Molecular Identification Of Bacteria Research Articles

Molecular identification of bacteria (Klebsiella aerogenes, PP335235) isolated from street food (Fried Rice); study of its antibiotic sensitivity pattern and probiotic fortification of fruit juice (Fragaria ananassa, Passiflora ligularis and Phyllanthus e

Street food is an integral part of India's culinary culture, offering patrons a wide range of affordable options. However, concerns about the public's health risks associated with street food consumption persist due to inadequate infrastructure and the transient nature of street vendors. Contaminated street food can lead to foodborne illnesses such as gastroenteritis, typhoid fever, pneumonia, food poisoning, and hepatitis A. Probiotics, which are beneficial bacteria, are potentially effective by targeting specific infections. Probiotic-enriched fruit drinks present an innovative approach to improving population nutrition and probiotic provision. Lactobacillus gasseri is a gram-positive bacterium that has been demonstrated to be a promising strain of probiotic due to its resistance to acidity and beneficial effects on gut health. Alginate encapsulation improves the stability and release of probiotic strain. Probiotic fruit juices can be made from fruits that are rich in antioxidants and nutrients, such as Passiflora ligularis, Fragaria ananassa, and Phyllanthus emblica. The aim of this study was to use molecular methods to discover Klebsiella aerogenes (PP335235) isolated from street foods. The study also sought to determine the isolate's pattern of antibiotic sensitivity and explore the potential of fortifying fruit juice with Lactobacillus gasseri as a probiotic nutraceutical therapeutic strategy.

Molecular identification of endosymbiotic bacteria associated with Ferrisia virgata (Homoptera: Coccoidea: Pseudococcidae) infesting cassava (Manihot esculenta)

Aim: To identify the mealy bug samples collected from cassava plants and identification of endosymbiotic bacteria associated with the mealy bugs Methodology: Molecular identification of mealy bugs was done using mitochondrial c y t o c h r o m e o x i d a s e ( C O X - 1 ) C 1 - J - 2 1 8 3 F(CAACATTTATTTTGATTTTTTGG) and CI-N-2568R (GCWACWACRTAATAKGTATCATG) primers. The molecular identification of bacteria was done using 16S rRNA gene universal primers Results: The mealy bug was identified as F. virgata and the endosymbionts associated with mealy bugs were identified as Lysinibacillus fusiformis and Bacillus cereus. Interpretation: The endosymbionts associated with the mealy bugs play significant role in completing lifecycle of insects host and for providing nutrients to the host insects. Key words: Cassava, Endosymbionts, Ferissia virgata, Mealybug

Screening of Poly(3-Hydroxybutyrate) P(3HB) Producing Bacteria from Mackerel Fish (Rastrelliger sp.)

Bioplastic P(3HB) is a plastic that can be decomposed by decomposing microorganisms. Bacteria can produce P(3HB) in conditions of low nutrition and high carbon sources accumulated in cells as energy reserves. Isolation of bacteria-producing bioplastic P(3HB) was carried out in mackerel fish's gills and intestines, allowing direct contact with polluted waters. This research aimed to determine the presence of P(3HB) bioplastic-producing bacteria in mackerel fish samples and to screen for P(3HB) bioplastic-producing bacteria. The stages of the research were the isolation of P(3HB) producing bacteria from the gills and intestines of mackerel fish, screening of P(3HB) bioplastic-producing bacteria by using Nile Blue A staining, and molecular identification of bioplastic-producing bacteria using 16S rRNA gene. The results of bacterial isolation in the gills and intestines of mackerel obtained 10 bacterial isolates. P(3HB) screening found 1 bacterium showing orange fluorescence, namely IKE-1 isolate which was isolated from the gills of mackerel fish and included in the Gram-negative group with a monobacilli cell shape. Molecular identification of bacteria by using the 16S rRNA gene that isolate IKE-1 is Enterobacter roggenkampii. These results indicate that Enterobacter roggenkampii can produce P(3HB) which was confirmed by the screening results

Characterization and molecular identification of bacteria from mackerel bekasam in Sorong City, Southwest Papua Province, Indonesia

Abstract. Sukmawati S, Ratna R, Sipriyadi, Yunita M. 2023. Characterization and molecular identification of bacteria from mackerel bekasam in Sorong City, Southwest Papua Province, Indonesia. Biodiversitas 24: 4967-4977. Bekasam is traditional food type produced by traditional fermented fish. Microbes that grow through fermentation play an important role in forming the product’s aroma, texture, and overall quality. The study aimed to determine the biochemical characteristic of bacteria from mackerel (Scomberomorus sp.) bekasam in Sorong City and identify bacteria at the molecular level. This research was a descriptive study, which described the results of the characterization of bacteria from fermented mackerel fish and the results of molecular identification to the species level through the PCR (Polymerase Chain Reaction) technique. Then, the DNA sequences were further analyzed using the agarose gel electrophoretic separation method to visualize the bacterial DNA profile. The biochemical characterization of bacterial isolates from mackerel showed that all isolates were negative indole, and eight isolates were positive in reducing nitrate. In comparison, four isolates were negative in reducing nitrate, then all isolates had proteolytic activity except the FST 3.1 and FST 3.2 isolates. Eleven isolates were positive in hydrolyzing fat, and one isolate could not hydrolyze fat. According to the DNA patterns seen in electrophoresis and alignment of the 16 sRNA gene sequences, several types of bacteria had been identified as Bacillus paramycoides strain 2883 FST 1.1, Bacillus paramycoides strain 3665 FST 2.1, Bacillus mobilis strain ICA-144 FST 3.1, Bacillus cereus strain ATCC 14579 FNT 1.1, Bacillus mobilis strain ICA-144 FNT 2.1, and Bacillus cereus strain ATCC 14579 FNT 3.1.

Studi Komunitas Bakteri Hidrolitik Saluran Pencernaan Ikan Nilem (Osteochilus vittatus) yang Dibudidayakan Di Kabupaten Banyumas

Hydrolytic bacteria are bacteria that play an important role in helping the digestive process of fish. This study aims to determine the hydrolytic activity of bacteria in the digestive tract of Nilem fish seen from amylolytic, proteolytic, lipolytic and cellulitic indices. The method used is exploratory and data analysis using parametric and non-parametric to explain the research data. Exploration carried out in this study included the total number of bacteria, proportion of hydrolytic bacteria, activity index of hydrolytic bacteria and molecular identification of bacteria with the best activity index. Fish were taken at random from fish farming ponds in Beji and Singasari with three fish each. The number of bacteria found an increasing pattern to the posterior intestine of fish from Beji and a pattern that varied between parts of the intestine of fish from Singasari. Hydrolytic bacteria were isolated from each part of the intestine from both locations which showed a decreasing pattern in each type of hydrolytic and intestinal tracts of fish from Singasari and varied patterns in the intestines of fish from Beji. The hydrolytic activity index showed a stable average value in each part of the intestine and the sampling location. Based on the best activity index, seven isolates were identified from three different genera, namely 1) Bacillus subtilis, 2) Enterobacter mori, Enterobacter cloacae, and 3) Aeromonas hydrophila (3), Aeromonas veronii. The bacteria obtained are classified as non-pathogenic bacteria that have potential in the field of aquaculture and normal pathogenic bacteria in the fish intestine

The threat of foodborne disease from raw seafood: isolation and molecular identification of bacteria from the gut of Portunus pelagicus

Portunus pelagicus is a marine commodity that is in great demand by consumers, especially coastal communities. Portunus pelagicus habitat in the sea allows contamination from microorganisms and marine waste. Proper cleaning and processing of Portunus pelagicus can cause foodborne disease. One part of Portunus pelagicus that contains a lot of contaminants is the gut. The process of isolation and molecular identification of bacteria from the gut of Portunus pelagicus is important. Portunus pelagicus samples that have been taken from the gut and extracted. Portunus pelagicus gut extract was put in NA media and continued into BAP media. Pure bacterial cultures were isolated using CIAA phenol DNA method and amplified using 16S rRNA followed by sequencing. Four bacterial isolates were obtained from the gut of Portunus pelagicus, namely PorTRJ6, PorTRJ8, PorTRJ9, PorTRJ10. PorTRJ6 are β-hemolytic bacteria and PorTRJ8, PorTRJ9, PorTRJ10 are α-hemolytic bacteria. Based on the results of sequencing the bacterial isolates had similarity with Vibrio parahaemolyticus, Uncultured bacterium clone RS-E27, Staphylococcus haemolyticus, Staphylococcus sp. Some bacteria found in the gut of Portunus pelagicus can cause foodborne disease. Portunus pelagicus is a high-protein seafood that can be toxic if it is not processed cleanly and properly.

Bacterial and parasite co-infection in Mexican golden trout (Oncorhynchus chrysogaster) by Aeromonas bestiarum, Aeromonas sobria, Plesiomonas shigelloides and Ichthyobodo necator

BackgroundBacterial infections are responsible of high economic losses in aquaculture. Mexican golden trout (Oncorhynchus chrysogaster) is a threatened native trout species that has been introduced in aquaculture both for species conservation and breeding for production and for which no studies of bacterial infections have been reported.Case presentationFish from juvenile stages of Mexican golden trout showed an infectious outbreak in a farm in co-culture with rainbow trout (Oncorhynchus mykiss), showing external puntiform red lesions around the mouth and caudal pedunculus resembling furuncles by Aeromonas spp. and causing an accumulated mortality of 91%. Isolation and molecular identification of bacteria from lesions and internal organs showed the presence of Aeromonas bestiarum, Aeromonas sobria, Plesiomonas shigelloides and Ichthyobodo necator isolated from a single individual. All bacterial isolates were resistant to amoxicillin-clavulanic acid and cefazoline. P. shigelloides was resistant to third generation β-lactamics.ConclusionsThis is the first report of coinfection by Aeromonas bestiarum, Aeromonas sobria, Plesiomonas shigelloides and Ichthyobodo necator in an individual of Mexican golden trout in co-culture with rainbow trout. Resistance to β-lactams suggests the acquisition of genetic determinants from water contamination by human- or livestock-associated activities.

Screening and Molecular Identification of Bacteria from the Midgut of Amphimallon solstitiale Larvae Exhibiting Antagonistic Activity against Bacterial Symbionts of Entomopathogenic Nematodes.

Entomopathogenic nematodes (Rhabditida: Steinernematidae and Heterorhabditidae) are a group of organisms capable of infecting larvae of insects living in soil, including representatives of the family Scarabaeidae. Their insecticidal activity is related to the presence of symbiotic bacteria Xenorhabdus spp. or Photorhabdus spp. in the alimentary tract, which are released into the insect body, leading to its death caused by bacterial toxins and septicemia. Although the antibacterial activities of symbionts of entomopathogenic nematodes have been well described, there is insufficient knowledge of the interactions between these bacteria and microorganisms that naturally inhabit the alimentary tract of insects infested by nematodes. In this study, 900 bacterial strains isolated from midgut samples of Amphimallon solstitiale larvae were tested for their antagonistic activity against the selected five Xenorhabdus and Photorhabdus species. Cross-streak tests showed significant antibacterial activity of 20 isolates. These bacteria were identified as Bacillus [Brevibacterium] frigoritolerans, Bacillus toyonensis, Bacillus wiedmannii, Chryseobacterium lathyri, Chryseobacterium sp., Citrobacter murliniae, Enterococcus malodoratus, Paenibacillus sp., Serratia marcescens and Serratia sp. Since some representatives of the intestinal microbiota of A. solstitiale are able to inhibit the growth of Xenorhabdus and Photorhrhabdus bacteria in vitro, it can be assumed that this type of bacterial interaction may occur at certain stages of insect infection by Steinernema or Heterorhabditis nematodes.

Quality assessment and molecular identification of bacteria across the black tiger shrimp (Penaeus monodon) supply chains in Southern Bangladesh

Black Tiger Shrimp (Penaeus monodon) is one of the leading export commodities in Bangladesh. The industry, however, is frequently beset with quality deterioration and microbial diseases owing to various reasons. Here, we analyzed the sensory and nutritional qualities of shrimp, the total bacterial count, and molecular identification of pathogenic bacteria in samples collected from different supply chain actors (SCA), including the gher (farms), depots, wholesalers, retailers, and the processing industry in Khulna, Bangladesh. While the Sensory Quality Indices (SQI) of shrimps collected from farms, depots, and processing plants were found ‘excellent and highly acceptable’, the rating for wholesale and retail markets were ‘good and acceptable’. Nutritionally, higher protein (21.59%), lipid (1.47%), and ash (1.97%) contents were found in shrimps collected from farms than that of other SCAs. Heterotrophic bacterial count (cfu/g) differed in various SCAs: farms 3.75±0.31 (×106), depots 3.95±0.92 (×106), wholesale markets 5.03±0.35 (×106), retail markets 4.82±0.40 (×106), and the processing industry 3.78±0.25 (×106). The presence of Ralstonia spp and Pseudomonas spp, confirmed by 16S rDNA sequencing were found in different SCAs. Overall, the quality of shrimp appeared better in farms than that of other SCAs, indicating that a lack of proper hygiene, sanitation, and post-harvest handling practices could be the likely impediments for quality deterioration.

Mid-term follow-up results after implementing a new strategy for the diagnosis and management of periprosthetic joint infections

BackgroundPeriprosthetic joint infections (PJIs) represent one of the most serious complications associated with joint replacement surgeries, a complication also of modern orthopedic surgery despite the efforts that occurred in this field. Frequently PJIs lead to prolonged morbidity, increased costs and mortality.MethodsWe are conducting a single-center observational cohort ongoing study in the Academic Emergency Hospital Sibiu, Romania, study in which sonication of the retrieved and as a rapid method of bacteria detection, molecular identification of bacteria by 16S rRNA beacon-based fluorescent in situ hybridization (bbFISH) are used.ResultsA total of 61 patients were enrolled in this study. The diagnosis of aseptic loosening was established in 30 cases (49.1%) and the diagnosis of periprosthetic joint infection was established at 31 patients (50.8%). The mean follow-up period in the subgroup of patients diagnosed with periprosthetic joint infections was 36.06 ± 12.59 months (range: 1–54). The 25-months Kaplan-Meier survival rate as the end point, as a consequence of the period of enrollment and a different follow-up period for each type of surgical procedure, was 75% after debridement and implant retention, 91.7% after one-stage exchange, 92.3% after two-stage exchange, and 100% after three-stage exchange. There were no significant differences in survival percentage.ConclusionsOur study has good results similar to previously published data. We cannot recommend one strategy of managing prosthetic joint infections over the other. Definitely, there is a need for prospective randomized controlled trials.

Effect of Clove (Syzygium aromaticum) spice as microbial inhibitor of resistant bacteria and Organoleptic Quality of meat.

For centuries, spices have been utilized as flavourants, colourants and as preservatives in food. Moreover, spices possess various antimicrobial properties with massive health benefits for the treatment and management of ailments and diseases. The present study was focused on three (3) aspects; (1) isolation and molecular identification of bacteria from the meat; (2) to determine the antimicrobial activity of the spices against the pathogens; (3) to assess the organoleptic properties of the spiced meat. A total of twelve (n = 12) spices evaluated against forty (n = 40) spoilage food-borne pathogenic bacteria (Escherichia coli and Enterococci spp.). The spice extracts were tested using disk diffusion method to determine the inhibition abilities. The results show that clove and black seed cumin extract exhibited excellent antibacterial activity against most pathogenic bacteria. Clove displayed the highest inhibition zone of 18 mm against E. coli (EcFwS1). Clove extract was the most inhibitor followed by black cumin, whereas extracts of thyme and cinnamon showed weak antibacterial activities against the tested strains. The most sensitive strain to spice extracts was Enterococcus spp. (EnFmL1) and the most resistant strain being E. coli. (EcFmS1 and EcFpL1). Untreated meat showed that E. coli and Enterococcus spp. count was 4.4 * 105 ± 3.4 * 105 and 2.2 * 105 ± 3.6 * 104 cfu/mL respectively after 7 days while the single dose of clove showed 5.4 * 104 ± 4.4 * 102 cfu/mL of E. coli and 1.7 * 105 ± 4.1 * 104 cfu/mL of Enterococcus spp. The organoleptic characteristics such as colour, texture, odour, pH, shape of the single dose of clove on the meat was overall acceptable.

Polyethylene degradation by Ralstonia sp. strain SKM2 and Bacillus sp. strain SM1 isolated from land fill soil site

Low-Density Polyethylene (LDPE) is often widely used in packaging and wrapping because of its stability and durability. For decades, the plastic or synthetic polymer persists without deterioration in the soil. The aim of this analysis was to separate the bacteria from the soil of landfill and to evaluate the microbial degradation of the sheet of low-density polythene (LDPE) for 180 days. The microbial degradation was characterized by weight loss, alteration of pH in the media, Fourier Transform Infrared Spectroscopy (FTIR) and microscopic view. Molecular identification of bacteria was confirmed by phylogenetic analysis using 16SrRNA gene sequence. The bacteria were identified as Ralstonia sp. strain SKM2 and Bacillus sp. strain SM1. The weight loss in LDPE sheet by Ralstonia sp. strain SKM2 and Bacillus sp. strain SM1was 39.2%and 18.9%respectively The pH of media was reduced from 7.12 to 6.67 for Ralstonia sp. strain SKM2 bacterium and 7.12 to 7.03 for Bacillus sp. strain SM1 bacterium. Clearly noticeable structural changes such as blackness, shrinkage, cracks, pits, and roughening of LDPE sheet surface were detected by microscope. FTIR also observed changes in the carbon bonds (especially alcohol), ether and alkane groups of LDPE sheet.Thus, the Ralstonia sp. strain SKM2 and Bacillus sp. strain SM1 could be used as LDPE degrading microorganisms.

Screening and Identification of Sponge-Associated Chitinolytic Bacteria by Forming Chitosan from Manado Bay, Indonesia.

Chitosan can be produced through the enzymatic process catalyzed by chitin deacetylase which can be produced by bacteria. The biotransformation of chitin to chitosan by bacteria is interesting because the process is economical and environmentally friendly. This study described the potential of sponge-associated bacterium capability in degrading chitin and forming chitosan. The bacteria were isolated from sponge Cribrochalina sp. at Manado Bay, Indonesia. In the screening of the chitinase activity of bacteria, chitin media was used. Meanwhile, the transformation of chitin to chitosan was tested by using Chitinase Degrading Activity media. Molecular identification of bacteria was based on 16S rRNA gene sequences. The results showed that the SS1, SS2, SS3, SS4 and SS5 bacterial isolates could degrade chitin based on chitinolytic indexes. These five bacteria could also form chitosan exhibited through the presence of chitosan in the form of precipitation in the fermented broth of bacteria. SS1 had the highest chitinase activity based on the chitinolytic index identified as Bacillus subtilis (100% identity), hence it is called B. subtilis strain SS1. The partial rRNA gene sequences data were deposited at GenBank under accession number MN999892. The bacteria strain isolated from Cribrochalina sp. can be utilized in degrading chitin and form chitosan which could be a promising candidate for an economical and eco-friendly process of chitosan.

Identification of Bacteria Sample Plaque from Periodontal Disease Among Diabetic Patients

Molecular identification of bacteria are very important to develop database gene bank in university. Databases of genes are very important to annotate a collection of nucleotide sequence and protein translation of oral bacteria. This research was conducted to identify bacteria that present in the plaque sample among diabetic patients collected from the Department of Periodontology and Community Oral health Universiti Sains Islam Malaysia (USIM). A total of bacteria was successfully isolated on Blood Agar from periodontal patients’ plaques. Colony Forming Unit (CFU/mL) was calculated to estimate the number of viable bacteria in a sample after performed serial dilution. Gram stained was done for all isolated samples to differentiate between Gram positive and negative organisms. About 2.07 x 10 7 CFU/mL of bacteria was successfully collected from periodontal plaques on diabetes patient. From the numbers, only 17 were selected to identify the species. Seven from the samples were Gram-positive bacteria, meanwhile ten samples were identified as Gram-negative bacteria. PCR products were isolated from the samples by using polymerase chain reaction analysis. Purification had been done to all PCR products before sent it for sequencing. Streptococcus mutans, Streptococcus gordonii, Streptococcus oralis, Streptococcus sanguinis, Streptococcus agalactiae, Streptococcus lutetiensis, Streptococcus downei,, Aggregatibacter actinomycetemcomitans, Klebsiella pneumoniae, Enterobacter clocae, Salmonella enterica subs enterica, Enterobacter ludwigii, Enterobacter mori, Enterobacter roggen kampii, Enterobacter cloacae, Enterobacter tabaci and Klebsiella pneumoniae were identified from all samples via DNA sequencing.

Semi-continuous desulfurization of natural gas in photobioreactor by green sulfur-oxidizing bacterial consortia isolated from hot spring

Anoxygenic phototrophic bacteria are able to oxidize and remove hydrogen sulfide from natural sources by using inorganic substrates and light. In the present study, anoxygenic phototrophic bacteria were isolated from Vartoon hot spring (east of Isfahan Province, Iran) and used for removal of sulfide compounds from natural gas in a semi-continuous photobioreactor. Mat samples that obtained from the depth of spring were introduced into Winogradsky columns and kept in the presence of sunlight for 3–4 months until green and purple layers were composed. The layers were then transferred into mineral medium and incubated under anaerobic condition. The sequence of amplified 16S rDNA in green bacteria and an amplified sequence among the gene encoding photosynthetic reaction center in purple bacteria were used for molecular identification of bacteria. The bacterial growth based on the contents of bacteriochlorophylls and the extent of elemental sulfur production by the cells were measured after ethanol extraction. Molecular identification validated the presence of Chlorobium phaeobacteroides and Prosthecochloris vibrioformis from green sulfur bacteria in the consortium. The results indicated the most increase in bacteriochlorophylls c, d, and e content of mineral medium after bacterial growth. In addition, by releasing 62.4 mmol elemental sulfur, 79.30% increase was detected in sulfur content of the medium during 3 weeks. The consortium of sulfur-oxidizing phototrophic bacteria was potentially used for natural gas desulfurization in the semi-closed photobioreactor. This system is suggested as a replacement for chemoautotrophic systems in areas where there is sufficient access to sunlight.

Penapisan Bakteri Penghambat Fusarium yang Diisolasi dari Cairan Kantung Semar (Nepenthes sp.)

The genus Fusarium sp. is a pathogenic fungal for many cultivated plants. The bacteria isolated from monkey cup (Nepenthes sp.) fluid possess the ability to produce hydrolytic enzyme, such as chitinase which can be utilized to inhibit the growth of mycelia of pathogenic fungi. The aims of this study are to isolate bacteria from monkey cup liquid, to test their abilities to produce protease, chitinase, and cellulase, as well as their abilities to inhibit Fusarium. The bacteria were isolated using serial dilution method on Reasoner’s 2A agar medium. Enzymatic activities of bacterial isolates were determined by inoculating them on tested medium supplemented with casein protein, chitin, and cellulose, whereas their antifungal activities were assayed using a direct confrontation method between tested bacterial isolates and pathogenic fungal on Malt Extract Agar medium. Molecular identification of bacteria with antifungal activity was performed by analyzing the 16S rRNA gene sequences. Isolation process of bacteria from monkey cup fluid resulted in 99 bacterial isolates with the ability to produce either protease, chitinase, and/or cellulose enzymes. A total of 37 bacterial isolates were capable of producing at least two hydrolytic enzymes. Antifungal assay of those bacteria showed that as many as 25 isolates have the ability to inhibit the growth of Fusarium sp. Based on the analysis of 16S rRNA gene sequences revealed that those isolates were closely related to three Burkholderia species, namely B. arboris, B. contaminans, and B. rijonensis.
 Keywords: antifungal, Burkholderia, chitinase, cellulaseN, epenthes, protease

Molecular identification of bacteria causing grain rot disease on rice

Bacterial grain rot disease on rice plantation is a new disease in Indonesia. The disease become a big threat for formers in Indonesia because it causes high losses and no effective means of control has yet been found. This study was aimed to identify the causal agent of grain rot disease by PCR technique using specific B. glumae primers (1418S and 1418A) in 17 bacterial isolates obtained from several regions and rice varieties. Stages of the used method include extraction and amplification of DNA and continued with secuencing. The secencing result were processed using the BLAST program and compared with NCBI data for phylogenetic analysis. All isolates tested were morphological and physiological testing before. The amplification result showed that all 17 isolates tested produced DNA band in the size of ± 571 bp. These results indicated that all test isolates were classified as B.glumae. 4 of the isolates that had their DNA bases sequenced were then confirmed in the BLAST program from NCBI with results that showed that B.glumae isolates were found to have values homology 98-99% with Burkholderia glumae LMG 2196 = ATCC 33617 in Genebank.

Studies of Bacillus subtilis NAP1 to degrade BOD, COD, TSS, and pH: The indigenous bacteria in Indonesia batik wastewater

Batik is an industry that is quite popular in Indonesia. Batik has been declared as one of Indonesia’s cultural heritage and is recognized by UNESCO. Batik production is recorded to always increase every year. Unfortunately, the batik industry in Indonesia is dominated by many small industries with limited fund management. This makes the environmental aspects and waste disposal neglected. Through this research, study and isolation were carried out to explore the potential of indigenous bacterial isolates that can biodegrade dyes in batik along with other physical parameters of waste. A sample that contained wastewater and sediment from batik industry are collected and cultured in 1000 ml Busnall Hass medium which olive oil-enriched and put at the shaker condition at 150 rpm until 6 days at 30°C. Identification of the isolates examined for their morphological, physiological and biochemistry test. Bacillus subtilis is one of the indigenous isolates from this research. This study aimed to determine the ability of B. subtilis to reduce BOD, COD, TSS, and pH in batik waste and present the results of the DNA analysis of B. subtilis. Based on the research that has been done, it can be concluded that the molecular identification of bacteria through analysis of the 16S rDNA gene fragment sequence, the bacteria that play a role in the degradation of dyes is Bacillus subtilis strain NAP1 with an average similarity level of 93%. B. subtilis NAP1. B. subtilis NAP1 isolate offers the potential for future bioremediation of batik wastewater.

The prevalence of Campylobacter species in broiler flocks and their environment: assessing the efficiency of chitosan/zinc oxide nanocomposite for adopting control strategy.

There is a growing trend to implement biosecurity measures in small commercial broiler flocks and trying to replace ineffective antimicrobial with alternative materials to interevent a strategy for the control of Campylobacter bacteria in these farms. This study was designed to determine the prevalence rate of Campylobacter spp. in broiler flocks and their environment. Thereafter, assess the efficiency of chitosan, zinc oxide nanoparticles (ZnO NPs), and chitosan/ZnO NPs composite against Campylobacter strains to adopt a novel control strategy based on the ability to use those nanocomposites. A total of 220 samples were collected from broiler flocks, their environment, and farm attendants that direct contact with birds. All samples were subjected to microbiological investigation for isolation, then molecular identification of bacteria using PCR. ZnO NPs and chitosan/ZnO NPs composite were synthesized then characterized by transmission electron microscopy (TEM), scanning electron microscopy (SEM), Fourier-transform infrared spectrum (FT-IR), and X-ray diffraction (X-RD). The efficiency of testing compounds was examined against 30 strains of Campylobacter coli (C. coli) to determine the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC). The highest percentages of C. coli were isolated from the manure storage area, and broiler litter followed by flies, and feeders (66.7, 53.3, 40.0, and 33.3%, respectively). Both chitosan/ZnO NPs and ZnO NPs at a concentration of 0.5 μg/mL and 1.5 μg/mL, respectively showed complete efficiency (100%) against C. coli compared with chitosan compound. In conclusion, manure storage area and broiler litter represented the main reservoir of Campylobacter bacterial contaminant followed by flies in broiler poultry farms. Chitosan/ZnO NPs composite can be used in any biosecurity program of poultry farms as an alternative to ineffective antimicrobial agents.

Isolation and Molecular Identification of Bacteria with Magnesite Enrichment Potential from Turanocak and Ortaocak Quarries in Kütahya-Turkey

In this study, bacteria were isolated from two different magnesite quarries in Turanocak and Ortaocak mine in Kütahya-Eskişehir region, one of the largest processed magnesite reserves in Turkey. The obtained isolates have a potential to solve important magnesite pollutant CaCO3 but incapable to solve magnesium that has the most crucial role in the industry. Thus, potential bacteria were identified to be used for magnesite enrichment studies. The obtained isolates were identified and characterized according to the morphological, physiological, biochemical, and molecular techniques (16S rDNA PCR). According to the gene sequencing analysis Bacillus genus bacteria have the ability to solve CaCO3. The data of the 16S rDNA gene sequence showed that there were 13 active strains grouped in Bacillus. These active strains; Bacillus sp (3), Bacillus atrophaeus (2), Bacillus thuringiensis (1), Bacillus circulans (1), Bacillus simplex (3), Bacillus endophyticus (1) Bacillus drentensis (1) and Bacillus idriensis (1).