Mullerian Tumor Research Articles

KEYNOTE-C93/GOG-3064/ENGOT-en15: A phase 3, randomized, open-label study of first-line pembrolizumab versus platinum-doublet chemotherapy in mismatch repair deficient advanced or recurrent endometrial carcinoma.

TPS5623 Background: Carboplatin-paclitaxel chemotherapy (with trastuzumab for HER2+ uterine serous carcinoma) is the standard of care first-line systemic treatment for recurrent or metastatic endometrial carcinoma (EC), which has a 5-year relative survival rate of only 17%. Worse survival outcomes have been shown for the mismatch repair deficient (dMMR) subtype of EC. Pembrolizumab (pembro), an anti-PD-1 antibody, showed compelling antitumor activity in previously treated, advanced MSI-H/dMMR EC in the phase 2 KEYNOTE-158 study (ORR, 48%; median duration of response [DOR], not reached; O’Malley JCO 2022). KEYNOTE-C93/GOG-3064/ENGOT-en15 (NCT05173987) is a phase 3, randomized, open-label study evaluating first-line pembro versus carboplatin-paclitaxel chemotherapy in patients with dMMR advanced or recurrent EC. Methods: Patients aged ≥18 years with histologically confirmed stage III/IV recurrent EC including carcinosarcoma (mixed Mullerian tumor), radiographically evaluable disease (measurable or nonmeasurable per RECIST v1.1), no prior systemic therapy (prior radiation with or without radiosensitizing chemotherapy > 2 weeks before first dose or prior hormonal therapy ≥1 week before randomization is permitted), and an ECOG PS ≤1 are eligible. Patients must have central confirmation of dMMR status. Approximately 350 patients will be randomized 1:1 to receive pembro 400 mg IV Q6W for 18 cycles (̃2 years) or carboplatin AUC 5 or 6 mg/mL/min IV Q3W and paclitaxel 175 mg/m2 IV Q3W for 6 cycles (with option for > 6 cycles). Trastuzumab is permitted for patients in the chemotherapy arm with HER2+ serous EC. Randomization is stratified by disease status (newly diagnosed advanced EC vs recurrent EC) and histology (endometrioid vs nonendometrioid). Treatment will continue for the specified number of cycles or until PD or unacceptable toxicity. Patients in the chemotherapy arm have the option to receive pembro following confirmed PD by blinded independent central review (BICR). Tumor imaging will be performed Q9W from randomization to week 54 and Q12W thereafter. AEs will be assessed from randomization to 30 days (90 days for serious AEs) after treatment discontinuation and graded per NCI CTCAE version 5.0. Dual primary endpoints are PFS per RECIST v1.1 by BICR and OS. Secondary endpoints are ORR, disease control rate, and DOR per RECIST v1.1 by BICR; PFS per RECIST v1.1 by investigator review; PFS2 (ie, time from randomization to PD per investigator assessment or death from any cause after start of subsequent anticancer therapy); safety; and patient-reported outcomes. PFS and OS will be estimated by the Kaplan-Meier method, with treatment differences assessed by the stratified log-rank test and HRs with 95% CIs determined using a Cox proportional hazard model. Enrollment is ongoing. Clinical trial information: NCT05173987.

48P Clinical profile and treatment outcomes of malignant mixed mullerian tumour of the uterus

48P Clinical profile and treatment outcomes of malignant mixed mullerian tumour of the uterus

Osseocartilaginous metaplasia in the Endometrium: A Rare Reversible Cause of Secondary Infertility

Osteo-cartilaginous metaplasia in endometrium is an infrequent finding and usually presents with secondary infertility. This is a benign entity and usually associated with a previous history of abortion. It can be treated successfully with hysteroscopy and henceforth reverting infertility. Awareness of this entity is important in order to avoid overdiagnosis of mixed Mullerian tumor of the endometrium followed by hysterectomy. Herein, we present one such case of a 28-year-old female who presented with secondary infertility.

Metachronous Cancer of Carcinosarcoma of the Uterus with Adenocarcinoma of Ovary: A Rare Case Report

Carcinosarcoma of the uterus (also known as malignant mixed Mullerian tumor, MMMT). Uterine carcinosarcoma is a rare, highly aggressive, rapidly progressing neoplasm associated with a poor prognosis that has not significantly improved in the past 30 years despite advances in imaging and adjuvant therapies. Our case is a Metachronous cancer where diagnosed two cancers at different time and she is on etoposide orally daily, She will evaluation after three months to see the response.

USG Guided Fine Needle Aspiration Cytology along with Immunocytochemistry to Diagnose Primary Malignant Mixed Mullerian Tumors: A Three-Year Study from a Tertiary Care Center.

Aims and Objectives:To study the diagnostic utility of fine-needle aspiration cytology (FNAC) and immunocytochemistry in diagnosing primary malignant mixed Mullerian tumors (MMMT).Materials and Methods:A 3-year retrospective study carried out in a tertiary care hospital, which included all the gynecological patients who underwent USG-guided FNAC of their abdominopelvic masses.Observations and Results:Out of the 324 total cases, 05 (1.5%) were reported as primary malignant mixed Mullerian tumors. Out of these 05 cases, 03 were ovarian, 01 was uterine, and 01 involved both uterus and one-sided adnexa. The FNA smears from the masses revealed cytomorphological features of a biphasic neoplasm with elongated pleomorphic spindle cells and dispersed, focal attempted acinar pattern, thus indicating the possibility of MMMT. Immunocytochemistry was further carried out which showed both vimentin and cytokeratin positivity. The diagnosis was confirmed on subsequent biopsy and immunohistochemistry (without any histopathological-cytological discrepancy).Conclusion:Though the literature is replete in establishing a histo-pathological diagnosis of MMMT, the diagnosis on USG-guided FNAC has been rarely described. Emphasis should be made on the careful examination of small sarcomatous elements in smears. Utilization of cell block and immunocytochemistry with histopathological correlation should be done to avoid misdiagnosis.

A Rare Case of Transformation of Endometrial Carcinoma Into Uterine Carcinosarcoma

Uterine carcinosarcoma (previously called malignant mixed Mullerian tumor) is a rare and aggressive cancer that is considered a high-risk variant of endometrial adenocarcinoma because of the resemblance in risk factors and clinical presentation with endometrial carcinoma. In the United States, the incidence of carcinosarcoma is approximately 1 to 4 per 100,000 women. The clinical features, diagnosis, staging, and treatment of uterine carcinosarcoma will be discussed in this topic review. To our knowledge, this is one of the few reported cases of endometrial carcinoma that has transformed into uterine carcinosarcoma. J Clin Gynecol Obstet. 2021;10(3):81-85 doi: https://doi.org/10.14740/jcgo677

Is complete mesocolic excision or total mesorectal excision necessary during cytoreductive surgery in ovarian peritoneal carcinomatosis with colonic involvement?

Introduction Cytoreductive surgery (CRS) and intraperitoneal chemotherapy are effective in the treatment of ovarian peritoneal carcinomatosis (OPC). Colon resection is often required to achieve maximal cytoreduction during CRS. The success of complete mesocolic excision (CME) and total mesorectal excision (TME) in the surgical treatment of primary colorectal tumors is well-known. Our study aimed to investigate the factors affecting mesocolic lymph node metastasis (MLNM) and the contribution of CME/TME techniques to maximal cytoreduction in patients diagnosed with ovarian peritoneal carcinomatosis (OPC) with colon metastasis. Patients and methods Between 2004–2020, 30 patients who underwent colorectal resection with CME/TME techniques due to OPC-related colon metastasis were retrospectively analyzed. Results The median age of patients was 61 (33–86). Six (20%) patients underwent total colectomy, 7 (23%) subtotal colectomy, 6 (20%) right hemicolectomy, 4 (13%) left hemicolectomy, and 7 (23%) rectosigmoid resection. Histopathological diagnosis was high-grade serous carcinoma in 29 (97%) patients, and malignant mixed Mullerian tumor in 1 (3%) patient. MLNM was detected in 17 (56%) of 30 patients. There was a significant relationship between MLNM and pelvic and para-aortic lymph node metastasis (PALNM) (p = 0.009) and lymphovascular invasion in primary ovarian tumors (p = 0.017). There was no significant relationship between MLNM and depth of colonic invasion (p = 0.463), histological grade (p = 0.711), and primary/secondary surgery (p = 0.638). MLNM was seen in 8 (47%) of 17 patients with only serosal invasion. Conclusion A high rate of MLNM can be seen in OPC-induced colon metastasis regardless of the degree of colon wall invasion. In patients with PALNM, the frequency of MLNM increases. We believe that if colon resection is to be performed in OPC, a colectomy should be performed by CME/TME principles to achieve maximal cytoreduction.

Abstract 2432: Somatic mutations in the STAT3 activation pathway are associated with improved survival in gynecologic malignancies and provide a molecular rationale for therapeutic targeting

Abstract Background: Signal transducer and activator of transcription 3 (STAT3) activation promotes tumor cell survival, immune evasion, metastasis, and drug resistance in PARP inhibitors and platinum-based chemotherapy. Objective: Based on our in-vitro findings of the tumoricidal potential of STAT3 inhibition in BRCAwild-type and PARP inhibitor-resistant tumor cells, we sought to evaluate whether ovarian and uterine cancer patients with somatic mutations in the STAT3 activation pathway had improved overall survival (OS) compared to those with intact STAT3 activation pathway-related genes. Method: We induced Olaparib resistance in BRCAwild-type ovarian cancer cell lines (OVCAR8 and A2780) and treated both parental and PARP inhibitor-resistant cell lines with various STAT3 inhibitors. We then attempted to establish clinical correlations of our in-vitro studies and queried the Cancer Genome Atlas (TCGA) Pan-Cancer Atlas for uterine and ovarian cancers. OS in patients with somatic mutations in the STAT3 gene and/or associated STAT3 activation genes (IL6ST, GNAS, JAK1, JAK2) was compared to OS in patients with intact STAT3 pathway-related genes. Kaplan-Meier survival curves were compared using the log-rank test. Results: In-vitro, STAT3 inhibition demonstrated potent, tumoricidal propensity in all cell lines (EC50: 0.34uM-0.46uM) including A2780parental, A2780parpi-resistant, OVCAR8parental, and OVCAR8parpi-resistant. Clinically, 1,154 total patients were identified in TCGA, including 571 high-grade serous ovarian carcinoma, 397 uterine endometrioid adenocarcinomas, 109 uterine serous carcinoma/uterine papillary serous carcinomas, 56 uterine carcinosarcomas/uterine malignant mixed Mullerian tumors, and 21 uterine mixed endometrial carcinomas. When pooling all uterine and ovarian cancer patients, median survival (MS) was 52 months (0-185) in patients with intact STAT3 (n=1,007) compared to not reached (NR, 0-225) in the STAT3 mutated group (n=147) with a Hazard Ratio (HR) of 0.25 and Confidence Interval (CI) 0.20-0.32 (p<0.001). In ovarian cancer patients, MS was 45 months (0-180) in patients with intact STAT3 (n=551) compared to 95 months (0-145) in the STAT3 mutated group (n=20) with a HR of 0.48 and CI 0.29-0.80 (p=0.038). In uterine cancer patients, MS was 112 months (0-185) in patients with intact STAT3 (n=456) compared to NR (0-225) in the STAT3 mutated group (n=127) with a HR of 0.40 and CI 0.25-0.64 (p=0.003). Conclusion: Pharmacologic and genetic (siRNA) inhibition of the STAT3 activation pathway killed PARP inhibitor-resistant ovarian cancer cells in-vitro. Clinically, somatic mutations in the STAT3 activation pathway were associated with improved OS in both ovarian and uterine cancer. These findings provide a rationale for the therapeutic targeting of this pathway in gynecologic malignancies. Citation Format: Adrian Kohut, Antons Martincuks, Thanh Dellinger, Hua Yu, Lorna Rodriguez-Rodriguez. Somatic mutations in the STAT3 activation pathway are associated with improved survival in gynecologic malignancies and provide a molecular rationale for therapeutic targeting [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2021; 2021 Apr 10-15 and May 17-21. Philadelphia (PA): AACR; Cancer Res 2021;81(13_Suppl):Abstract nr 2432.

Uterine Sarcomas: Are There MRI Signs Predictive of Histopathological Diagnosis? A 50-Patient Case Series with Pathological Correlation.

Purpose To make clear distinction between two radiological types of uterine sarcomas. Methods 50 preoperative MRI were analyzed retrospectively, blinded to histopathology: 11 endometrial stromal sarcomas (ESS), 19 leiomyosarcomas (LMS), 18 carcinosarcomas/malignant mixed Mullerian tumors (MMMT), and 2 smooth muscle tumors of uncertain malignant potential (STUMP). Results According to their locations, two radiological types of sarcomas were identified: type 1: intracavitary (ESS, MMMT) and type 2: intramyometrial (LMS, STUMP). In both types, all tumors displayed intermediate T2-weighted signal (p < 0.001) and high diffusion-weighted imaging (DWI) b1000 signal (p < 0.001). Dynamic contrast-enhanced (DCE) MRI showed intratumoral pathologic vessels (98%) and heterogeneity at venous phase (p < 0.001). In the type 1 subgroup, all tumors displayed local spread: invasion of junctional zone on T2-weighted imaging (T2WI), irregular margins on DWI, and disruption of arcuate arteries subendometrial ring on DCE-MRI. In the type 2 subgroup, all tumors displayed irregular margins on T2WI, DWI, and DCE-MRI. Tumor heterogeneity was due to necrosis (p < 0.001). Most commonly the tumor was single (61%). In both types, apparent diffusion coefficient (ADC) lesser than or equal to 0.86 × 10−3 mm2/s (sensitivity = 73%, specificity = 92%) was suggestive of malignancy. Conclusion It may be feasible to get close to histological type of a uterine sarcoma based on our topographic classification into two radiological subgroups, corresponding to two kinds of diagnostic difficulties. Advances in knowledge. MRI signs suggestive of histopathological malignancy are identifiable, considering the triad T2WI/DWI/DCE-MRI, easily for type 1 but less easily for type 2; the threshold value for ADC is 0.86 × 10−3 mm2/s.

MUC5AC expression is linked to mucinous/endometroid subtype, absence of nodal metastasis and mismatch repair deficiency in ovarian cancer

Mucin 5AC (MUC5AC) is a secreted gel-forming mucin which is expressed by mucus producing cells of several organs but can also be found in cancer cells of the ovary, pancreas, and gastrointestinal tract. This study aimed to characterize the expression of MUC5AC and its potential prognostic implications in different ovarian cancer subtypes. MUC5AC expression was analyzed by immunohistochemistry on a tissue microarray containing 603 ovarian cancers. MUC5AC was commonly expressed in mucinous (27/36; 75%) and endometrioid (12/39; 31%) carcinomas, whereas malignant mixed Mullerian tumors (2/27; 7%), high-grade serous (20/373; 5%) and clear cell carcinomas (1/28; 4%) were only rarely MUC5AC positive and also showed lower expression levels. MUC5AC positive endometroid carcinomas and high-grade serous carcinomas lacked lymph node metastases (p = 0.0495 and p = 0.0216) suggesting a more favorable prognosis. Deficient mismatch repair (dMMR), associated with a favorable prognosis in different cancer types, was found in 4/39 (10%) MUC5AC positive cancers but in only 5/375 (1%) of MUC5AC negative cancers (p = 0.0052). In subgroup analyses MUC5AC positive endometroid carcinomas more frequently showed dMMR (4/10; 40%) as opposed to MUC5AC negative endometroid carcinomas (3/23; 13%; p = 0.0932). In summary, the results of our study show that MUC5AC expression is associated with mucinous and endometrioid ovarian carcinomas, lack of nodal metastases and dMMR. MUC5AC expressing ovarian cancers should be evaluated for dMMR.

Differential risk factors between uterine sarcomas and malignant mixed Müllerian tumors.

e23551 Background: Uterine sarcomas are malignant tumors of the smooth muscle or connective tissue of the uterus. Its main histological types are leiomyosarcomas and endometrial stromal sarcomas, with recent classifications considering malignant mixed müllerian tumors (MMMT) as a dedifferentiated endometrial carcinoma rather than a primary uterine sarcoma. We hypothesize there are different risk factors which predispose to MMMT as compared to uterine sarcomas. This study investigates these risk factors to determine if they contribute to the development of either disease. Methods: Under an IRB-approved protocol, we identified patients with uterine sarcomas and MMMT treated at Sylvester Comprehensive Cancer Center and University of Miami Hospital between 2010 and 2020 by Patient Atlas (clinical database tool; Miami, FL). We compared the risk factors known to be associated with endometrial carcinomas between uterine sarcomas and MMMT using independent sample t-test, Chi Square, Spearman Rho and Pearson correlation. Results: A total of 59 patients with MMMT and 115 cases of uterine sarcoma were identified in our database. In the sarcoma group, the most common histology was leiomyosarcoma (n = 76, 66%). Upon analysis of the characteristics of the sarcoma and MMMT cohorts respectively, 38 (33%) vs 16 (27%) were Hispanics, 18 (15%) vs 13 (22%) had diabetes, 26 (22%) vs 20 (34%) used contraception or hormonal replacement therapy (HRT), 35 (30%) vs 17 (28%) were alcohol users, 26 (22%) vs 15 (25%) were smokers, and 54 (47%) vs 31 (52%) had a positive family history of cancer, with no statistically significant differences found (p &gt; 0.05). The sarcoma group had a significantly lower age at diagnosis (AAD) (53 vs. 65, P &lt; 0.001) and a larger tumor size (11.3 vs. 7.3 cm, p &lt; 0.0005). Use of contraception or HRT was not significantly different among the 2 groups (χ(1) = 0.699, p = 0.4). Similarly, no significant difference was found in the mean age of menarche/menopause, patient’s weight, median gravidity and parity (p &gt; 0.05). The patient’s weight and BMI negatively correlated with the AAD in the MMMT group (ρ = - 0.279, p = 0.043 and r = -0.274, p = 0.041 respectively). Older age at menopause was associated with older AAD in the sarcoma group (ρ = 0.571, p = 0.0001). Patients with higher gravidity and parity had an older AAD among the 2 groups (p ≤ 0.05). Conclusions: The uterine sarcoma patients had significantly younger AAD than the MMMT group, with the age at menopause being positively correlated with the AAD. The use of contraception or HRT were not significantly different among the 2 cohorts, suggesting that there could be an overlap of the risk factors of MMMT and uterine sarcomas. Interestingly, higher gravidity and parity were associated with an older AAD. In the MMMT group, patient’s weight and BMI were inversely associated with the AAD. Larger studies are needed to investigate whether similarities or discrepancies in the studied risk factors truly exist.

Uterine carcinosarcoma: a rare cause for postmenopausal bleeding

Uterine carcinosarcoma is a rare aggressive tumor also known as Malignant Mixed MullerianTumor. Prognosis is poor with 30-40% having extrauterine involvement at the first presentation and over 10% with distant metastasis. The primary treatment is surgery, along with radio-chemotherapy. We report a case of uterine carcinosarcoma in a 65 y para four lady who presented with blood mixed discharge per vagina for one month and polypoidal mass protruding through the cervical os. Endometrial biopsy showed carcinosarcoma. She was managed with surgery. She received adjuvant chemotherapy paclitaxel and carboplatin. There was no recurrence at six months follow-ups.

Malignant mixed mullerian tumor of the ovary: A rare entity

Malignant mixed mullerian tumors (carcinosarcomas) of the ovary are very rare neoplasms which account for less than 1-2% of ovarian tumors. These are associated with an aggressive clinical course and a poor prognosis. Here we are reporting a case of carcinosarcoma of the ovary. Keywords: Carcinosarcoma, Malignant Mixed Mullerian Tumor, Ovary.

Cervical malignant mixed mesonephric tumour: A case report with local recurrence after six-years and next-generation sequencing analysis with particular reference to the ataxia telangiectasia mutated gene.

Malignant mixed mesonephric tumours (MMMsT) of the female genital tract are extremely rare, and the majority are located in the wall of the cervix uteri. At present, there are no reports of the molecular characterisation of MMMsT of the female genital tract. Herein, we report the morphological, immunohistochemical and molecular features of this rare malignancy using next-generation sequencing (NGS) analysis. A 58-year-old woman presented with vaginal bleeding. In 2013, she had been diagnosed with a cervical carcinosarcoma of probable mesonephric origin and International Federation of Gynaecology and Obstetrics (FIGO) stage IB that had been treated by total hysterosalpingo-oopherectomy without adjuvant chemo-radiotherapy. Ultrasonography showed a vaginal mass measuring 25 mm in the maximum dimension. Biopsy was performed and showed a biphasic neoplasm composed of adenocarcinoma and sarcoma. Immunohistochemistry showed positive staining for epithelial membrane antigen (EMA), pancytokeratin (MNF116), paired box 8 (PAX-8), β-catenin, cytokeratin 7, cyclin D1, GATA3 and CD10. Androgen receptor positivity was detected in very limited areas. Cytokeratin 20, carcinoembryonic antigen (CEA), oestrogen receptor (ER), progesterone receptor (PR), transcription termination factor 1 (TTF1), Wilm's tumour antigen-1 (WT-1), calretinin and p16 were negative. The immunohistochemical profile was consistent with mesonephric origin. NGS analysis identified a variant of the ataxia-telangiectasia mutated (ATM) gene (p.Phe858Leu; c.2572 T>C; COSM21826). The number of detected allele frequency reads of ATM mutation following clinical relapse was higher, compared to its baseline: 65 vs. 96%. The differential diagnosis of MMMsT includes mesonephric hyperplasia, malignant mixed Mullerian tumour (carcinosarcoma), endometrioid adenocarcinoma and endometrial stromal sarcoma. The clinical significance of the observed ATM variant in the case reported herein is unknown. The present findings need further verification, as the mutation in ATM may result in chemotherapy resistance or conversely, may be exploited for targeted therapies.

Abstract PO013: SNP rs1982 in the 3’UTR of placenta-specific protein 1 (PLAC1) is associated with endometrial cancer survival

Abstract Placenta-specific protein 1 (PLAC1) is a small (212aa) secreted protein normally only expressed on the apical surfaces of syncytiotrophoblasts. However, over the past two decades we and other investigators have shown that human cancers and, in particular, cancers of the human reproductive tract, induce PLAC1 expression. In gynecologic cancers, PLAC1 expression has been shown to be associated with risk, histology and TP53 mutation status. A previously unassessed informative SNP rs1982 (A&amp;gt;C) lies in the 3’ untranslated region of the PLAC1 gene. We have begun to explore the utility of this SNP by genotyping a panel of 75 endometrial cancers. The panel is composed of 29 endometrial adenocarcinomas, 10 papillary serous adenocarcinomas, 9 mixed Mullerian tumors, 6 mixed histologies, 2 tumors identified as displaying complex atypia and 1 neuroendocrine tumor. High molecular weight genomic DNA was extracted from these tumors and SNP genotypes determined by directly sequencing a 312bp PCR amplicon generated by the primers: rs1982for: GAGGATTGGTCTCTTCACACAG; rs1982rev: ACAATGTCTGGCCCATACTAAA SNP genotypes were then evaluated against a variety of clinical variables including age, BMI, tobacco use, Charlson Index, co-morbidities, stage, grade, myometrial invasion, recurrence, and death by cancer using both univariate and multivariate logistic regression. Progression-free and overall survival were assessed by Cox Proportional Hazard ratio. Results show that CC homozygotes have increased progression-free and overall survival though neither reached statistical significance. However, several clinical variables were statistically associated with different rs1982 genotypes. Charlson co-morbidity Index was positively associated with presence of the wild-type A allele (OR = 1.61; 1.06 - 2.69; p&amp;lt;0.05), while death from disease was negatively associated (OR = 0.15; 0.03 – 0.64; p&amp;lt;0.02). These differences hold when accounting for other co-variates in the multivariate analysis. These data support further exploration of this SNP in gynecologic cancers. Citation Format: Eric J. Devor, Jesus Gonzalez-Bosquet, Kimberly K. Leslie. SNP rs1982 in the 3’UTR of placenta-specific protein 1 (PLAC1) is associated with endometrial cancer survival [abstract]. In: Proceedings of the AACR Virtual Special Conference: Endometrial Cancer: New Biology Driving Research and Treatment; 2020 Nov 9-10. Philadelphia (PA): AACR; Clin Cancer Res 2021;27(3_Suppl):Abstract nr PO013.

Nature and significance of stromal differentiation in carcinosarcoma (MMMT): unravelling the biology and shifting current paradigms.

Carcinosarcoma (CS) is a rare, aggressive malignancy of the Mullerian system often termed mixed malignant Mullerian tumor (MMMT). It is biphasic in nature, differentiating into epithelial and sarcomatous components. Tumor-node-metastasis (TNM) staging and mismatch repair (MMR) status is the basis for both prognostication and therapeutic decision making. However, stromal differentiation (SD) is a new frontier in the field of histopathology and many studies have demonstrated its prognostic significance. The present study is the first study to evaluate the role of SD in carcinosarcoma. Here we found immature SD to be a significant prognostic signature (p = 0.04). It outperformed age, nodal metastasis, and lymphovascular invasion for predicting cancer-free survival. Immature SD also corelated with both myometrial invasion (p = 0.01) and tumor stage (p = 0.02). Carcinosarcoma has been previously thought to have universally poor outcomes; however, mature SD was found to be protective in this cancer subtype. Our findings support the integration of SD into the synoptic reporting for carcinosarcoma; however, this will require pathologists to shoulder the adoption of SD into clinical practice.

Intraoperative Evaluation of a Serous Cystadenofibroma of the Fallopian Tube in a 13-Year-Old Female

Background: Cystadenofibromas (CAFs) are defined as benign mixed mullerian tumors. They are diagnosed mainly in the ovary. Nonetheless, extraovarian locations, such as endometrium, uterine cervix, fallopian tube, and parasalpinx, were reported. Clinical course is commonly asymptomatic, and tumors are often diagnosed on histology after adnexal cyst surgery for benign indications. Case: A 13-year-old female was admitted into our emergency room with acute lower right abdominal pain as her main complaint. Abdominopelvic ultrasonography showed a right adnexal unilocular cyst with small papillary projections on the inner wall of the cyst, with no apparent solid component. Result: During laparoscopy, two cystic masses dependent on the distal region of the right fallopian tube were seen. After fluid aspiration of the first cyst, capsule was opened to see the nodular formations (papillary projections) previously described by ultrasonography. Right salpingectomy was performed due to high suspicion of a borderline tumor. Histopathologic diagnosis was compatible with a serous CAF. Conclusion: In our case we tried an intraoperative evaluation of the inner surface of the cyst, observing papillary projections that were regular and well adhered to their wall. However, microscopic pathology assessment of the tumor is mandatory to have definitive diagnosis. Surgical treatment, especially in child and youth population, should be conservative and adnexectomy should be avoided. Laparoscopic approach is often successful and can be considered in these cases. Although previous published cases were diagnosed in an incidental manner, our case highlights the importance of a thorough intraoperative assessment of adnexal tumors in child and adolescent patients.

Adjuvant Radiotherapy Improves Overall Survival When Added to Surgery and Chemotherapy for Endometrial Carcinosarcoma: A Surveillance, Epidemiology, and End Results Analysis

Endometrial carcinosarcoma (CS), or malignant mixed Mullerian tumor, is a high-grade variant of endometrial carcinoma with a high risk for recurrence. Adjuvant multi-agent chemotherapy (CHT) is a preferred treatment modality in all stages of disease, with or without radiotherapy (RT). As prospective data are lacking regarding the benefit of RT when added to adjuvant CHT in CS, we sought to analyze the Surveillance, Epidemiology, and End Results (SEER) database to ascertain whether RT improves overall survival (OS) and cancer-specific survival (CSS) when added to surgery and CHT for endometrial CS. SEER 18 Custom Data registries (Nov 2018 submission) were queried for endometrial (ICD10 C54.1-9, C55.9) CS (ICD-0-3 8980-3). Patients with stage I-III CS who received CHT with or without RT were included for analysis. Univariate analysis (UVA) and multivariable analysis (MVA) using Kaplan-Meier and Cox proportional hazards regression modeling were performed. Propensity-score matched analysis with inverse probability of treatment weighting was performed to account for indication bias. Furthermore, conditional landmark analysis using a minimum follow-up time of 3 months was performed to minimize immortal time bias. A total of 1,541 patients treated from 1988-2016 were included in this analysis. Median age at diagnosis was 65 (IQR 59-71). Patients had FIGO stage IA (30%), IB (14%), II (9%), IIIA (8%), IIIB (3.6%), or IIIC (32%) disease. All patients received CHT and 54% received RT, either with external beam RT (EBRT) alone (25%), EBRT with a brachytherapy boost (9.7%), or brachytherapy alone (18.7%). On UVA, adjuvant RT improved OS (HR 0.65, 95% CI 0.56-0.77, p<0.001) and CSS (HR 0.64, 95% CI 0.54-0.76, p<0.001) compared to surgery and CHT alone. Of note, RT was more likely to be delivered to patients who were slightly younger (p = 0.034) and to those with a lower FIGO stage (p<0.001). After adjusting for these baseline imbalances, the OS benefit provided by adjuvant RT persisted (HR 0.76, 95% CI 0.65-0.89, p<0.001), as did the CSS benefit (HR 0.74, 95% CI 0.63-0.87, p<0.001). Moreover, these findings were maintained using a 3-month conditional landmark analysis (HR 0.67, 95% CI 0.57-0.79). On subgroup analysis, factors associated with an OS benefit included stage IA (HR 0.45, 95% CI 0.45-0.99) and IIIA (HR 0.42, 95% CI 0.24-0.74) disease, grade III disease (HR 0.78, 95% CI 0.61-0.99), ages 50-64 years (HR 0.76, 95% CI 0.59-0.98) and ≥65 years (HR 0.79, 95% CI 0.64-0.98), and treatment delivered between 2010-2016 (HR 0.65, 95% CI 0.52-0.81). In patients with FIGO stage I-III endometrial CS undergoing surgery and CHT, RT improves OS and CSS. Further prospective data are needed to investigate the benefit of RT in endometrial CS treated with modern therapies.

Cytologic Presentation and Clinicopathologic Correlation of Malignant Mixed Mullerian Tumor Diagnosed in Serous Fluids

Cytologic Presentation and Clinicopathologic Correlation of Malignant Mixed Mullerian Tumor Diagnosed in Serous Fluids

Carcinosarcoma of the Uterus: An Elusive Diagnosis

Introduction: Carcinosarcoma or Malignant Mixed Mullerian Tumor (MMMT) of the uterus is a rare malignant tumor comprising both carcinomatous and sarcomata’s components. Worldwide it accounts for two to five percentages of all uterine malignancies. However, there is a paucity of reports in Nepalese literature.&#x0D; Case report: A 62 year’s postmenopausal woman with diabetes and hypertension presented with urinary symptoms for two months and passage of fleshy mass per vagina for two days. Ultrasound was inconclusive, whereas, Magnetic Resonance Imaging (MRI) showed an endo-cervical mass. Pre-operative biopsy of the masssuggested leiomyosarcoma. Abdominal hysterectomy with bilateral salpingo-oophorectomy and pelvic andpara-aortic lymphadenectomy was performed. Per-operatively, an atrophic uterus, a dimple in the funds, andballooning of the lower uterine segment and vagina were noted. The cut section showed an exophytic polypoidalmass with base in the fundus. Histopathology revealed Stage IA carcinosarcoma with aggressive mitotic figures. Immunohistochemistry confirmed the diagnosis of carcinosarcoma with a heterogonous rhabdomyosarcomatouscomponent. Adjuvant chemotherapy and radiation therapy was advised.&#x0D; Conclusion: The preoperative diagnosis of carcinosarcoma or MMMT was difficult and might be missed on biopsy as well. Owing to its aggressive nature and higher rates of post-surgical recurrence, carcinosarcoma accounts for around one-fifth of deaths due to uterine malignancies. Surgery is the primary treatment modality, yet much study is needed before evidence-based adjuvant management for improving its outcome is established.