Mutations In NF1 Gene Research Articles

554 Sirolimus gel effectively reduced neurofibromas in neurofibromatosis type 1 in a double-blind, placebo-controlled, randomized clinical trial

NF1 is an autosomal dominant inherited disease caused by the mutation of NF1 gene coding neurofibromin. Although many symptoms with wide variations are recognized, neurofibromas and café-au-lait spots are observed in nearly 100% of patients. Neurofibromin is a tumor suppressor and suppress RAS-MAPK and PI3K-mTOR signaling pathway. Although several clinical trials in NF1 patients have been conducted with RAS-MAPK inhibitors, they are not constantly effective for tumor suppression but resulted in severe side effects. Thus, safer and more effective treatment have been required. It is known that the tumor microenvironment (TME) is involved in the developement of neurofibromas in NF1. In addition to protein synthesis and cell proliferation, mTORC1 is known to be involved in the formation of TME. Therefore, mTORC1 inhibitors seem to be more effective than RAS-MAPK inhibitors. However, systemic administration of sirolimus, an mTORC1 inhibitor, has not been so effective for tumor suppression as expected probably because sirolimus is ineffectively transferred to dermal lesions from blood. We have developed a novel sirolimus gel which delivers sirolimus into the skin lesions with low migration into the blood. Then, we conducted a phase 2, randomized, double-blind clinical trial of the sirolimus 0.4% and 0.2% gel in 18 NF1 patients aged 16 to 70 years old which was approved by our IRB. Tumor size was measured by both CT and ruler to determine the best evaluation method. Statistically significant differences were observed in the sirolimus 0.2% group, and combination of the sirolimus 0.2% and 0.4% group for the change in tumor size by ruler through week 24. Adverse events were mild, and the treatment was not discontinued. As conclusion, topical sirolimus gel treatment was effective and safe for patients with dermal neurofibromas in NF1, which suggest a novel and effective therapeutic modality for NF1.

Gene expression profiles between cystic and solid vestibular schwannoma indicate susceptible molecules and pathways in the cystic formation of vestibular schwannoma

Previous research has shown that although NF2 gene mutation is the major cause of vestibular schwannoma (VS), it may not directly participate in cystic VS (CVS). To elucidate the underlying potential genetic mechanisms in the cystic formation of VS, we compared differences in gene expression between solid VS (SVS) and CVS via a bioinformatics analysis. The cDNA microarray method and miRNA sequencing were performed on 29 representative VSs (17 CVSs and 12 SVSs). A differential expression analysis was used to identify differentially expressed mRNAs (DEmRNAs) and miRNAs (DEmiRNAs). Then, miRNA–mRNA regulatory networks were constructed. Gene ontology (GO), a KEGG pathway enrichment analysis, and the protein–protein interaction (PPI) were used to analyze the co-differentially expressed DEmRNAs at the functional level. From the differential expression analyses, 1304 DEmRNAs, 55 DEmiRNAs, and hub genes including PTEN, FOXO1, FOXO3, VEGFA, and SIRT1 were identified. Histological evidence is presented to confirm the makeup of the hubs, which corresponded with the cDNA microarray. Our analysis revealed that the maps of apoptosis, cellular response to hypoxia, and the PI3K-Akt, AMPK, FOXO, and chemokine signaling pathways were significantly enriched. In addition, the TUNEL assay, immunoblotting analysis, and transmission electron microscope revealed increased degenerative changes in CVS. These findings could be the foundation for understanding the potential role of differential genes in the cystic formation of VS and be helpful in exploring the potential biomarkers for the differential diagnosis, prognosis, and development of drug targets for CVS.

Increased breast cancer risk in women with neurofibromatosis type 1: a meta-analysis and systematic review of the literature

BackgroundNeurofibromatosis type 1 (NF1) is a cancer predisposing syndrome. Studies suggest that women < 50 years old (y.o.) with NF1 have an increased breast cancer (BC) incidence and BC associated mortality. However, this has not been widely recognized secondary to small study populations.MethodsA systematic literature review was conducted through database searches for BC and NF1: 3456 articles identified, 166 reviewed, 58 used for descriptive analysis and 4 utilized for meta-analysis. Fisher’s exact tests, Kaplan-Meier curves and random-effects meta-analysis models were used for analysis.ResultsTwo hundred eighty-six cases of NF1 and female BC were identified with a median age of 46 years at diagnosis; 53% were < 50. Peak age of BC diagnosis was between 34 to 44 years. Women < 50 y.o. presented with more advanced disease vs. those ≥50 (56% vs. 22% stage III-IV, respectively; p = 0.005). Median survival for the entire cohort was 5 years vs. the reported median BC survival of over 20 years in the general population using the SEER database. Median age at BC death was 48.5 years; 64% of deceased patients were < 50. Meta-analysis of a total of 4178 women with NF1 revealed a BC standardized incidence ratio (SIR) of 3.07 (95%CI 2.16–4.38) for women with NF1 vs. the general population. Women < 50 y.o. demonstrated a higher SIR of 5.08 (95%CI 3.77–6.81) compared to 1.92 (95%CI 1.40–2.63) if ≥50 y.o.ConclusionsThis systematic literature review and meta-analysis suggests that women with NF1 < 50 y.o. have a five-fold increased risk of BC, present with more advanced disease, and may have an increased BC related mortality. Increased awareness and implementation of recent National Comprehensive Cancer Network early BC screening guidelines for this high-risk patient population is essential. Additional evaluation on the influence of NF1 gene mutations identified in patients undergoing hereditary cancer genetic testing on breast cancer risk in individuals without clinical evidence of NF1 is needed.

Breast cancer risk in neurofibromatosis type 1 is a function of the type of NF1 gene mutation: a new genotype-phenotype correlation

BackgroundNeurofibromatosis type 1 (NF1) predisposes to breast cancer (BC), but no genotype-phenotype correlations have been described.MethodsConstitutional NF1 mutations in 78 patients with NF1 with BC (NF1-BC) were compared with the...

Ampullary Neuroendocrine Tumor With Multiple Gastrointestinal Stromal Tumors in a Patient with Von Recklinghausen’s Disease Patient: A Case Report

Von Recklinghausen’s disease (VRD) is a hereditary disease that occurs because of mutation in NF1 gene located on chromosome 17. About 25% of VRD patients are reported to suffer from gastrointestinal lesions varying from hyperplasia of the gut neural tissue, endocrine tumors of the duodenum and the periampullary region, and gastrointestinal stromal tumors. Herein, we describe a case of ampullary neuroendocrine tumor with unique histology and immunohistochemistry in a 35-year-old male patient with VRD, detailed review of literature.

Predicting Response to Dasatinib Using a Computational Model and Its Validation: A Beat AML Project Study

Background: New prognostic factors have been recently identified in AML patient population that include frequent mutations of receptor tyrosine kinases (RTK) including KIT, PDGFR, FLT3, that are associated with higher risk of relapse. Thus, targeting RTKs could improve the therapeutic outcome in AML patients.Aim: To create a digital drug model for dasatinib and validate the predicted response in AML patient samples with ex vivo drug sensitivity testing.Methods: The Beat AML project (supported by the Leukemia & Lymphoma Society) collects clinical data and bone marrow specimens from AML patients. Bone marrow samples are analyzed by conventional cytogenetics, whole-exome sequencing, RNA-seq, and an ex vivo drug sensitivity assay. For 50 randomly chosen patients, every available genomic abnormality was inputted into a computational biology program (Cell Works Group Inc.) that uses PubMed and other online resources to generate patient-specific protein network maps of activated and inactivated pathways. Digital drug simulations with dasatinib were conducted by quantitatively measuring drug effect on a composite AML disease inhibition score (DIS) (i.e., cell proliferation, viability, and apoptosis). Drug response was determined based on a DIS threshold reduction of > 65%. Computational predictions of drug response were compared to dasatinib IC50 values from the Beat AML ex vivo testing.Results: 23/50 (46%) AML patients had somatic mutations in an RTK gene (KIT, PDGFR, FLT3 (ITD (n=15) & TKD (n=4)), while 27/50 (54%) were wild type (WT) for the RTK genes. Dasatinib showed ex vivo cytotoxicity in 9/50 (18%) AML patients and was predicted by CBM to remit AML in 9/50 AML patients with 4 true responders and 5 false positive. Ex vivo dasatinib responses were correctly matched to the CBM prediction in 40/50 (80%) of patients (Table1), with 10 mismatches due to lack of sufficient genomic information resulting in profile creation issues and absence of sensitive loops in the profile. Only 4/23 (17%) RTK-mutant patients and 5/27(19%) RTK-WT patients were sensitive to dasatinib ex vivo, indicating that presence of somatic RTK gene mutations may not be essential for leukemia regression in response to dasatinib. Co-occurrence of mutations in NRAS, KRAS and NF1 seemed to associate with resistance as seen in 10 of the 14 profiles harboring these mutations.Conclusion: Computational biology modeling can be used to simulate dasatinib drug response in AML with high accuracy to ex vivo chemosensitivity. DNA mutations in RTK genes may not be required for dasatinib response in AML. Co-occurrence of NRAS, KRAS and NF1gene mutations may be important co-factors in modulating response to dasatinib. [Display omitted] DisclosuresTyner:Leap Oncology: Equity Ownership; Syros: Research Funding; Seattle Genetics: Research Funding; Janssen: Research Funding; Incyte: Research Funding; Gilead: Research Funding; Genentech: Research Funding; AstraZeneca: Research Funding; Aptose: Research Funding; Takeda: Research Funding; Agios: Research Funding. Druker:Third Coast Therapeutics: Membership on an entity's Board of Directors or advisory committees; Novartis Pharmaceuticals: Research Funding; Millipore: Patents & Royalties; Vivid Biosciences: Membership on an entity's Board of Directors or advisory committees; Oregon Health & Science University: Patents & Royalties; McGraw Hill: Patents & Royalties; Celgene: Consultancy; MolecularMD: Consultancy, Equity Ownership, Membership on an entity's Board of Directors or advisory committees; GRAIL: Consultancy, Membership on an entity's Board of Directors or advisory committees; Bristol-Meyers Squibb: Research Funding; Amgen: Membership on an entity's Board of Directors or advisory committees; Aptose Therapeutics: Consultancy, Equity Ownership, Membership on an entity's Board of Directors or advisory committees; Henry Stewart Talks: Patents & Royalties; Patient True Talk: Consultancy; Blueprint Medicines: Consultancy, Equity Ownership, Membership on an entity's Board of Directors or advisory committees; ARIAD: Research Funding; Fred Hutchinson Cancer Research Center: Research Funding; Beta Cat: Membership on an entity's Board of Directors or advisory committees; Cepheid: Consultancy, Membership on an entity's Board of Directors or advisory committees; Leukemia & Lymphoma Society: Membership on an entity's Board of Directors or advisory committees, Research Funding; ALLCRON: Consultancy, Membership on an entity's Board of Directors or advisory committees; Aileron Therapeutics: Consultancy; Gilead Sciences: Consultancy, Membership on an entity's Board of Directors or advisory committees; Monojul: Consultancy. Sahu:Cellworks Research India Private Limited: Employment. Vidva:Cellworks Research India Private Limited: Employment. Kapoor:Cellworks Research India Private Limited: Employment. Azam:Cellworks Research India Private Limited: Employment. Kumar:Cellworks Research India Private Limited: Employment. Chickdipatti:Cellworks Research India Private Limited: Employment. Raveendaran:Cellworks Research India Private Limited: Employment. Gopi:Cellworks Research India Private Limited: Employment. Abbasi:Cell Works Group Inc.: Employment. Vali:Cell Works Group Inc.: Employment. Cogle:Celgene: Other: Steering Committee Member of Connect MDS/AML Registry.

Analysis of NF1 gene mutations among eleven sporadic patients with neurofibromatosis type 1

To explore the genetic etiology for 11 sporadic patients with neurofibromatosis type 1. Chip targeting capture and high-throughput sequencing were employed to detect potential mutations of NF1 and NF2 genes among the 11 patients. The data was filtered through multiple mutational databases and in-house whole exome sequence database. Sanger sequencing was used for analysis of family members of the patients. Eleven pathogenic variants were found among the 11 patients, which included two splicing mutations, one missense mutation, two nonsense mutations, and six frame-shifting mutations. None of the mutations was recorded by the public database or the in-house database generated from 1775 samples through whole exome sequencing. None of the unaffected parents carried the same mutation. Seven mutations were associated with neurofibromatosis type 1 previously, while the remaining four were discovered for the first time. Prenatal diagnosis of two high-risk pregnancies suggested that neither fetus has inherited the NF1 mutation from their affected parents. Identification of causative mutations in patients with sporadic-type neurofibromatosis type 1 has provided a basis for genetic counseling. The four novel mutations have enriched the spectrum of NF1 gene mutations.

Height Growth Impairment in Children With Neurofibromatosis Type 1 Is Characterized by Decreased Pubertal Growth Velocity in Both Sexes.

Previous studies have suggested that children with neurofibromatosis type 1 are shorter than their unaffected counterparts as an effect of a germline NF1 gene mutation. The pathophysiology of this effect is still uncertain. The purpose of this study was to characterize longitudinal growth in children with neurofibromatosis type 1 in order to assess growth velocity and its influence on stature. Longitudinal height data were collected for 188 patients with a confirmed clinical diagnosis of neurofibromatosis type 1. Children with neurofibromatosis type 1 had population mean heights statistically different from the general population, with a reduced peak height velocity during pubertal growth. In addition, there were no significant differences in the timing of peak height velocity during puberty between the general population and those with neurofibromatosis type 1. These data demonstrate that short stature in neurofibromatosis type 1 is due in part to subnormal height acquisition during puberty.

Insights into optic pathway glioma vision loss from mouse models of neurofibromatosis type 1.

Neurofibromatosis type 1 (NF1) is a common cancer predisposition syndrome caused by mutations in the NF1 gene. The NF1-encoded protein (neurofibromin) is an inhibitor of the oncoprotein RAS and controls cell growth and survival. Individuals with NF1 are prone to developing low-grade tumors of the optic nerves, chiasm, tracts, and radiations, termed optic pathway gliomas (OPGs), which can cause vision loss. A paucity of surgical tumor specimens and of patient-derived xenografts for investigative studies has limited our understanding of human NF1-associated OPG (NF1-OPG). However, mice genetically engineered to harbor Nf1 gene mutations develop optic gliomas that share many features of their human counterparts. These genetically engineered mouse (GEM) strains have provided important insights into the cellular and molecular determinants that underlie mouse Nf1 optic glioma development, maintenance, and associated vision loss, with relevance by extension to human NF1-OPG disease. Herein, we review our current understanding of NF1-OPG pathobiology and describe the mechanisms responsible for tumor initiation, growth, and associated vision loss in Nf1 GEM models. We also discuss how Nf1 GEM and other preclinical models can be deployed to identify and evaluate molecularly targeted therapies for OPG, particularly as they pertain to future strategies aimed at preventing or improving tumor-associated vision loss in children with NF1.

Neurofibromatosis type I and multiple myeloma coexistence: A possible link?

The association between Neurofibromatosis type I (NF1) and multiple myeloma (MM), a plasma cell, dyscrasia is very rare. Here we put to the attention of the scientific community two new cases. The first one is a patient with active MM whereas the second with smoldering MM. Both patients present typical features of NF1 but skeletal alterations were present only in the second case including dysplasia, marked scoliosis and osteoporosis. MM osteolytic lesions were absent in both patients. In addition to the clinical diagnosis of NF1, a molecular testing for NF1 gene mutations has been performed finding that patient one was heterozygous for the c.6855C>A (Tyr2285Ter) mutation, while patient two was heterozygous for the c.7838dupC (Lys2614GlufsTer20) mutation. The two mutations were diagnosed both in genomic DNA from peripheral blood and from MM cells. The potential link between NF1 mutation and the increased risk of MM is discussed in the report.

Meningiomas – insights into genetics and correlations with histological features

Meningiomas are the most common intracranial tumors. They occur more frequently in women and may be completely asymptomatic. According to the World Health Organization, the ability to invade and to develop recurrences represents the criterion which is used to designate three grades of meningiomas. In the last decade, advanced knowledges in genetics and molecular biology have improved our understanding of the clinical behavior of meningiomas. In addition to mutation or loss of NF2 gene, recurrent mutations of other genes, such as TERT, TRAF7, AKT1, AKT3, SMO, KLF4, SMARCE1, POLR2A, SUFU, BAP-1, PIK3CA, TSLC1, CDNK2A, PTCH1, TP73, PTEN, NDRG2, S6K, and CDNK2B have been identified within subsets of meningiomas. This review provides an overview and updates of the current knowledge of the genetics of meningioma in correlation with its histopathology. The insights into genetics and molecular profile of meningiomas may provide a valuable step towards developing new therapeutic approach for this type of intracranial tumor.

Analysis of NF2 gene mutations in intraspinal Schwannomas

To explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene. Samples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing. Four de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations. The occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.

Lipoamide Inhibits NF1 Deficiency-induced Epithelial-Mesenchymal Transition in Murine Schwann Cells

Neurofibromatosis type I (NF1) is one of the most common neurocutaneous syndromes characterized by development of adult neurofibromas which is mainly made up of Schwann cells. The disease is generally accepted to be caused by inactivation mutation of Nf1 gene. And Nf1 deficiency had been reported to lead to ROS overproduction and epithelial-mesenchymal transition (EMT) phenotype. This study was designed to investigate whether excessive ROS conferred to Nf1 deficiency-induced EMT in Schwann cells. Colony formation, wound healing assay and transwell assay was used to evaluate the effects of stable Nf1 knockdown in SW10 Schwann cells. Western blot and ROS assay was conducted to explore the molecular mechanisms of Nf1 inactivation in tumorigenesis. Animal experiments were performed to assess the inhibitory effects of lipoamide, which is the neutral amide of α-lipoic acid and functions as a potent antioxidant to scavenge ROS, on Nf1-deficiency tumor growth invivo. Nf1 knockdown enhanced the cellular capacities of proliferation, migration and invasion, promoted ROS generation, decreased the expression of epithelial surface marker E-cadherin, and up-regulated several EMT-associated molecules in Schwann cells. Moreover, lipoamide dose-dependently inhibited not only Nf1 deficiency-induced EMT but also spontaneous EMT. Furthermore, lipoamide markedly suppresses tumor growth in a mouse model of NF1-associated neurofibroma. Our results clearly reveal that ROS overproduction is responsible for Nf1 deficiency-induced EMT and plays a crucial role in NF1 tumor growth. The findings presented herein shed light on the potential of antioxidant therapy to prevent the progression of NF1-associated neurofibroma.

NF1 Gene Mutations are the Major Molecular Event in Neurofibromatosis-Noonan Syndrome

NF1 Gene Mutations are the Major Molecular Event in Neurofibromatosis-Noonan Syndrome

Targeted Disruption of NF1 in Osteocytes Increases FGF23 and Osteoid With Osteomalacia-like Bone Phenotype.

Neurofibromatosis type 1 (NF1, OMIM 162200), caused by NF1 gene mutations, exhibits multi-system abnormalities, including skeletal deformities in humans. Osteocytes play critical roles in controlling bone modeling and remodeling. However, the role of neurofibromin, the protein product of the NF1 gene, in osteocytes is largely unknown. This study investigated the role of neurofibromin in osteocytes by disrupting Nf1 under the Dmp1-promoter. The conditional knockout (Nf1 cKO) mice displayed serum profile of a metabolic bone disorder with an osteomalacia-like bone phenotype. Serum FGF23 levels were 4 times increased in cKO mice compared with age-matched controls. In addition, calcium-phosphorus metabolism was significantly altered (calcium reduced; phosphorus reduced; parathyroid hormone [PTH] increased; 1,25(OH)2 D decreased). Bone histomorphometry showed dramatically increased osteoid parameters, including osteoid volume, surface, and thickness. Dynamic bone histomorphometry revealed reduced bone formation rate and mineral apposition rate in the cKO mice. TRAP staining showed a reduced osteoclast number. Micro-CT demonstrated thinner and porous cortical bones in the cKO mice, in which osteocyte dendrites were disorganized as assessed by electron microscopy. Interestingly, the cKO mice exhibited spontaneous fractures in long bones, as found in NF1 patients. Mechanical testing of femora revealed significantly reduced maximum force and stiffness. Immunohistochemistry showed significantly increased FGF23 protein in the cKO bones. Moreover, primary osteocytes from cKO femora showed about eightfold increase in FGF23 mRNA levels compared with control cells. The upregulation of FGF23 was specifically and significantly inhibited by PI3K inhibitor Ly294002, indicating upregulation of FGF23 through PI3K in Nf1-deficient osteocytes. Taken together, these results indicate that Nf1 deficiency in osteocytes dramatically increases FGF23 production and causes a mineralization defect (ie, hyperosteoidosis) via the alteration of calcium-phosphorus metabolism. This study demonstrates critical roles of neurofibromin in osteocytes for osteoid mineralization. © 2017 American Society for Bone and Mineral Research.

Whole tumor RNA-sequencing and deconvolution reveal a clinically-prognostic PTEN/PI3K-regulated glioma transcriptional signature.

The concept that solid tumors are maintained by a productive interplay between neoplastic and non-neoplastic elements has gained traction with the demonstration that stromal fibroblasts and immune system cells dictate cancer development and progression. While less studied, brain tumor (glioma) biology is likewise influenced by non-neoplastic immune system cells (macrophages and microglia) which interact with neoplastic glioma cells to create a unique physiological state (glioma ecosystem) distinct from that found in the normal tissue. To explore this neoplastic ground state, we leveraged several preclinical mouse models of neurofibromatosis type 1 (NF1) optic glioma, a low-grade astrocytoma whose formation and maintenance requires productive interactions between non-neoplastic and neoplastic cells, and employed whole tumor RNA-sequencing and mathematical deconvolution strategies to characterize this low-grade glioma ecosystem as an aggregate of cellular and acellular elements. Using this approach, we demonstrate that optic gliomas generated by altering the germline Nf1 gene mutation, the glioma cell of origin, or the presence of co-existing genetic alterations represent molecularly-distinct tumors. However, these optic glioma tumors share a 25-gene core signature, not found in normal optic nerve, that is normalized by microglia inhibition (minocycline), but not conventional (carboplatin) or molecularly-targeted (rapamycin) chemotherapy. Lastly, we identify a genetic signature conferred by Pten reduction and corrected by PI3K inhibition. This signature predicts progression-free survival in patients with either low-grade or high-grade glioma. Collectively, these findings support the concept that gliomas are composite ecological systems whose biology and response to therapy may be best defined by examining the tumor as a whole.

Quadruple-Negative GIST Is a Sentinel for Unrecognized Neurofibromatosis Type 1 Syndrome.

The majority of gastrointestinal stromal tumors (GIST) are driven by KIT, PDGFRA, or, less commonly, BRAF mutations, and SDH gene inactivation is involved in a limited fraction of gastric lesions. However, about 10% of GISTs are devoid of any of such alterations and are poorly responsive to standard treatments. This study aims to shed light on the molecular drivers of quadruple-negative GISTs. Twenty-two sporadic quadruple-negative GISTs with no prior association with Neurofibromatosis Type 1 syndrome were molecularly profiled for a panel of genes belonging to tyrosine kinase pathways or previously implicated in GISTs. For comparison purposes, 24 GISTs carrying KIT, PDGFRA, or SDH gene mutations were also analyzed. Molecular findings were correlated to clinicopathologic features. Most quadruple-negative GISTs featured intestinal localization, with a female predilection. About 60% (13/22) of quadruple-negative tumors carried NF1 pathogenic mutations, often associated with biallelic inactivation. The analysis of normal tissues, available in 11 cases, indicated the constitutional nature of the NF1 mutation in 7 of 11 cases, unveiling an unrecognized Neurofibromatosis Type 1 syndromic condition. Multifocality and a multinodular pattern of growth were common findings in NF1-mutated quadruple-negative GISTs. NF1 gene mutations are frequent in quadruple-negative GISTs and are often constitutional, indicating that a significant fraction of patients with apparently sporadic quadruple-negative GISTs are affected by unrecognized Neurofibromatosis Type 1 syndrome. Hence, a diagnosis of quadruple-negative GIST, especially if multifocal or with a multinodular growth pattern and a nongastric location, should alert the clinician to a possible Neurofibromatosis Type 1 syndromic condition. Clin Cancer Res; 23(1); 273-82. ©2016 AACR.

Mechanical Signaling in NF1 Osteoblast Cells

Neurofibromatosis Type I (NF1) syndrome is characterized by neurofibromas andneural tumors but is also associated with skeletal abnormalities. The cellularpathophysiology of skeletal abnormalities in NF1 is not understood. Theseabnormalities result from constitutive active RAS and its downstream effectors, RASERKpathway, due to mutation of NF1 gene which converts active RAS-GTP intoinactive RAS-GDP. In osteoblast cells, RAS-ERK pathway is involved in cellproliferation and differentiation and is also involved in mechanical signals transduction. In this study, we propose that Nf1 mutation in osteoblast cells will affect the responseto mechanical stimulation through the RAS pathway. The Flexcell tension system wasused to mechanically stimulate calvarial osteoblast precursor from conditional knockoutmice, Nf1(ob-/-), and wild type calvarial osteoblast precursor cells, (WT. Theprotocol of cyclic mechanical strain was 2% to 4% elongation at 0.16 Hz (10 cycles perminute) for 24h. Mechanically stimulated cells showed lower expression levels of theosteoblast marker gene, RUNX2, measured at 4h and 8h post-stretch. Mineralizedmatrix deposition, assessed by Alizarin red staining, was decreased in Nf1(ob-/-)compared to (WT) cells following mechanical stimulation. the Nf1(ob-/-) and WTosteoblast precursor cells were then treated with RAS inhibitor (FTI-277), for 4h and8h. RUNX2 expression level was increased in Nf1(ob-/-) cells compared to non-treatedcells. However, the opposite result was seen in (WT) cells. The FTI-277 treatmentresulted in lower RUNX2 expression level and lower mineralized matrix deposition. This response of (WT) cells was normal. However, the Nf1(ob-/-) response showedthat these cells although they have hyper-active RAS, but when it is exposed to stress,it loses its ability to express osteoblast markers or lay down mineralized matrix. Ourresults indicate that, the hyper-active RAS in NF1 mutant osteoblast will result in cellsbeing stuck in proliferative state and unable to differentiate.

Méningiomes multiples

Multiple meningiomas (MMs) or meningiomatosis are defined by the presence of at least 2 lesions that appear simultaneously or not, at different intracranial locations, without the association of neurofibromatosis. They present 1–9 % of meningiomas with a female predominance. The occurrence of multiple meningiomas is not clear. There are 2 main hypotheses for their development, one that supports the independent evolution of these tumors and the other, completely opposite, that suggests the propagation of tumor cells of a unique clone transformation, through cerebrospinal fluid. NF2 gene mutation is an important intrinsic risk factor in the etiology of multiple meningiomas and some exogenous risk factors have been suspected but only ionizing radiation exposure has been proven. These tumors can grow anywhere in the skull but they are more frequently observed in supratentorial locations. Their histologic types are similar to unique meningiomas of psammomatous, fibroblastic, meningothelial or transitional type and in most cases are benign tumors. The prognosis of these tumors is eventually good and does not differ from the unique tumors except for the cases of radiation-induced multiple meningiomas, in the context of NF2 or when diagnosed in children where the outcome is less favorable. Each meningioma lesion should be dealt with individually and their multiple character should not justify their resection at all costs.

Molecular analysis of two pediatric cases with sporadic neurofibromatosis type 1

To report on two children manifesting multiple cafe-au-lait spots suspected as neurofibromatosis type 1, and perform NF1 gene mutation analysis. Blood samples were collected from the 2 children, their unaffected parents and 100 normal controls. The entire coding region of the NF1 gene was amplified by PCR and subjected to direct sequencing. In patient 1, a novel frameshift mutation c.1948delT (p.Leu650TyrfsX38) was identified in exon 12 of the NF1 gene. And in patient 2, a previously reported nonsense mutation c.541C>T (p.Gln181X) was revealed in exon 4b. The same mutations were not detected in their unaffected parents or 100 normal controls. The two patients were diagnosed with neurofibromatosis type 1 by molecular genetic testing. The pathogenic mutations were c.1948delT and c.541C>T, respectively.