This paper is devoted to the study of existence and multiplicity results for a class of elliptic problems driven by a q ( x ) -Laplacian-like operator and a q ( x ) -biharmonic operator in the presence of a Hardy-type singular potential. The problem is formulated within the framework of variable exponent Lebesgue–Sobolev spaces, which naturally accommodate the non-standard growth conditions of the operators involved. By employing variational methods, notably the Mountain Pass Theorem and its Z 2 -symmetric version, we establish the existence of at least one nontrivial weak solution as well as the existence of infinitely many solutions under suitable symmetry assumptions. A central feature of the analysis is the restriction imposed on the parameter μ associated with the Hardy-type term, which ensures the coercivity of the energy functional and the validity of the Palais–Smale condition. The results obtained extend and complement existing contributions on variable exponent biharmonic problems with singular nonlinearities and provide a foundation for further investigations, including regularity analysis and possible extensions to fractional or nonlocal q ( x ) -biharmonic operators.

This article explores the links between writing, argumentation, teaching and learning within the framework of a naturalistic didactic research designed as a multiple case study. This research was carried out in two classrooms (one of Linguistics and the other of Biology) in the first year of two Argentine public universities where certain teaching conditions favoured and sustained epistemic work with writing and argumentation. These cases show two different but interrelated ways of working with argumentative writing in the first year of higher education: in the Linguistics case, the work with argumentative writing as teaching object prevails, while in the Biology case, its use as a teaching tool stands out. However, we stress that this is a question of emphasis within a tool-object continuous, since teachers of both cases recognize the benefits of writing and arguing as a way of thinking, participating, sharing and, above all, learning.

The correlation between keratoconus (KC) and psychiatric disorders has been reported, but whether there is a genetic correlation between the 2 remains unclear. We identified genetic overlaps between KC and 6 psychiatric disorders by using comprehensive summary data from genome-wide association studies. Cross-trait pleiotropic analysis uncovered shared loci and genes, whereas functional annotations and tissue-specific investigations assessed the impact of these pleiotropic genes. Finally, bidirectional Mendelian randomization was applied to explore causal relationships. Significant genetic correlation and genetic overlap were observed in 3 of the 6 trait pairs. A multiplicity study using the composite null hypothesis discovered significant possible multiplicity single nucleotide variants across 3 trait pairs, revealing 13 pleiotropic genetic loci, of which 3 were confirmed as colocalized loci with a posterior probability (PP.H4) exceeding 0.75. Significantly, numerous pleiotropic loci were identified across various paired traits, including 11p15.5 and 9q34.3. At the gene level, 137 pleiotropic genes were identified, including PDDC1, PIDD, and PNPLA2. Gene-based analyses indicated that these genes were significantly enriched in the brain and fibroblasts. Pathway analysis highlighted critical roles in Wnt/β-catenin signaling pathway. Mendelian randomization analysis further analyzed the correlation between these diseases. This study offers additional evidence of a multifaceted relationship between psychiatric disorders, specifically attention-deficit/hyperactivity disorder, anorexia nervosa, and posttraumatic stress disorder, and KC. At the same time, it may facilitate novel medications and enhanced clinical treatment techniques.

To establish a theory one needs cleverly designed and well-executed studies with appropriate and correctly interpreted statistical analyses. Equally important, one also needs replications of such studies and a way to combine the results of several replications into an accumulated state of knowledge. An approach that provides an appropriate and powerful analysis for studies targeting prespecified theories is the use of Bayesian informative hypothesis testing. An additional advantage of the use of this Bayesian approach is that combining the results from multiple studies is straightforward. In this article, we discuss the behavior of Bayes factors in the context of evaluating informative hypotheses with multiple studies. By using simple models and (partly) analytical solutions, we introduce and evaluate Bayesian evidence synthesis (BES) and compare its results to Bayesian sequential updating. By doing so, we clarify how different replications or updating questions can be evaluated. In addition, we illustrate BES with two simulations, in which multiple studies are generated to resemble conceptual replications. The studies in these simulations are too heterogeneous to be aggregated with conventional research synthesis methods. (PsycInfo Database Record (c) 2025 APA, all rights reserved).

STSL Press is an international platform for researchers, scientists, engineers, managers, doctors, and professors involved in all streams of research with the purpose of publishing high-quality research and review papers.

Nordhaus and Gaddum proved sharp upper and lower bounds on the sum and product of the chromatic number of a graph and its complement. Over the years, similar inequalities have been shown for a plenitude of different graph invariants. In this paper, we consider such inequalities for the number of cliques (complete subgraphs) in a graph $G$, denoted $k(G)$. We note that some such inequalities have been well-studied, e.g., lower bounds on $k(G)+k(\overline{G})=k(G)+i(G)$, where $i(G)$ is the number of independent subsets of $G$, has been come to be known as the study of Ramsey multiplicity. We give a history of such problems. One could consider fixed sized versions of these problems as well. We also investigate multicolor versions of these problems, meaning we $r$-color the edges of $K_n$ yielding graphs $G_1,G_2,\ldots,G_r$ and give bounds on $\sum k(G_i)$ and $\prod k(G_i)$.

The concept of accountability has been portrayed as vital and pertinent in the field of public administration in general and education management in particular for several years. This is important at a time that stakeholders like educators have misconceptualised the purpose of accountability to mean inspection or the lack of trust which makes them uncomfortable. This study sought to develop a conceptual framework of School Governing Body (SGB) Chairperson’s perception of their accountability in selected schools with the purpose of facilitating learning and teaching outcomes. A qualitative paradigm using a multiple case study design was adopted. Data were collected through in-depth individual interviews with 3 chairpersons. The participants were purposively selected because of our discernment that as representatives on the school governing boards, they were accountable to parents as part of their managerial responsibilities. Thematic analysis of the data was used to identify emerging themes and categories. The findings reveal clarity on the practice of accountability in the broad spectrum of school management and administration as well as with policy making and implementation.

Conservation–tourism partnerships are often promoted as win–win solutions to the twin problems of underfunded conservation and unsustainable development. Critics on the other hand have warned about the tendency toward win–lose outcomes, when nature is reduced to a tourism commodity. This article intervenes in this debate by contributing to a scholarship in Science and Technology Studies on ontological multiplicity. We present an ethnographic case study of a nature park in South Africa that analyzes its partnership and its outcomes as emerging from situated and messy political dynamics. Our findings demonstrate the ontological politics taking place in the interactions between two enacted versions of the park: a tourism version and a conservation version. We show how in some cases one version comes to matter over the other and also how the outcomes of these ontological politics are not total. In doing so, our analysis furthers the study of ontological multiplicity of natural places by going beyond the mapping of multiplicity, to also explicitly consider power relations. Focusing on the work of coordination, we challenge both win–win and win–lose accounts of conservation–tourism partnerships, revealing possibilities for doing partnerships otherwise. We also make the argument for expanding these possibilities through a move toward “response-able” tourism.

The use of botanical seeds of shallot as planting materials is more effective than bulbs. However, the characteristics of plants are not ‘true to type’. Bibliometric analysis can identify areas that have been under- explored. Research on biomolecule compounds and gene expression is needed to support biomarker-based detection technology to predict plant productivity early. This research aims to study the expression of the AcFT1 gene to compare two shallot plantlets with different responses (non-multiplied and multiplied). The AcFT1 gene was identified by bibliometric analysis. GapC2 (group of housekeeping genes) was selected as an internal control gene. The primer designed result were: <em>AcFT1</em>-F: 5’GCGAGAAACCGTCTGCTATGA3’; <em>AcFT1</em>-R: 5’GCAACTGGA GACCCAAGGTT3’; <em>GapC2</em>-F: 5’GCTGCACAACCAACTGCTTA3’; <em>GapC2</em>-R: 5’CCAGTGCTGCTAGGAATGAT3’. The RNA from micro bulb of shallot was then extracted and converted into cDNA with RT-PCR process. Based on the best-optimized PCR annealing temperature (55.2oC), the GapC2 and AcFT1 genes were expressed at the same thickness for both phenotypes, indicating the same level of expression in both micro bulbs. Further, this showed that AcFT1 cannot be used for comparative multiplication studies, this gene is more related to the bulb formation rather than the multiplication process.

Strangeness enhancement has long been considered as a signature of the quark-gluon plasma formation in heavy-ion collisions. Strangeness enhancement has also been observed in small systems at the Large Hadron Collider (LHC), but the underlying physics still needs to be fully understood. This motivates us to study the strange hadron production in small systems at RHIC. We present new measurements of (multi-)strange hadrons (KS0, Λ, Ξ and Ω), Λ, Ξ and Ω) in d+Au collisions at √sNN = 200 GeV, collected by STAR in 2016. We report the multiplicity and rapidity dependence of strange hadron transverse momentum (pT) spectra, pT-integrated yields dN/dy, average transverse momentum (<pT>), yield ratios of these strange hadrons to pions, nuclear modification factors and rapidity asymmetry for these particles in d +Au collisions.

Social Development and Welfare State Systems in Developing Countries in East Asia: A Comparative Study

Context. Multiplicity studies greatly benefit from focusing on M dwarfs because they are often paired in a variety of configurations with both stellar and substellar objects, including exoplanets. Aims. We aim to address the observed multiplicity of M dwarfs by conducting a systematic analysis using the latest available astropho-tometric data. Methods. For every star in a sample of 2214 M dwarfs from the CARMENES catalogue, we investigated the existence of resolved and unresolved physical companions in the literature and in all-sky surveys, especially in Gaia DR3 data products. We covered a very wide range of separations, from known spectroscopic binaries in tight arrangements (~0.01 au) to remarkably separated ultra-wide pairs (~105 au). Results. We identified 835 M dwarfs in 720 multiple systems, predominantly binaries. Thus, we propose 327 new binary candidates based on Gaia data. If these candidates are finally confirmed, we expect the multiplicity fraction of M dwarfs to be 40.3−2.0+2.1%. When only considering the systems already identified, the multiplicity fraction is reduced to 27.8−1.8+1.9%. This result is in line with most of the values published in the literature. We also identified M-dwarf multiple systems with FGK, white dwarf, ultra-cool dwarf, and exoplanet companions, as well as those in young stellar kinematic groups. We studied their physical separations, orbital periods, binding energies, and mass ratios. Conclusions. We argue that based on reliable astrometric data and spectroscopic investigations from the literature (even when considering detection biases), the multiplicity fraction of M dwarfs could still be significantly underestimated. This calls for further high-resolution follow-up studies to validate these findings.

Extended shortwave infrared (eSWIR) detectors capable of detecting wavelengths between 1.7 and 2.7 µm are useful for a wide range of applications, such as remote sensing and monitoring, but most of these detectors require cooling to reduce the dark currents. Identifying a suitable material that extends the wavelength range to well beyond 2 µm with minimal cooling is therefore important. The overall sensitivity of such a detector can be enhanced by using it in conjunction with a wide bandgap multiplication region which can increase the photocurrent via impact ionization. In this work, a systematic study of avalanche multiplication in seven Al0.9Ga0.1As0.08Sb0.92 diodes lattice matched to GaSb shows that the electron impact ionization coefficient (α) is larger than the hole impact ionization coefficient (β), especially at low electric fields. Using In0.22Ga0.78As0.19Sb0.89 (bandgap=0.45eV) as the absorber and Al0.9Ga0.1As0.08Sb0.92 (bandgap=1.6eV) as the multiplier in a separate absorption, charge, and multiplication region avalanche photodiode configuration enabled room temperature optical detection up to 2.75 µm with a peak external quantum efficiency (EQE) of >50% at the punch-through voltage (Vpt) ∼2µm wavelength. This device demonstrates a low excess noise of F=4.5 at a multiplication of M=20, giving rise to a noise equivalent power for an unoptimized device of 1.69×10−12W/Hz. A maximum multiplied EQE of >2000% at 2 µm is achieved before a low breakdown voltage of 18.9 V, obtained using a novel undepleted absorber design. This work shows the possibility of a high sensitivity eSWIR detector capable of operating at room temperature.

Background: This article presents a novel strategy that utilizes the nature-inspired Spotted Hyena Optimizer Algorithm (SHOA) to optimize the placement of solar and wind-based renewable distributed generation (RDG) and distribution static compensators (DSTATCOMs) in radial distribution systems (RDS). Methods: The proposed technique aims to determine the optimal locations of DSTATCOM and RDGs based on the loss sensitivity factor (LSF), while the appropriate sizes are determined using the newly developed SHOA. To facilitate efficient load flow calculations, a fast and effective backward/forward sweep algorithm (BFSA) is employed. Results: The primary objective of this method is to minimize overall power losses within the system. The effectiveness of the optimization approach based on SHOA is demonstrated through extensive simulations conducted on a standard IEEE 33-bus test system with diverse load models. Conclusion: The results of the simulations and comparisons of multiple case studies clearly indicate that the allocation of DSTATCOMs leads to significant reductions in power losses and improvements in voltage profiles.

The study explored how family care is developed and maintained in families in cases where more than one family member is involved in care. A total of 43 family carers in Austria participated in this qualitative study. Family care is a process of ongoing communication, in which responsibilities, coordination and conditions are negotiated among the family members involved. Three distinct care network types emerged from the data, which differ in terms of the individual perception of roles and responsibilities, and the distribution of care. Responsibilities for one another, awareness of being a family carer and the availability of resources are preconditions for the composition of these networks.

Walking speed (WS) is an easily assessable and interpretable functional outcome measure with great utility for the physical therapist providing care to older adults. Since WS was proposed as the sixth vital sign, research into its interpretation and use has flourished. The purpose of this scoping review is to identify the current prognostic value of WS for the older adult. A scoping review was conducted using PubMed, CINAHL, and SPORTDiscus to find relevant articles highlighting the predictive capabilities of WS for older adults. Titles and abstracts were reviewed to identify relevant articles. Articles were excluded based on the following criteria: sample included both younger and older adults without separate analyses, sample was focused on a particular disease, if the study was published before 2017, or if the study did not report relevant cut points for interpretation of WS. The search returned 1064 results. Following removal of articles not meeting inclusion criteria and critical appraisal, relevant cut points were extracted from 47 original research publications. A preliminary review of the included articles showed that WS is a valuable prognostic tool across many health domains, including mental health, mortality, disability, pain, bone and joint health, falls, cognition, physical activity, metabolic health, risk for cardiovascular disease, socialization, and metabolic health. The fastest WS of 1.32 meters per second (m/s) served as a cutoff for decreased risk for incident development of type 2 diabetes, while the slowest WS of less than 0.2 m/s was associated with increased duration of hospitalization. Multiple studies reported on the prognostic value of WS slower than 1.0 m/s. Although the reported range of predictive WS values was broad, multiple studies found WS of approximately 1.0 m/s to be a useful marker for delineating risk or decline across a variety of health domains. Clinicians may find it useful to use a WS slower than 1.0 m/s as a "yellow flag" to guide evaluation and intervention for their older adult clients.

In recent years, psychological research has faced a credibility crisis, and open data are often regarded as an important step toward a more reproducible psychological science. However, privacy concerns are among the main reasons that prevent data sharing. Synthetic data procedures, which are based on the multiple imputation (MI) approach to missing data, can be used to replace sensitive data with simulated values, which can be analyzed in place of the original data. One crucial requirement of this approach is that the synthesis model is correctly specified. In this article, we investigated the statistical properties of synthetic data with a particular emphasis on the reproducibility of statistical results. To this end, we compared conventional approaches to synthetic data based on MI with a data-augmented approach (DA-MI) that attempts to combine the advantages of masking methods and synthetic data, thus making the procedure more robust to misspecification. In multiple simulation studies, we found that the good properties of the MI approach strongly depend on the correct specification of the synthesis model, whereas the DA-MI approach can provide useful results even under various types of misspecification. This suggests that the DA-MI approach to synthetic data can provide an important tool that can be used to facilitate data sharing and improve reproducibility in psychological research. In a working example, we also demonstrate the implementation of these approaches in widely available software, and we provide recommendations for practice. (PsycInfo Database Record (c) 2024 APA, all rights reserved).

We have carried out methods of study to find the correlation between charged particle multiplicity and collision centrality of Au+Au collisions at SNN = 200 GeV. We have studied the open data from the ALICE experiment and arrived at the conclusion that central collisions produced a greater number of charged particles than peripheral collisions. This is done by reconstructing the three silicon layers inside the inner tracking system of the detector and studying the change in two spatial variables between layers: pseudorapidity with range || < 1 and azimuthal angle with acceptance , which can then be input into the sideband method to find the final multiplicity of each event. The study provides an insight into the transient nature of the Quark Gluon Plasma (QGP) produced in collisions by exploring how collision aftermaths vary with different conditions of the partons, which hopefully adds to the understanding of matter under the strong force at extreme energy density.

This study examined the human resource management challenges faced by heads of departments in managing a multigenerational academic workforce in the South African higher education sector. A qualitative research approach was followed, and a multiple case study research design was applied. A purposive sampling technique was used to select 16 participants. Data was collected through semi-structured interviews, and it was analysed thematically with the aid of Atlas.ti. The study revealed several challenges related to the management of a multigenerational academic workforce, namely, differences in career expectations, skills, and experience among generations; conflict management; implementation of plans and strategies; succession planning; and teamwork. The findings have implications for higher education institutions as different generations have varying expectations for career development. Human resource departments should establish clear and transparent career pathways to meet these expectations. The study also provides supporting evidence for the dimensions outlined in the framework for understanding generational identities in organisations. Exploring generational diversity in workplace relationships and interactions within the education context complements the existing research focused on pedagogical aspects and cultural characteristics in academic settings.

El presente estudio utiliza los datos de la última versión de la Encuesta Nacional de Hogares (Enaho) —una encuesta anual y representativa de la población de Perú— para determinar en qué medida la composición y estructura familiar puede predecir o evitar que los miembros del hogar sobrepasen la línea de pobreza. Los resultados obtenidos, a través de un modelo de regresión logística, indican que las familias constituidas por padres que mantienen una unión libre o convivencia con hijos menores de edad, los hogares con número extenso de miembros y la mala calidad de empleo del jefe de familia son aspectos que incrementan la posibilidad de que el hogar sea pobre. Por otro lado, las variables consideradas y relacionadas a menores probabilidades de escenarios de pobreza son: contar con dos o más perceptores de ingresos en el hogar, vivir en un área urbana, tener un mejor grado de instrucción, tenencia de activos y la jefatura femenina del hogar; todos ellos aspectos que tienen la capacidad de mitigar los efectos de la pobreza