2 (13%), CBL (11%), TP53 (10%), SETBP1 (9%), KRAS (9%), STAG2 (9%), and NRAS (9%). A comparison of the top 5 diagnoses and the top 10 additional gene mutations showed an association between diagnosis and gene mutation (chi2 = 131, 36 df, p=.000). A post hoc test showed CBL mutations were less frequent in patients with AML-Others (p=.029), STAG2 mutations were less common in CMML patients (p=.007), and STAG2 mutations were more frequent in patients with MDS (p=.000). Among all patients, RUNX1 mutation (HR=2.4, 95% CI [1.3, 4.4], p=.005), ASXL1 mutation (HR=2.3, 95% CI [1.3, 4.2], p=.005), and CBL mutation (HR=2.0, 95% CI [1.0, 3.8], p=.048) were associated with lower OS. Among patients diagnosed with CMML, KRAS mutation (HR=4.1, 95% CI [1.5, 11.3], p=.006) and ASXL1 mutation (HR=3.3, 95% CI [1.4, 8.3], p=.009]) were associated with lower OS. Among patients with low-grade myeloid diseases (CMML and MDS), ASXL1 mutation (HR=2.6, 95% CI [1.2, 5.9], p=.021) was associated with lower OS. For the five most frequently co-mutated genes ( ASXL1, RUNX1, CUX1, JAK2, and CBL), no difference in OS was found between patients with CMML vs MDS, or AML-CMML vs AML-Others. Conclusions: SRSF2 and TET2 co-mutations occurred in various myeloid diseases, including CMML, AML transformed from CMML, other types of AML, MDS, and MPN. RUNX1, ASXL1, and CBL, were commonly mutated and associated with lower OS compared to patients with only SRSF2 and TET2 mutations. When comparing OS for patients diagnosed with low-grade diseases (CMML or MDS), ASXL1 mutation was associated with an increased risk of death. No difference in OS was found between CMML vs MDS, or AML-CMML vs AML-Others when co-mutation with ASXL1, RUNX1, CUX1, JAK2, or CBL was present.

Molecular and Cytogenetic Evaluation in Systemic Mastocytosis

Systemic mastocytosis (SM) is a rare hematological neoplasm characterized by pleomorphic symptoms, related to mediators release from pathological mast cells. Tissue infiltration of liver, spleen, gastro-intestinal (GI) tract and osteolysis are present in aggressive disease. As KIT D816V mutation can be found in approximately 80% of patients, several additional somatic mutations of prognostic significance have been detected in a subset of patients. We report on clinical, cytogenetic and molecular characteristic of 160 patients with SM diagnosed in the last 15 years at our center. Fourteen (8.9%) patients had cutaneous mastocytosis, 85 (53.5%) had indolent SM (ISM), 12 (7.5%) had smoldering SM (SSM), 27 (17%) had aggressive SM (ASM), 17 (10.5%) had SM with an associated hematological neoplasm (AHN-SM) and 1 (0.6%) had mast cell leukemia. Symptoms were mostly related to mediators release: itching and blistering (69, 43%), anaphylaxis (49, 30%), diarrhea/bloating (19, 12%), osteoporosis/bone fracture (10, 6%), constitutional symptoms (8, 5%), bone pain and myalgia (16, 10%), anaphylaxis from Hymenoptera venom (24, 15%). While SM patients were mostly treated with antihistamines and membrane stabilizers, 29 patients needed a disease modifying therapy. Four patients with ISM were treated with Interferon (IFN) for bone lytic alterations, while 1 patient with ISM started midostaurin for uncontrolled symptoms. Other 11 patients with ASM were treated with midostaurin: 4 responded, while 7 needed multiple lines of therapy including allogeneic transplant in 4 cases. Eleven patients with ASM were treated with tyrosin kinase inhibitors (TKI) before midostaurin became available, while 2 elderly patients were treated with low dose cytarabine and TKI for concomitant acute leukemia. KIT D816V mutation was found in 111 of 131 (85%) evaluable patients with SM. Cytogenetics was normal in all but 2 patients with AHN-SM in which a chromosomal gain was reported. Among 6 patients with ISM, KIT mutation was found in only 2 cases. One patient had isolated KIT mutation and was treated with IFN for skin symptoms and bone fracture, and another patient had a DNMT3A associated mutation and was treated with imatinib. Moreover, 1 patient presented both DNMT3A and TET2 mutations and was treated with IFN for bone fracture. Among 12 ASM patients, 1 was negative for significant mutations: no disease control was achieved after target therapy, and bone marrow function slowly recovered after allogeneic transplant. The most frequently recorded mutations were SRSF2 and TET2: they were present in 4 patients each and recorded together in 3 cases. Two patients with SRSF2 and TET2 mutations died after multiple lines of therapy: 1 patient for infection and graft versus host disease after allogeneic transplant and 1 for progressive disease. Moreover, the latter had additional RUNX1 mutation. Two patients with concomitant SRSF2 and IDH1 mutations and TET2 mutation respectively responded to midostaurin, while 1 with DNMT3A mutation received multiple lines of therapy and died for pneumonia. One patient with ASXL1 mutation responded to chemotherapy after 2 previous lines of treatment. Among 4 patients with isolated KIT mutation, 2 responded to midostaurin, 1 obtained a partial control of symptoms after 4 lines of treatment and 1 suddenly died after achieving stable disease after 2 lines of therapy. Among 3 patients with SM associated to myelodyplastic syndrome, 1 was negative for KIT but positive for TP53 mutations and died for natural event after symptoms directed therapy and continuing recombinant erythropoietin. The other 2 KIT positive patients presented multiple concomitant mutations. Additional TET2 and SRSF2 mutations were recorded in a patient who died few weeks after diagnosis, while additional TET2, SRSF2, RUNX1 and KRAS mutations were recorded in a patient treated with midostaurine and 2CDA before successful allogeneic transplant. Molecular characterization of SM has uncovered a complex landscape of somatic mutations other than KIT D816V. Although the prognostic significance of some recurrent mutations has been reported, prospective correlation with clinical response may highlighted their role in the pathogenesis of disease and possibly elucidate mechanism of resistance to treatment. On the other hand, cytogenetics might no be considered mandatory except for AHN-SM

Survival Outcomes Associated with Molecular and Cytogenetic Alterations in AML Patients Treated with Hypomethylating Agent and Venetoclax

Molecular profiling has improved prognostication and helped identify novel therapeutic targets in AML. Nonetheless, it has also created a complex web of molecular profiles and cytogenetic abnormalities and in many cases it remains unclear which specific alterations primarily drive leukemogenesis. We sought to review our patients (pts) treated with a hypomethylating agent (HMA) + Venetoclax (Ven), to evaluate molecular and cytogenetic profiles with their associated outcomes. We identified 142 pts with AML treated with HMA + Ven at Northwell Health between January 2019 and December 2023. Through retrospective chart review, we obtained patient and disease characteristics, treatment regimens, clinical outcomes as well as molecular and cytogenetic profiling (using commercial AML panels) prior to the initiation of HMA + Ven. Bone marrow biopsy pathology reports were reviewed to identify the subtype of AML and grouped into De novo AML, AML with MDS related changes (AML-MRC) and therapy-related AML (t-AML). Median relapse free survival (mRFS) and median overall survival (mOS) in months (m) as defined by ELN 2022 (Dohner et al, Blood 2022), were estimated with Kaplan-Meier curves and compared utilizing log-rank testing. T-test was used to evaluate significant differences between categorical data. Of the 142 pts identified, the median age was 77. The majority of patients had adverse (n = 99) or intermediate risk (n = 31) genetics as defined by the 2022 ELN genetic risk classification. The overall response rate (ORR) was 42% with mOS of 9.6m. AML-MRC patients (n=80) had mOS of 9.1m and mRFS of 11.6m with 61 pts receiving HMA + Ven as frontline treatment. 47 pts with De novo AML had mOS of 13.4m and mRFS of 16.1m with 36 pts receiving HMA + Ven as frontline therapy. Only 15 pts had t-AML with mRFS of 12.3m and mOS of 8.8m with 10 pts receiving HMA + Ven as frontline therapy. There was no significant difference in mRFS or mOS between these groups, although there was a trend favoring De novo AML. 47 different molecular alterations were identified among the 142 patients. Figure 1 illustrates outcomes associated with the 16 most prevalent molecular alterations found in our AML population. Mutational burden was similar between AML types (2.7 vs 3.0 vs 2.4 mutations per pt). De novo AML was associated with an increased mutation burden in signaling molecules (60%) and transcription factors (47%) compared to AML-MRC (29%, 31%). AML-MRC had a higher occurrence of mutations in epigenetic regulatory genes (79%) and splicing factors (31%) compared to De novo AML (55%, 19%). Mutations in splicing factors were associated with a significant increase in both mRFS and mOS(p = 0.01) compared to pts without mutations. Pts with DNMT3A, NPM1 or SRSF2 mutations had the highest ORR to HMA + Ven (63%, 64% and 63% respectively). RUNX1, TP53, complex cytogenetics and del 7q were associated with worse ORR (46%, 36%, 46% and 42% respectively) as well as decreased mOS. SRSF2, mutated in both AML-MRC and De novo AML, not only had an elevated ORR, but improved mRFS and mOS. Contrarily, mRFS and mOS were not significantly improved despite the high ORR in DMT3A mutated pts. DNMT3A was mutated most often in AML-MRC and was associated with a higher rate of other epigenetic regulatory gene co-mutations. The same is true for patients with KMT2A mutations (ORR 50%, mOS 2.8m, mRFS 6.1m) which suggests ineffectiveness of HMA+ Ven in maintaining remissions with this alteration with possible early selection for resistant clones. RUNX1 mutations were associated with an improved mRFS (16.1m) despite lower mOS (8.8m). NPM1 mutations had the highest mRFS of 34.4m. The survival advantage may be secondary to the absence of adverse cytogenetics in 88% of these pts. IDH2 mutations was associated with a significantly improved mOS compared to unmutated IDH2; however this may be confounded by the use of an IDH2 inhibitor at relapse. Our review of molecular alterations in AML pts identified several molecular alterations such as SRSF2, DNMT3A, RUNX1 which we found to be associated with favorable responses when treated with HMA + Ven. In addition, we demonstrated that NPM1 mutation remains favorable in patients treated with HMA + Ven. Our findings help contribute to the ever-growing, complex molecular and genomic profiling of AML patients.

Common Pathways for Acute Myeloid Leukemia Progression in Systemic Mastocytosis with Associated Hematologic Neoplasm

Background: Mastocytosis is a heterogenous disease of mast cell (MC) clonal proliferation with pathologic accumulation in organ systems such as but not limited to skin, bone marrow, gastrointestinal tract, liver and spleen. Mast cells are CD34+, CD117+ (stem cell factor, KIT) with greater than 90% of people with mastocytosis harboring KIT D816V activating mutations which allows for increased proliferation and accumulation of neoplastic mast cells leading to downstream mast cell activation and intolerable symptoms. Advanced systemic mastocytosis (advSM) is categorized into three major subtypes, aggressive SM, MC leukemia and SM with an associated hematologic neoplasm (SM-AHN). SM-AHN is the most common advSM subtype accounting for about 75% of advSM cases and typically includes myeloid neoplasms such as MDS, CMML, or MPN. In most pts with SM-AHN, clinical symptoms is driven by the MC component and the goal of treatment with KIT inhibitors is to decrease the MC burden, thus improving quality of life and overall survival (Nat Med refs), However, the median survival of SM-AHN remains poor at 2-3.5 years with many pts transforming to advanced myeloid neoplasms especially an acute myeloid leukemia (AML). The use of next generation sequencing has helped to prognosticate patients with AdvSM. Patients with advSM typically exhibit multiple somatic mutations other than KIT D816V We describe the molecular signature of patients with SM-AHN who transformed to AML. Commonly involved genes are TET2, SRSF2, ASXL1, RUNX1, and CBL with inferior OS and adverse clinical characteristic associated with SRSF2/ ASXL1/ RUNX1 (S/A/R). To better prognosticate, Jawhar and colleagues introduced the MARS score. This incorporated molecular findings in AdvSM to help estimate overall survival which identified 3 risk categories (low, intermediate, and high). The overall survival in low, intermediate and high were not reached, 4.3 years, and 1.9 respectively for patients with AdvSM. While mutational findings in the MARS score can help prognosticate overall survival in these patients, the molecular footprint of progression or transformation to acute myeloid leukemia has not been established. We describe the molecular signature of patients with SM-AHN who transformed to AML. Methods: We analyzed 10 pts with SM-AHN who transformed to AML from 2000-2022. Of those patients, 7 were found to have full next generation sequencing at the time of initial consultation and transformation. These data were collected and descriptive analysis was performed. Results: We identified 7 pts with SM-AHN who progressed to AML. At SM-AHN diagnosis all pts had at least 2 additional co-mutations with a maximum of 7 co-mutations along with KIT D817V. The most common co-mutations were splicing factor mutations ( SRSF2 and SF3B1), TET2, RASEZH2, CUX1 and CBL. Six of the seven received treatment for SM-AHN. These patients received treatment with multikinase inhibitors or hypomethylating agents. The acquired driver mutations were NPM1, FLT3-ITD, RUNX1, and RAS pathway. In patient 1, a new FLT3-ITD and RUNX1 was acquired with an increased VAF of a RAS pathway mutation ( PTPN1) which was originally present in the SM-AHN diagnosis. Patient 3 also developed a new RUNX1 mutation at AML transformation. Patients 4 and 5 had new NPM1 mutations and patients 6 and 7 had a new RAS pathway mutations . Patient 2 acquired new BCOR, RIT1 and CBL mutations. Upon transformation to AML, 5/7 patients had resolution or a decrease of greater than 10% of KIT D816V VAF. One of the seven had no change in KIT D816V VAF at the time of transformation, this was also the only patient to receive no prior therapy. Only 1/7 had a VAF increase of greater than 20% in KIT D817V at transformation. The MARS score was calculated at the time of diagnosis of SM-AHN which showed that only 4 of 7 had a high MARS score. Time from SM-AHN diagnosis to AML progression ranged from 4-31 months. Survival was calculated from time of SM-AHN diagnosis to death which ranged from 6-47 months. Conclusion: Acquisition of known AML driver mutations (RAS, RUNX1, NPM1, FLT3-ITD) are commonly found in SM-AHN patients at time of progression to AML. The MARS score calculated in our patients did not correlate with time to transition to AML.

Mutations in the RNA Splicing Factors U2AF1 and SRSF2 are Context-Dependent in Myeloproliferative Neoplasms

RNA splicing factor gene mutations are recurrently found in BCR::ABL1 negative myeloproliferative neoplasms (MPN). To understand the interactions between spliceosome gene mutations and MPN phenotypic driver mutations ( JAK2, CALR and MPL), we investigated their patterns of co-occurrence or mutual exclusivity in a cohort of 990 MPN patients with comprehensive molecular profiling and clinical information from the Hematologic Malignancies Data Repository (HMDR). As expected, MPN driver mutations ( JAK2, CALR and MPL) were mutually exclusive (N=658, N=168, N=53 respectively, Log2 OR≤-3.5 and Padj. ≤0.005 using pairwise Fisher's exact tests with Benjamin Hochberg multiple testing correction). Additionally, cases with co-occurring mutations in two RNA splicing factors, SF3B1, U2AF1 and SRSF2 (N=44, N=49, N=44) respectively were uncommon (2/135 splicing factor mutated cases) . We further found that U2AF1 and SRSF2 mutations co-occurred with JAK2 (log2 OR=1.7, Padj.=0.009) and MPL (log2 OR=2.1, Padj.=0.006) respectively, but rarely with CALR mutations (N=2 CALR-U2AF1 log2 OR=-2.3 Padj.=0.025, N=2 CALR-SRSF2 log2 OR=-2.2 Padj.=0.048). In contrast, CALR-SF3B1 mutations occurred at the expected frequency (Padj.=0.11). To explore the molecular settings where these mutations co-occur, we investigated the variant allele frequencies (VAFs) of CALR, U2AF1, SRSF2 and concomitant mutations in the CALR-U2AF1 (N=2) and CALR-SRSF2 (N=2) patients. The VAFs for the mutations detected in the first patient with CALR-U2AF1 co-mutation were: CALR 0.26, U2AF1 0.45, and TET2 0.41. Since CALR and splicing factor mutations are typically heterozygous, this suggests the CALR mutation was sub-clonal to the U2AF1 mutation and that U2AF1 and TET2 mutations were likely present in the same cell. In the second CALR-U2AF1 co-mutant case, VAFs were: CALR 0.31, U2AF1 0.27, and TP53 0.16. It is possible that in this case, the CALR and U2AF1 mutations may have occurred in independent clones or may have occurred in the same cell in the absence of other pathogenic mutations. For the two CALR-SRSF2 patients, data from three samples revealed VAFs of 0.23-0.46 for CALR and 0.21-0.58 for SRSF2 mutations. Considering their typical heterozygous occurrence, we inferred those individual cells harbored both CALR and SRSF2 mutations. Notably, in samples with high VAFs (>0.37) for both CALR and SRSF2 in two separate patients, additional high VAF pathogenic mutations were observed: 0.35 for ASXL1 and 0.46 for RUNX1 respectively. As ASXL1 and RUNX1 mutations also typically occur in a heterozygous manner, we hypothesized that when CALR and SRSF2 mutations are present in the same cell, another pathogenic co-mutation may be required for survival of the clone. To test our hypothesis, we FACS-sorted single lineage negative CD34 positive bone marrow cells from the first CALR- SRSF2 co-mutant case into 96 wells plates containing methylcellulose and hematopoietic growth factors (CFU-GEMM). DNA was harvested from single-cell colonies and genotyped for the following mutations using polymerase chain reaction (PCR) followed by gel electrophoresis and Sanger sequencing: CALR c.1154_1155insTTGTC p.K385fs*, SRSF2 c.284G>T p.P95H, ASXL1 c.1926_1927insG p.G642fs*, EZH2 c.2188_2212delAAAAAACAGCTCTTCGCCAGTCTGG p.F729fs*. Bulk NGS VAFs were 0.46, 0.38, 0.35, and 0.17, respectively. Out of 73 colonies analyzed, 71 colonies had the CALR insertion 5 mutation detected (see figure). Among these 71 CALR-mutated colonies, SRSF2 was found to co-occur in 35 colonies. Interestingly, all 35 colonies were accompanied by an ASXL1 mutation, and 29 of them had an additional EZH2 mutation. These findings support our hypothesis that CALR and SRSF2 mutations may co-occur in the same cell in the presence of another pathogenic mutation. Our findings offer molecular insights into the context-dependent behavior of splicing factor mutations in MPN. While they can co-occur with JAK2 and MPL mutations, U2AF1 and SRSF2 mutations are largely mutually exclusive with CALR mutations. In addition, our findings generate two main biological hypotheses: (i) a synthetic lethal relationship may exist between CALR mutations and SRSF2 or U2AF1 mutations, and (ii) this synthetic lethality may be overcome by the presence of additional pathogenic mutation(s) in the cell. Validation studies are ongoing to address these hypotheses. AM and AEM contributed equally.

Integrative Multi-Omic Analysis for Prognosis Stratification in Acute Myeloid Leukemia

Acute myeloid leukemia (AML) is a heterogeneous hematopoietic malignancy with a dismal prognosis. European LeukemiaNet (ELN) is crucial for tailoring AML treatment individually. Various AML models correlated survival and clinical drug response with immune cell differentiation state by deconvoluting transcriptomics. However, few comprehensive molecular subtyping models integrate multi-omic profiles for prognostic and drug response prediction. Thus, this study aimed to integrate DNA methylation, genomics, transcriptomics and ex vivo drug sensitivity screening of AML patients and explore their roles in facilitating AML molecular stratification and redefining prognosis. Firstly，data on 90 patients with AML(non-promyelocytic leukemia) were retrieved from The Cancer Genome Atlas (TCGA) for consensus clustering by 10 advanced consensus clustering algorithms. The optimal three distinct subtypes, UAMOCS1, UAMOCS2, and UAMCOS3, were identified to achieve the best clustering effect. Multi-omics were orchestrated together for UAMOCS shaping. The UAMOCS can significantly distinguish overall survival (median 18 vs. 27 vs. 45 months, P= 0.0048) among the three instinct subtypes with the integrated contribution of transcriptomic profiles and DNA methylation and mutation data. Also, the activity of AML-specific transcription factors and chromatin remodeling makers showed a diverse pattern among the three subtypes, epigenetically contributing to UAMOCS shaping. Next, the nearest template prediction, a model-free method, was applied to further validate this predictive model. Similar subtyping under this model is generated robustly by imitating 50 subtype-specific genes and capable of identifying survival in both the “ihCAMs-AML” (Figure 1) and GSE37642. The main validation cohort was a real-world de novo AML cohort (acute promyelocytic leukemia excluded), “ihCAMs-AML”（N=98）, aged 14-70 years, with a median follow-up of 28 (1-55) months. The samples were simultaneously available for methylome (N=31, 850K Methylation Chip), DNA mutation (N=96, targeted deep sequencing), transcriptome (N=98, bulk RNA-seq), and ex vivo drug screening (N=66, 17 drugs under 100% peak plasma concentration) profiling analysis. Clinical relevance showed that traditional cytogenetic stratification was strongly correlated with our system. UAMOCS1, acting as an “immune activator”, is characterized by enriching of AML myelodysplasia-related (AML-MR) gene mutations (especially RUNX1 mutation, P = 0.00839), unstable chromosome (deletions on 7q), increased abundance of immune cells with immune escaping marker and poor risk. UAMOCS2 was defined as an intermediate immune burden and a “monocytic-like” phenotype with intermediate survival, corresponding to its inclining result toward M4/M5. UAMOCS3 was an “immune desert” group supposed to be the most favorable subset among the three groups. The ex vivo drug screening result implied that UAMOCS also provide values in distinguishing drug response. UAMOCS1 hardly benefited from commonly used chemotherapeutic drugs compared with the other two distinct subtypes. Pharmacogenomics database GDSC (the Genomics of Drug Sensitivity in Cancer) among AML cell lines was used to evaluate potential drug targets for overcoming drug resistance. Receptor tyrosine kinase signaling inhibitors (SB505124 and EphB4) might be sensitive to UAMOCS1. Taken together, UAMOCS model was generated that can classify AML patients independently and help develop precise chemotherapeutic strategy for patients with AML in the future.

Precise Single-Cell Transcriptomic Mapping of Leukemia Cell States Reveals Unconventional Lineage Priming in Acute Myeloid Leukemia

Initial disease classification within acute leukemia relies on identifying morphological and immunophenotypic features of hematopoietic differentiation retained by leukemic blasts. While existing approaches can classify leukemic cells into broad lineages, they lack precision in discerning between specific cell states, particularly at the level of immature blasts. Single-cell (sc) RNA-sequencing (RNA-seq) provides thousands of new markers to enable precise determination of leukemia cell state and provides an opportunity to refine our classification of acute leukemia. To extend our ability to identify leukemia cell states by scRNA-seq, we developed a comprehensive reference map of human bone marrow hematopoiesis. Specifically, we integrated three unsorted bone marrow datasets and three CD34+ hematopoietic stem and progenitor (HSPC) purified datasets to ensure balanced representation of early HSPCs and terminally differentiated immune cells. This culminated in a curated atlas of 263,159 high-quality sc transcriptomes, representing 55 cellular states spanning 45 healthy donors (Fig 1A). We validated our cell state annotations to ensure concordance between transcriptional states and functional populations through reference mapping of bulk and sc transcriptomes from purified HSPC subsets. For example, mapping of scRNA-seq profiles from Lin-CD34+38-45RA-90+49f+ long-term (LT) HSCs revealed 91% concordance between transcriptional HSC and functional LT-HSC. We next performed scRNA-seq profiling on 12 AML patient samples harbouring either myelodysplasia-related genetic features or classical alterations involving NPM1 or KMT2A. By mapping leukemia cells onto our reference atlas, we identified pronounced involvement of early erythroid-like blasts in a subset of AML samples. To further investigate unconventional lineage priming in AML, we processed and mapped scRNA-seq profiles from eleven studies comprising 166 additional AML samples and 9 mixed phenotype acute leukemia (MPAL) samples (Fig 1B). After quality control and exclusion of mature lymphoid cells, we performed composition analysis utilizing 600,570 leukemia cells mapped to 38 cell states to identify patterns of variation among leukemia cell states. Immature leukemia cells map to a range of cellular states spanning HSC/MPP-like, LMPP-like, MLP-like, GMP-like, MEP-like, and EarlyEry-like, among others. Notably, we identified a subset of AMLs with high MLP-like enrichment that co-cluster with MPALs as well as a subset with high EarlyEry-like involvement that co-cluster with acute erythroid leukemias (AEL), thus highlighting the biological continuum between these diseases. We next identified marker genes from each leukemia cell state and trained sparse regression models to estimate their relative abundance within bulk RNA-seq cohorts. Through bulk analysis, we confirmed that MPAL is highly enriched for MLP-like cells compared to AML (p=2.5e-12) and that M6 AELs are highly enriched for EarlyEry-like cells compared to M0-M5 AMLs (p=0.00067). Among 864 AML patients, we found that high MLP-like abundance was associated with NUP98-NSD1 fusions (p=0.0011) and RUNX1 mutations (p=8.0e-10) while high EarlyEry-like abundance was associated with Complex Cytogenetics (p=8e-15) and TP53 mutations (p=2.3e-25). Cellular states of immature leukemic cells captured inter-patient heterogeneity within 136 AEL samples, wherein high EarlyEry-like abundance was associated with TP53 mutations (p=3.6e-9) and Poor cytogenetic risk (p=1.1e-9) while high GMP-like abundance was associated with KMT2A alterations (p=0.00046) and Good/Intermediate risk (p=0.00032). Finally, through integration of sc transcriptomics and targeted DNA profiling, we found examples of genetic subclones impacting the cellular hierarchies of individual patients through induction of early differentiation blocks, skewing of lineage output from myeloid to erythroid, or potentiation of transcriptional self-renewal programs within mature myeloid cells. Together, our high-resolution mapping approach highlights the cellular state continuum between acute leukemias and enumerates the impact of genetic drivers on leukemia cell hierarchies. Precise definitions of cellular states, coupled with the presence or absence of genetic alterations, may help to refine future disease classification, prognostication, and therapy development.

Safety and Efficacy of Azacitidine and Chidamide Maintenance after Allogeneic Hematopoietic Stem Cell Transplantation for Patients with High-Risk Acute Myeloid Leukemia: Interim Analysis of a Prospective, Multicenter, Single-Arm, Phase Ⅱ Clinical Trial

Background Although allogeneic hematopoietic stem cell transplantation (allo-HSCT) is the potentially curative therapy for AML, the relapse rate after HSCT is high with 30-60% for patients with high-risk AML. Maintenance therapy with efficacy and low toxicity is needed to mitigate relapse. It has been reported that histone deacetylases inhibitor chidamide exhibits anti-tumor activity against AML cells, and is able to elicit anti-tumor immune response in mouse models. However, efficacy and safety of chidamide as maintenance therapy following allo-HSCT for patients with AML have not been reported. Therefore, we designed a multicenter, single arm, phase II clinical trial for high-risk AML patients to use azacitidine combined with chidamide as maintenance therapy post allo-HSCT to prevent relapse. Methods In this multicenter, single arm, phase II clinical trial, patients aged 18-60 years with high-risk AML, defined as the European LeukemiaNet (ELN) 2017 adverse risk group, refractory, relapsed or secondary AML were given AZA and chidamide as maintenance therapy after 60 days post transplantation (NCT05270200). AZA was given at 100mg/day (days 1-5) for 6 cycles and chidamide 5mg daily (days 1-28) with a cycle of 28 days for up to 2 years. The dose of AZA was amended at 50mg/m 2/day (days 1-3) from Dec 23,2022 due to occurrence of thrombocytopenia. If PLT was below 50×10 9/L or grade 3/4 non-hematological toxicity occurs, maintenance should be interrupted or delayed until PLT count was greater than 75×10 9/L or the non-hematological toxicity resolved to ≦ grade 1. Primary objectives were safety and one year cumulative incidence of relapse. Secondary objections were relapse-free survival (RFS), overall survival (OS) and incidence of severity of acute and chronic graft-versus-host disease (GVHD). Results From February 12,2022 to June 30,2023, seven patients were enrolled, with a median age of 46 years（28-60), four patients (57%) were female. One patient (14%) received matched sibling donor transplantation, six patients (86%) received haploidentical donor transplantation. Five patients (71%) received myeloablative and 2/7 (29%) reduced intensity conditioning regimen. Six (86%) were in ELN 2017 adverse risk with three patients harboring KMT2A rearrangement, one patient with TP53 mutation, one patient with -7, one patient with RUNX1 mutation, while one patient (14%) was diagnosed as secondary AML with broad extramedullary infiltration. All but one patients entered transplant in CR, while five patients (83%) were MRD negative and one patient (17%) were positive. The baseline patient characteristics are summarized in Table1. Outcome data were updated as of June 30,2023 (Figure1). The median time to start maintenance therapy after transplantation was 77 days (range 64-80). The median follow-up time was 9.9 months, only one patient relapsed and the accumulative incidence of relapse of one year was 16.7%（95%CI,0.4%-64.1%). The relapsed patient diagnosed with MLL-AF10 rearrangement had extramedullary infiltration of left tonsil, gum and neck lymph nodes at 197 days post transplantation while bone marrow remained in MRD negative remission. AZA/chidamide were well tolerated, with no severe adverse event was recorded. Two grade 3/4 non-hematologic adverse events were observed, with one increased bilirubin due to cGVHD and one pneumonia. Two patients (29%) experienced grade4 thrombocytopenia requiring platelet transfusion. After amendment of AZA dose, no grade4 thrombocytopenia was recorded. No one discontinued treatment due to toxicity. During follow-up, none of patients had aGVHD. Three patients (43%) experienced mild or moderate cGVHD, no severe cGVHD was observed. The median OS was not reached, with six months and one year OS both of 100%. The median RFS is not reached, with six months and one year RFS of 100% and 83.3%(95%CI,35.9%-99.6%). Conclusions Preliminary results suggest that maintenance of AZA combined with chidamide post allo-HSCT in patients with high-risk AML exhibits promising efficacy and well-tolerated. Recruitment of patients with high-risk AML post allo-HSCT for this trial is ongoing. Disclosures No relevant conflicts of interest to declare.