Mottled Pattern Research Articles

Revisiting the hormonal control of sexual dimorphism in chicken feathers

Sexual dimorphism in plumage is widespread among avian species. In chickens, adult females exhibit countershading, characterized by dull-colored round feathers lacking fringe on the saddle, while adult males display vibrant plumage with deeply fringed bright feathers. This dimorphism is estrogen-dependent, and administering estrogen to males transforms their showy plumage into cryptic female-like plumage. Extensive studies have shown that estrogen’s role in female plumage formation requires thyroid hormone; however, the precise mechanisms of their interaction remain unclear. In this study, we investigated the roles of estrogen and thyroid hormone in creating sexual dimorphism in the structure and coloration of saddle feathers by administering each hormone to adult males and observing the resulting changes in regenerated feathers induced by plucking. RT-PCR analysis revealed that the expression of type 3 deiodinase (DIO3), responsible for thyroid hormone inactivation, correlates with fringing. Estrogen suppressed DIO3 and agouti signaling protein (ASIP) expression while stimulating BlSK1, a marker of barbule cells, resulting in female-like feathers with mottled patterns and lacking fringes. Administration of thyroxine (T4) stimulated BlSK1 and proopiomelanocortin (POMC) expression, with no effect on ASIP, leading to the formation of solid black feathers lacking fringes. Triiodothyronine (T3) significantly increased POMC expression in pulp cells in culture. Taken together, these findings suggest that estrogen promotes the formation of solid vanes by suppressing DIO3 expression, while also inducing the formation of mottled patterns through inhibition of ASIP expression and indirect stimulation of melanocortin expression via changes in local T3 concentration. This is the first report describing molecular mechanism underlying hormonal crosstalk in creating sexual dimorphism in feathers.

Evaluation of three different DNA extraction methods for the detection of Pepper yellow leaf curl virus (PepYLCV) by Polymerase Chain Reaction

Abstract Pepper yellow leaf curl virus (PepYLCV) from the genus Begomovirus infecting Chili pepper plant can cause significant yield losses. PepYLCV infection can lead the development of mosaic yellow, mottled pattern and yellowing leaves, which can be challenging in disease management and control. Developing effective detection methods for PepYLCV is a critical disease management and crop loss mitigation. The Begomovirus viruses have extremely low viral concentrations and are limited to the phloem and vascular system. DNA extraction is an important step in PepYLCV detection. This study aimed to evaluate the efficiency of three DNA extraction methods: phenol-based extraction, CTAB-based extraction, and the GeneJET Plant Genomic DNA Purification Kit (Thermo Scientific™). These methods were evaluated for their performance to identified the presence of PepYLCV DNA and provide accurate results for further analyses. DNA samples were extracted from two varieties including Red Habanero and F8 012328-6-2-1-1-3-1, and were subsequently amplified using Krusty Homer’s primers. The results showed that all three extraction methods possess the capability to identify PepYLCV. Based on the results, DNA extraction employing the CTAB-based method yields DNA with higher concentration and purity levels. Additionally, this method proves to be cost-effective and proficient in generating higher DNA concentrations.

Visualization of Recrystallization Induced by Ultraviolet Degradation of a Polypropylene Film Using Raman Imaging.

Raman images were constructed for polypropylene (PP) films before and after ultraviolet (UV) irradiation (100 mW, 248-436 nm) for 10 h using several intensity ratios of Raman bands that are sensitive to crystallization of PP. In the images of PP films before the irradiation the intensity ratios are nearly uniform for the films but for those of the PP films after the irradiation, the ratios become large with a mottled pattern, indicating that recrystallization occurs in the PP films upon the irradiation of the UV light. The UV-irradiated PP films show worm-like shaped structures in few micrometer order representing the recrystallization of PP. The temperature gradient of PP is low (273 K), and thus, it is very likely that due to UV energy and polymer fragmentation, PP molecules become more mobile and some parts of molecular chains in amorphous parts of PP molecules lead to their rearrangement and recrystallization. In this study, we demonstrate that Raman imaging clearly detects subtle changes in the crystallinity with a micrometer order structure which morphological images cannot observe.

Dermoscopic Features of Cutaneous Vasculitis.

Dermoscopy has become widespread in the diagnosis of inflammatory skin diseases. Cutaneous vasculitis (CV) is characterized by inflammation of vessels, and a rapid and reliable technique is required for the diagnosis. We aimed to define CV dermoscopic features and increase the diagnostic accuracy of dermoscopy with machine learning (ML) methods. Eighty-nine patients with clinically suspected CV were included in the study. Dermoscopic images were obtained before biopsy using a polarized dermoscopy. Dermoscopic images were independently evaluated, and interobserver variability was calculated. Decision Tree, Random Forest, and K-Nearest Neighbors were used as ML classification models. The histopathological diagnosis of 58 patients was CV. Three patterns were observed: homogeneous pattern, mottled pattern, and meshy pattern. There was a significant difference in background color between the CV and non-CV groups (P = 0.001). The milky red and livedoid background color were specific markers in the differential diagnosis of CV (sensitivity 56.7%, specificity 96.3%, sensitivity 29.4%, specificity 99.2%, respectively). Red blotches were significantly more common in CV lesions (P = 0.038). Red dots, comma vessels, and scales were more common in the non-CV group (P = 0.002, P = 0.002, P = 0.003, respectively). Interobserver agreement was very good for both pattern (κ = 0.869) and background color analysis (κ = 0.846) (P < 0.001). According to ML classifiers, the background color and lack of scales were the most significant dermoscopic aspects of CV. Dermoscopy may guide as a rapid and reliable technique in CV diagnosis. High accuracy rates obtained with ML methods may increase the success of dermoscopy.

Nb-Ta-Sn Oxides from Lithium-Beryllium-Tantalum Pegmatite Deposits of the Kolmozero–Voronja Belt, NW Russia: Implications for Tracing Ore-Forming Processes and Mineralization Signatures

In this paper we present textural and compositional data for columbite group minerals (CGMs) and associated Nb-Ta-Sn oxides from lithium-beryllium-tantalum pegmatite deposits of the Kolmozero–Voronja belt, NW Russia, with the aim of deciphering these characteristics for minerals from deposits with different mineral signatures and lithium ore grade. Minerals from four deposits, including two of world-class (Kolmozero and Polmostundra), are examined. The main controlling factors for CGM compositional ranges are the diversity and rate of magmatic fractionation, hydrothermal overprint and mineral paragenesis, following the specific geochemical signature of the different pegmatite deposits. CGM from Kolmozero include several mineral species (columbite-(Fe), columbite-(Mn), tantalite-(Fe), and tantalite-(Mn)), showing large compositional variations, mainly controlled by Nb-Ta fractionation (Ta/(Ta + Nb) = 0.16–0.70; Mn/(Mn + Fe) = 0.45–0.63). Textural patterns are various (oscillatory, homogeneous, and patchy); spongy domains and overgrowing Ta-rich rims are also observed somewhere. This indicates the involvement of numerous magmatic and hydrothermal processes. The Polmostundra CGMs are represented by columbite-(Fe) with Ta/(Ta + Nb), ranging from 0.05 to 0.39; some crystals are homogenous, and others present normal, oscillatory, mottled and reverse-zoning patterns. The Okhmylk CGMs are irregular normal, patchy and homogeneous columbite-(Fe) and columbite-(Mn), with Ta/(Ta + Nb) = 0.09–0.24 and Mn/(Mn + Fe) = 0.29–0.92, indicating the suppressed magmatic fractionation and iron drop due to precipitation of Fe minerals. Columbite-(Fe) and columbite-(Mn) from the Be-Ta Shongui deposit are less evolved, with Ta/(Ta + Nb) = 0.07–0.23 and Mn/(Mn + Fe) = 0.31–0.55. The minerals are characterized by progressive normal, oscillatory, homogeneous and irregular reverse patterns. Associated pyrochlore minerals occur both as early magmatic (Kolmozero) and late hydrothermal (Polmostundra, Okhmylk). Cassiterite is found only in the Okhmylk dykes, and is apparently of hydrothermal origin. CGM from Li pegmatites have impurities of Ti (0.01–0.05 apfu) and W (up to 0.02 apfu), whereas CGM from Be pegmatites contains elevated Ti (up to 0.09 apfu). The mineral system analysis presented here is relevant for exploration.

A conditional inference tree model for predicting cancer risk of non-mass lesions detected on breast ultrasound.

To generate and validate a prediction model based on imaging features for cancer risk of non-mass lesions (NMLs) detected on breast ultrasound (US). In this single-center study, consecutive women with 503 NMLs detected on breast US between 2012 and 2019 were retrospectively identified. The lesions were randomly assigned to the training or testing dataset with a 70/30 split. Age, symptoms, lesion size, and US features were collected. Multivariate analyses were employed to identify risk factors associated with malignancy. The predictive model was developed by using conditional inference trees (CTREE). There were 498 patients (50.9 ± 13.29years; range, 22-88years) with 503 NMLs with histopathologic results or > 2-year follow-up, including 224 (44.5%) benign and 279 (55.5%) malignant lesions. At multivariate analysis, age (odds ratio (OR) = 1.08, 95% confidence interval (CI), 1.06-1.11, p < 0.001), NMLs with focal mass effect (OR = 3.03, 95% CI, 1.59-5.81, p = 0.001), indistinct glandular-fat interface (GFI) (OR = 4.23, 95% CI, 2.31-7.73, p < 0.001), geographic (OR = 3.47, 95% CI, 1.20-10.8, p = 0.022) and mottled (OR = 3.67, 95% CI, 1.32-10.21, p = 0.013) patterns, and calcifications (OR = 2.15, 95% CI, 1.16-4.01, p = 0.016) were associated with malignancy. The GFI status, architectural patterns, general morphology, and calcifications were consistently identified as the strongest US predictors of malignancy using CTREE analysis. Based on these factors, individuals were stratified into six risk groups. The predictive model showed an area under the curve of 0.797 in the testing dataset. The CTREE model efficiently aids in interpreting and managing ultrasound-detected breast NMLs, overcoming BI-RADS limitations by refining cancer risk stratification. The CTREE model allows for the reclassification of BI-RADS categories into subgroups with varying malignancy probabilities, thus providing a valuable enhancement to the BI-RADS assessment for the diagnosis of ultrasound-detected NMLs, with the potential to minimize unnecessary biopsies. • The indistinct glandular-fat interface (GFI) status, NML with focal mass effect, geographic or mottled patterns, and calcifications are the strongest imaging predictors of malignant non-mass lesions (NMLs) detected on breast US. • A practical system has been created to categorize NMLs found in breast US; each classification is associated with a degree of diagnostic certainty. • The model may contribute to patient stratification by determining the relative likelihood of malignancy and thus support clinical decision-making and evidence-based management.

Colour change and colour phases in Lethrinidae with insights into ecology.

Colour change is used by a wide range of animals. It is used for intra- and interspecific communication and crypsis, and can occur on morphological and physiological levels. Bony fish employ rapid physiological colour change and display various types of patterns and colouration (colour phases) useful for aposematic and cryptic purposes. Using an existing database of benthic stereo-baited remote underwater video systems from two locations in Western Australia, we tested whether the frequency of colour phases of emperors, Lethrinidae, varied by species. We described colour phases and rapid physiological colour change in 16 species of lethrinids, and related occurrences of colour change to feeding activity and life stages. Dark and light colour phases were observed in nine of the 16 evaluated species of which seven also displayed physiological colour change. Frequency of colour phases varied between species, suggesting that the display of different dark patterns may be especially important for certain species. Both juveniles and adults showed the ability to change between different colour patterns. The change into a mottled pattern mainly occurred while feeding or when approaching to feed, suggesting that it may be triggered by feeding and the associated decrease in environmental awareness. Colour change is a commonly observed strategy in lethrinids and may have evolved as an adaptation for increased foraging success or to reduce aggression from conspecifics. Physiological colour change allows lethrinids to quickly adapt to various cues from the environment and can therefore be considered a versatile physiological mechanism in this family.

Correlation Between Fundus Autofluorescence Pattern and Retinal Function on Microperimetry in Choroideremia.

In patients with choroideremia, it is not known how smooth and mottled patterns on short-wavelength fundus autofluorescence (AF) imaging relate to retinal function. A retrospective case-note review was undertaken on 190 patients with choroideremia at two specialist centers for retinal genetics. Twenty patients with both smooth and mottled zones on short-wavelength AF imaging and concurrent mesopic microperimetry assessments were included. Mean retinal sensitivities within the smooth and mottled zones were compared between choroideremia patients, and identical points on mesopic microperimetry collected from 12 age-matched controls. Longitudinal analyses were undertaken at 2 and 5years in a subset of patients. In patients with choroideremia, mean retinal sensitivities at baseline were significantly greater in the smooth zone (26.1 ± 2.0 dB) versus the mottled zone (20.5 ± 4.2 dB) (P < 0.0001). Mean retinal sensitivities at baseline were similar in the smooth zone between choroideremia patients and controls (P = 0.054) but significantly impaired in the mottled zone in choroideremia compared to controls (P < 0.0001). The rate of decline in total sensitivity over 5 years was not significant in either the smooth or mottled zone in a small subset of choroideremia patients (n = 7; P = 0.344). In choroideremia, retinal sensitivity as determined by microperimetry correlates with patterns on AF imaging: retinal function in the smooth zone, where the retinal pigment epithelium is anatomically preserved, is similar to controls, but retinal sensitivity in the mottled zone is impaired. Patterns on AF imaging may represent a novel, objective outcome measure for clinical trials in choroideremia as a surrogate for retinal function.

New localities and sexual dichromatism in Blue-green eyed Spotted Cuscus Spilocuscus wilsoni Helgen et Flannery, 2004 (Mammalia: Marsupialia: Phalangeridae) from Biak Island, Indonesia

Spotted cuscuses are medium-sized tree-dwelling mammals native to tropical forests of Australo-Papua that primarily feed on fruits and leaves. They belong to the phalangerid genus Spilocuscus (Gray, 1862). The difference in pelage color between male and female Spilocuscus wilsoni has not yet been well described morphologically. In the present study, we describe the coat color of four S. wilsoni individuals: a male adult, a sub-adult male, a sub-adult female, and a juvenile female. Dorsal, lateral, and ventral body section images were captured on camera, and body weight &amp; length, tail &amp; ear length were measured. The adult male S. wilsoni had brown spot and blotch patterns on the dorsal and lateral regions, and the ventral region was plain beige. The sub-adult male had distinct spot patterns without blotches on the dorsal and lateral regions, while the ventral region was plain with a cream base color. The sub-adult female had a mottled pattern that blended with the base color, making a silvery appearance. The female juvenile was spotless throughout, with a foundation hue ranging from creamy to somewhat yellow.

Dynamic optical coherence tomography of chronic venous ulcers.

Chronic ulcers, especially venous leg ulcers, are a major burden on the healthcare system. To date there are only few non-invasive established procedures for evaluation of blood perfusion in wounds. Dynamic optical coherence tomography (D-OCT) provides images of the skin's superficial vascularisation. This study aims to investigate if and how the D-OCT measurement of chronic wounds can provide new information about the vascularisation during the healing process. We examined 16 venous ulcers over 16 weeks and evaluated the vessel morphology and density using D-OCT at the wound bed, borders, two centimetres adjacent to the wound und at non-ulcerated skin on the contralateral leg. In D-OCT scans clumps were unique and the most common vessel type in the wound area of venous ulcers, whereas lines and serpiginous vessels were the most common in non-ulcerated skin. At the wound border mottle and cluster patterns occurred more frequently. Healthy skin showed a significant increase of mesh pattern. Vessel density significantly increased at the wound area compared to non-ulcerated skin. During the healing process the wound border showed the most vascular changes while only an increase in curves was observed in the wound centre. Non-healing wounds had fewer dots and blobs at the borders, fewer dots, coils, clumps, lines and serpiginous vessels at the centre and fewer dots in adjacent skin. Temperature analysis showed higher temperatures in non-ulcerated skin, followed by the wound margin and centre. Non-healing wounds showed the lowest temperatures in the wound centre. These results highlight the non-invasive use of D-OCT for the examination and monitoring of wound healing in chronic venous ulcers. D-OCT imaging of blood vessels may offer the potential to detect disorders of wound healing at an early stage, differentiate ulcers of different genesis and to tailor more individualized, patient-oriented therapy.

Dyschromatosis universalis hereditaria.

Reticulate pigmentary dyschromatoses primarily include dyschromatosis universalis hereditaria (DUH), dyschromatosis symmetrica hereditaria (DSH) (Reticulate acropigmentation of Dohi), and unilateral dermatomal pigmentary dermatosis, which differ in their patterns of distribution. The disease was initially described by Ichikawa and Hiraga in Germany in 1933. The prevalence of DUH is 0.3 per 100,000 with a female preponderance. The skin lesions usually appear in infancy or early childhood and cease to progress beyond adolescence. The subtypes DUH 1 and DUH 3 are found to have autosomal dominant inheritance, which is the most common inheritance pattern, while DUH 2 has an autosomal recessive pattern. The most common gene involved in DUH is ABCB6, while the other genes include SASH 1, PER 3, and KITLG (DUH type 2). DUH is characterized by multiple irregular hyperpigmented macules interspersed with hypopigmented macules in a mottled pattern over the trunk and extremities. The face is involved in 50% of individuals. Rarely, it can also involve hairs, nails, mucous membranes, palms, and soles. Other varied presentations include localized forms, localization of lesions to sun-exposed areas, large macules, uniform palmar hypopigmentation, diffuse hyperpigmentation with spotty depigmented macules, and unilateral involvement. DUH has been reported to be associated with various cutaneous and systemic diseases. The authors have observed cases of DUH associated with hepatocellular carcinoma, solitary keratoacanthoma, and dermoid cyst. The various diagnostic modalities include dermoscopy, histopathology, electron microscopy, and targeted gene sequencing. Though various treatment modalities like NBUVB and lasers have been tried, no treatment is promising.

Morphological and structural analysis of iron-rich porcelains excavated from the Jian kiln site of Song dynasty.

Iron-rich porcelains generally embrace relatively high iron concentration in the glaze and body, which have an important position in the history of ancient Chinese high-temperature ceramics. The colour and lustre of glaze patterns are closely related to the orientation and order of crystallisation. In this work, three representative types of iron-rich porcelains (persimmon red-glazed sample, oil spot-glazed sample and mirror black-glazed sample) were analysed by portable energy-dispersive X-ray fluorescence (PXRF), optical coherence tomography (OCT), optical microscopy (OM), scanning electron microscopy (SEM), X-ray diffraction (XRD) and laser Raman spectroscopy (RS) to determine the morphology, chemical composition and microstructure. Results showed that layered structure was observed in both persimmon red and oil spot glazes, however with respective thickness. Besides, iron-enriched crystals mostly precipitated on glaze surface. For the persimmon red sample, multilayer microstructure consisting of three sublayers beneath glaze surface was identified. Crystals and dark red substrates were all made of ε-Fe2 O3 , implying that it was fired at a strong reducing atmosphere. But for the oil spot sample, large-scale leaf-shaped crystals were well characteristic of ε-Fe2 O3 , while small snowflake-shaped crystals were assigned to α-Fe2 O3 , indicating that the firing environment was partially reduced. In addition, there was no crystalline layer existing on surface of mirror black-glazed porcelain, and plain black glaze layer was featured by a glassy matrix. The Jian kiln is a famous ancient folk kiln in the southern China that is currently located in Jianyang county of Fujian province. Its production of black-glazed porcelain began in the Tang dynasty (618-907 AD), became prosperous in the Southern Song dynasty (1127-1279 AD), and declined and ended in the Yuan dynasty (1271-1368 AD). Black-glazed Jian tea bowls were perfect for highlighting the rich white tea decoction. The thick and lustrous black glaze of Jian bowls sometimes were featured by streaked or mottled patterns, usually recognised by 'hare's fur (HF)', 'oil spot (OS)', 'partridge spot (PS)' and so on, which were the crystalline markings of iron oxide precipitated during firing in the dragon kiln. Iron oxide acted as a colorant for black-glazed porcelain and, thus, was called as iron-rich porcelain. The unique patterns originated from local iron-enrichment raw materials and firing process, and the locally iron-enriched areas generated due to the supersaturated crystallisation of different iron oxide in the cooling period. It was generally believed that research studies on the crystallographic nature and growth mechanism of surface crystals would provide help for the manufacturing of ancient Chinese glazes. With this aim, three types of iron-rich porcelain excavated from the Jian kiln were selected to further study the forming cause and growth process of glaze patterns using a series of characterisation methods, like portable energy-dispersive X-ray fluorescence (PXRF), optical coherence tomography (OCT), optical microscopy (OM), scanning electron microscopy (SEM), X-ray diffraction (XRD) and laser Raman spectroscopy (RS).

Glyptothorax vatandousti, a new species of torrent catfish from the upper Karkheh drainage in Iran (Teleostei: Sisoridae).

Glyptothorax vatandousti, new species, from the upper Karkheh drainage, a tributary of the Iranian Tigris, is distinguished from its congeners in the Persian Gulf basin by having the flank with a fine, pale-brown mottled pattern overlaid by small and large, blackish or dark-brown blotches, deep caudal-peduncle (its depth 1.1-1.3 times in length), and without, or with a pale-brown triangle-shaped blotch in front of dorsal-fin origin.

First Report of citrus virus A infecting citrus (Citrus reticulata Blanco) in China.

Citrus is one of the most popular fruit crops in the world. Citrus virus A (CiVA, species Coguvirus eburi, genus Coguvirus) is a newly identified virus (Navarro et al. 2018) with two negative-sense single-stranded RNAs (RNA1 and RNA2). To date, CiVA has been detected on different citrus species in South Africa, U.S.A. and Greece (Bester et al. 2021; Park et al. 2021; Beris et al. 2021). CiVA has not been reported in China. In Sept. 2018, virus-like symptoms of leaf mottling, leaf flecking, and oak leaf patterns were observed on 'Orah' mandarin (Or) and 'Harumi' tangor (Ht) trees grown in Neijiang (NJ, Sichuan Province) and on Citrus reticulata cv.'Jinqiushatangju' (Jq) trees in Guizhou Province (GZ). Two mixed leaf samples (HY-NJ: 1 Or and 1 Ht and GZ-1: 2 Jq) were collected from symptomatic trees and then subjected to high-throughput sequencing (HTS). Total RNA was extracted by TRIzol. The cDNA library was constructed after depleting ribosomal RNA using a TruSeq RNA Sample Prep Kit and sequenced by Illumina HiSeq X-ten platform with paired-end reads length of 150 bp. After removing adaptors, low-quality reads, and reads homologous to citrus hosts by CLC Genomics Workbench 11 (Qiagen, U.S.A.), 917,547 and 1,508,134 clean reads were obtained from 56,239,772 and 81,535,900 total reads for HY-NJ and GZ-1, respectively. De novo assembly of the clean reads by CLC Genomics Workbench 11 resulted in 2,181 contigs for HY-NJ and 3,718 contigs for GZ-1. BLASTX searches of the contigs against local virus (taxid:10239) and viroid datasets (taxid:2559587) downloaded from NCBI allowed identification of several viruses and viroids. CiVA, citrus leaf blotch virus, citrus yellow vein clearing virus (CYVCV), and citrus psorosis virus (CPsV) were detected in HY-NJ. CiVA, hop stunt viroid, citrus viroid VI, citrus viroid V, citrus exocortis viroid, citrus dwarfing viroid, citrus bent leaf viroid, citrus bark cracking viroid, CYVCV, citrus tristeza virus, apple stem grooving virus, and CPsV were also detected in GZ-1. The lengths of the CiVA contigs were 6,682-nt and 6,670-nt matching RNA1 and 2,728-nt and 2,715-nt matching RNA2, respectively. The average coverage depth of clean reads mapped to CiVA-related contigs in HY-NJ was 64.90 and 156.54 for RNA1 and RNA2, respectively, and 26.50 and 558.08 in GZ-1. The full-length genomes of CiVA in HY-NJ and GZ-1 were determined by Sanger sequencing of six overlapping cDNA fragments obtained by RT-PCR and 5' and 3' RACE. At least 5 molecular clones were randomly selected for each fragment. The NJ isolate had a 6,690 nt RNA1 (GenBank accession no. MZ436805) and a 2,740 nt RNA2 (MZ436807). The GZ isolate had a 6,688 nt RNA1 (MZ436804) and a 2,734 nt RNA2 (MZ436806). BLASTN showed that the NJ and GZ isolates have 99.31 to 99.60% sequence identity to the isolate CG301 (MT922052; MT9220523). A phylogenetic tree constructed from nucleotide sequences indicated that the NJ and GZ isolates are closely related to the CG301 isolate. Among 105 citrus samples (35 Or and 30 Ht from NJ and 50 Jq from GZ) randomly collected, 11 samples (4 Or, 2 Ht and 5 Jq) with similar symptoms tested positive by RT-PCR using generic primers designed from conservative regions of RNA2 (F: TTGCAGTAGTGAGAAGGGAGT; R: TCAAAAGAGGCAGTGGTAGGA). To our knowledge, this is the first report of CiVA infecting citrus trees in China. The results will help facilitate further research to assess the threat of CiVA to citrus growing areas in China.

Stripes and loss of color in ball pythons (Python regius) are associated with variants affecting endothelin signaling.

Color patterns in nonavian reptiles are beautifully diverse, but little is known about the genetics and development of these patterns. Here, we investigated color patterning in pet ball pythons (Python regius), which have been bred to show color phenotypes that differ dramatically from the wildtype form. We report that several color phenotypes in pet animals are associated with putative loss-of-function variants in the gene encoding endothelin receptor EDNRB1: (1) frameshift variants in EDNRB1 are associated with conversion of the normal mottled color pattern to skin that is almost fully white, (2) missense variants affecting conserved sites of the EDNRB1 protein are associated with dorsal, longitudinal stripes, and (3) substitutions at EDNRB1 splice donors are associated with subtle changes in patterning compared to wildtype. We propose that these phenotypes are caused by loss of specialized color cells (chromatophores), with loss ranging from severe (fully white) to moderate (dorsal striping) to mild (subtle changes in patterning). Our study is the first to describe variants affecting endothelin signaling in a nonavian reptile and suggests that reductions in endothelin signaling in ball pythons can produce a variety of color phenotypes, depending on the degree of color cell loss.

Mucosal patterns change after Helicobacter pylori eradication: Evaluation using blue laser imaging in patients with atrophic gastritis.

Mucosal patterns (MPs) observed on blue laser imaging in patients with atrophic gastritis can be classified as spotty, cracked, and mottled. Furthermore, we hypothesized that the spotty pattern may change to the cracked pattern after Helicobacter pylori (H. pylori) eradication. To further substantiate and comprehensively investigate MP changes after H. pylori eradication in a larger number of patients. We included 768 patients who were diagnosed with atrophic gastritis with evaluable MP using upper gastrointestinal endoscopy at the Nishikawa Gas-trointestinal Clinic, Japan. Among them, 325 patients were H. pylori-positive, and of them, 101 patients who underwent upper gastrointestinal endoscopy before and after H. pylori eradication were evaluated for post-eradication MP changes. The patients' MPs were interpreted by three experienced endoscopists who were blinded to their clinical features. Among 76 patients with the spotty pattern before or after H. pylori eradication, the pattern disappeared or decreased in 67 patients [88.2%, 95% confidence interval (CI): 79.0%-93.6%), appeared or increased in 8 patients (10.5%, 95%CI: 5.4%-19.4%), and showed no change in 1 patient (1.3%, 95%CI: 0.2%-7.1%). In 90 patients with the cracked pattern before or after H. pylori eradication, the pattern disappeared or decreased in 7 patients (7.8%, 95%CI: 3.8%-15.2%), appeared or increased in 79 patients (87.8%, 95%CI: 79.4%-93.0%), and showed no change in 4 patients (4.4%, 95%CI: 1.7%-10.9%). In 70 patients with the mottled pattern before or after H. pylori eradication, the pattern disappeared or decreased in 28 patients (40.0%, 95%CI: 29.3%-51.7%), appeared or increased in 35 patients (50.0%, 95%CI: 38.6%-61.4%), and showed no change in 7 patients (10.0%, 95%CI: 4.9%-19.2%). After H. pylori eradication, MPs changed from spotty to cracked in most patients, which may help endoscopists easily and precisely evaluate H. pylori-related gastritis status.

Morphology and Structure Characteristics of the Rare Black-Glazed Porcelains Excavated from the Jian Kiln Site of Song Dynasty

Jian tea bowls are greatly appreciated not only due to their thick and lustrous black glazes, but also their exquisite streaked and mottled patterns. Researches on the firing process and colouring mechanism of typical hare’s fur and oil spot Jian glazes have continuously been carried out in the past decades; however, there are few reports about other scarce types of black-glazed porcelains excavated from the Jian kiln site. In this work, we report on a multi-technique analysis of the surface and cross-sectional structure, phase, morphology and chemical composition of three rare types of Jian tea bowls (tea-dust-glazed ware, grey-glazed ware and pearl-glazed ware) combining optical and spectroscopic methods such as optical coherence tomography (OCT), optical microscopy (OM), Portable energy dispersive X-ray fluorescence spectrometry (XRF), laser-Raman spectroscopy (LRS) and scanning electron microscopy coupled with an X-ray energy dispersive spectrometer (SEM-EDS). Results revealed that the tea dust glaze was one high-temperature iron-based crystalline glaze, and its glaze was characterized by a transparent glass matrix; irregular pits completely or partially filled by TiO2; and that ε-Fe2O3 and residual quartz were randomly distributed all over the surface, which produced the appearance of tea-dust. The grey-glazed porcelain was fired at a lower temperature in the dragon kiln than that of the traditional hare’s fur and oil spot samples, its glaze contained some residual quartz, and anorthite crystals showed a serried distribution along the thickness. The pearl-glazed porcelain was fired through a secondary glazing process via artificial stippling quartz powder. This work provides guidance for the firing process of three rare types of Jian wares and has not only scientific but also cultural profound significance, which reveals the features of their historical heritage.

Characterisation of deposited dust particles on Mars insight lander Instrument Context Camera (ICC) lens

The ubiquitous dust in the Martian environment plays a key role in its weather and climate: it must be taken into account in the interpretation of remote sensing data and observations, and could pose a potential risk to surface equipment and operations. In this study, we use observations retrieved by the Instrument Context Camera (ICC) onboard the InSight lander to evaluate the accumulation of dust on the camera lens and estimate the size of the deposited dust particles. Dust contamination is revealed as mottled pattern image artefacts on ICC observations. These were detected using a template matching blob detection algorithm and modelled with a first-order optical model to simulate their size and optical density as a function of the particle diameter. The results show a deep decay in the first 70 sols (LS = 295–337°, MY34) during which dust particles deposited at landing were mostly removed. The subsequent gradual decrease and stable behaviour in the number of detected particles is only interrupted by accumulation and removal periods around sols 160 (LS ∼ 23°, MY35) and 800–1100 (LS = 9–150°, MY36). The estimated particle sizes follow a similar trend, with deposited particles due to wind-driven forces (average diameter < 50 μm) being smaller than the ones deposited by other forces during landing, with particles of up to 220 μm of diameter. The results of this study provide an additional source of information for evaluating aeolian dust processes in Mars, with quantitative results on dust accumulation and removal activity, and may contribute to a better determination of dust entrainment threshold models by constraining susceptible dust particle sizes.

IRON DEFICIENCY ANEMIA AND HYPOALBUMINEMIA SECONDARY TO A RARE CASE OF RAPUNZEL SYNDROME.

Background: The term '' RAPUNZEL SYNDROME '' was coined by Vaughan and associates in 1968 for unusual manifestation of a trichobezoar in which the mass extends from the stomach and duodenum through a large portion of small intestine.Bezoars are collection of non-digestible foreign bodies such as hair that usually accumulate in gastrointestinal tract.Trichobezoar is underdiagnosed entity that has to be considered in childrens and adolescents especially females, suffering from trichotillomania(compulsion to pull hair) and trichophagia (compulsion to swallow hair) When undiagnosed, gastric bezoars may also cause severe anemia either due to malabsorption or gastrointestinal bleeding. 1)To Objectives: emphasize the presentation and focus on prompt diagnostic ndings in a case of Rapunzel syndrome. 2) To explain the need of routine biochemical investigations like S. Iron, S. Ferritin, S. Albumin, S. Globulin, Total proteins in case of Rapunzel syndrome so as prevent further complications. Methodology: A 17 year old female presented to casualty with complaints of pain in epigastric region since 4 months which was spasmodic on and off in nature and non-radiating. History of nausea and vomitings and histrory of strange behaviour noticed by guardians-plucking hair and swallowing.USG suggested hyperechoic curvilinear dense strip with acoustic shadowing.CT scan shows an intragastric well circumscribed inhomogenous mass consisting of mottled gas pattern. patient was diagnosed wit Result: h Rapunzel syndrome associated with iron deciency anemia and hypoalbuminemia. Rapunzel syndrome is a rare entity that can be com Conclusion: plicated with life threatening events.A prompt diagnosis of trichobezoar so as to prevent deciencies which may lead to complications.

PSUN275 Autoimmune Dysglycemia Syndrome (ADS) Associated with Multiple Rheumatological Conditions

Abstract Background Autoimmune dysglycemia syndrome is rare entity that can be induced by drugs or associated with rheumatic diseases. This syndrome includes the insulin autoimmune syndrome caused by anti-insulin antibodies; and type B insulin resistance syndrome caused by anti-insulin receptor antibodies. Patients may present with hyperglycemia, hypoglycemia, or both. Clinical case A 41-year-old Peruvian woman; pulmonary tuberculosis at age 14. In 2008 she presented polyarthritis, elevated ESR and CRP, she received methotrexate and deflazacort for 3 months, presenting remission and suspending medication. In 2009, she was admitted to the emergency room with seizures that resolved after intravenous administration of 33% dextrose. She was hospitalized for study, during her stay she presented episodes of fasting hypoglycemia and postprandial hyperglycemia. She reported hyporexia, weight loss, alopecia, and joint pain. On examination: she presented malar and soft palate erythema, mild pretibial edema. Laboratory tests: fasting blood glucose: 52-69mg/dl, albumin 1,6g/L; fasting insulin: 69.3uIU/mL, C-peptide: 3ng/mL; Anti-insulin antibodies: 4,7 (NV &amp;lt; 0,5), proteinuria 4,2 g/24h, ANA 1/2560 mottled pattern. Anti-cardiolipin, Anti-Sm and Anti-DNA (-). Hemoglobin: 10.6, Leukocytes: 3,160, lymphocytes: 1,540, platelets: 166,000. Renal biopsy showed membranous glomerulonephritis. The determination of antibodies against the insulin receptor is not available in Peru. With the diagnosis of autoimmune dysglycemia associated with SLE, she received prednisone 30mg/d, azathioprine 125mg/d, hydroxychloroquine 400mg/d; fractionated normocaloric diet, NPH + crystalline insulin on a correction scale, she was discharged with a progressive decrease in NPH insulin and metformin 850mg bid. Her glucose levels stabilized, control of proteinuria and joint symptoms was achieved with azathioprine, hydroxychloroquine, prednisone 10mg. The patient remained asymptomatic with rheumatological treatment, she suspended metformin and endocrinological follow-up in 2011. In 2013 she presented recurrent episodes of Raynaud's phenomenon and symptoms of proximal muscle weakness, crusted ulcers on the pads of the fingers of both hands, malar rash and exanthema in heliotrope. Laboratory tests: CPK: 8347U/L. Electromyogram: Spontaneous activity with polyphasic short small motor unit potential and early recruitment. Muscle biopsy showed perifascicular atrophy, perivascular and perimysial inflammatory infiltrate with CD4+ T lymphocytes and B lymphocytes. Glucose, insulin, C3, and C4 levels were normal, and anti-insulin antibodies (-). The diagnosis of dermatomyositis was established. She received prednisone 60mg, hydroxychloroquine, methotrexate 10mg, and nifedipine. In August 2020, telemedicine care in endocrinology and rheumatology concluded that there were no episodes of hypoglycemia, glucose: 86 mg/dl, insulin: 12uIU/ml; anti-insulin antibodies (-); CPK levels 136IU/L, C3, C4 normal, no proteinuria and anti ds-DNA (-). Conclusion Autoimmune conditions could cause dysglycemia mainly through different autoantibodies which may cause hyperglycemia and in rare cases hypoglycemia. This case report emphasizes the importance of long-term follow-up in patients with autoimmune conditions including SLE and ADS. Many of these patients are prompt to develope a new autoimmune disease over time. Presentation: Sunday, June 12, 2022 12:30 p.m. - 2:30 p.m.