Major Immediate Early Gene Expression Research Articles

Repression of the major immediate early promoter of human cytomegalovirus allows transcription from an alternate promoter.

Following infection, the human cytomegalovirus (HCMV) genome becomes rapidly associated with host histones which can contribute to the regulation of viral gene expression. This can be seen clearly during HCMV latency where silencing of the major immediate early promoter (MIEP), normally responsible for expression of the key lytic proteins IE72 and IE86, is mediated by histone methylation and recruitment of heterochromatin protein 1. Crucially, reversal of these histone modifications coupled with histone acetylation drives viral reactivation which can be blocked with specific histone acetyltransferase inhibitors (HATi). In lytic infection, a role for HATi is less clear despite the well-established enhancement of viral replication observed with histone deacetylase inhibitors. Here we report that a number of different broad-acting HATi have a minor impact on viral infection and replication during lytic infection with the more overt phenotypes observed at lower multiplicities of infection. However, specific analyses of the regulation of major immediate early (MIE) gene expression reveal that the HATi C646, which targets p300/CBP, transiently repressed MIE gene expression via inhibition of the MIEP but by 24 h post-infection MIE gene expression was rescued due to compensatory activation of an alternative IE promoter, ip2. This suggested that silencing of the MIEP promoted alternative ip2 promoter activity in lytic infection and, consistent with this, ip2 transcription is impaired in cells infected with a recombinant HCMV that does not auto-repress the MIEP at late times of infection. Furthermore, inhibition of the histone methyltransferases known to be responsible for auto-repression is similarly inhibitory to ip2 transcription in wild-type infected cells. We also observe that these discrete transcriptional activities of the MIEP and ip2 promoter are also reflected in reactivation; essentially in cells where the MIEP is silenced, ip2 activity is easier to detect at very early times post-reactivation whereas in cells where robust activation of the MIEP is observed ip2 transcription is reduced or delayed. Finally, we observe that inhibition of pathways demonstrated to be important for reactivation of HCMV in dendritic cells, e.g. in response to IL-6, are preferentially important for activation of the MIEP and not the ip2 promoter. Together, these data add to the hypothesis that the existence of multiple promoters within the MIE region of HCMV can drive reactivation in a cell type- and ligand-specific manner and also suggest that inter-dependent regulatory activity between the two promoters exists.

Control of Immediate Early Gene Expression for Human Cytomegalovirus Reactivation.

Human cytomegalovirus (HCMV) is a beta herpesvirus that persists for life in the majority of the world's population. The persistence of HCMV in the human population is due to the exquisite ability of herpesviruses to establish a latent infection that evades elimination by the host immune response. How the virus moves into and out of the latent state has been an intense area of research focus and debate. The prevailing paradigm is that the major immediate early promoter (MIEP), which drives robust expression of the major immediate early (MIE) transactivators, is epigenetically silenced during the establishment of latency, and must be reactivated for the virus to exit latency and re-enter productive replication. While it is clear that the MIEP is silenced by the association of repressive chromatin remodeling factors and histone marks, the mechanisms by which HCMV de-represses MIE gene expression for reactivation are less well understood. We have identified alternative promoter elements within the MIE locus that drive a second or delayed phase of MIE gene expression during productive infection. In the context of reactivation in THP-1 macrophages and primary CD34+ human progenitor cells, MIE transcripts are predominantly derived from initiation at these alternative promoters. Here we review the mechanisms by which alternative viral promoters might tailor the control of viral gene expression and the corresponding pattern of infection to specific cell types. Alternative promoter control of the HCMV MIE locus increases versatility in the system and allows the virus to tightly repress viral gene expression for latency but retain the ability to sense and respond to cell type-specific host cues for reactivation of replication.

Bright and Early: Inhibiting Human Cytomegalovirus by Targeting Major Immediate-Early Gene Expression or Protein Function.

The human cytomegalovirus (HCMV), one of eight human herpesviruses, establishes lifelong latent infections in most people worldwide. Primary or reactivated HCMV infections cause severe disease in immunosuppressed patients and congenital defects in children. There is no vaccine for HCMV, and the currently approved antivirals come with major limitations. Most approved HCMV antivirals target late molecular processes in the viral replication cycle including DNA replication and packaging. “Bright and early” events in HCMV infection have not been exploited for systemic prevention or treatment of disease. Initiation of HCMV replication depends on transcription from the viral major immediate-early (IE) gene. Alternative transcripts produced from this gene give rise to the IE1 and IE2 families of viral proteins, which localize to the host cell nucleus. The IE1 and IE2 proteins are believed to control all subsequent early and late events in HCMV replication, including reactivation from latency, in part by antagonizing intrinsic and innate immune responses. Here we provide an update on the regulation of major IE gene expression and the functions of IE1 and IE2 proteins. We will relate this insight to experimental approaches that target IE gene expression or protein function via molecular gene silencing and editing or small chemical inhibitors.

Differentiation-Coupled Induction of Human Cytomegalovirus Replication by Union of the Major Enhancer Retinoic Acid, Cyclic AMP, and NF-κB Response Elements.

ABSTRACTTriggers and regulatory pathways that effectively link human cytomegalovirus (HCMV) major immediate early (MIE) latent-lytic switch activation with progeny production are incompletely understood. In the quiescently infected human NTera2 cell model of primitive neural stem cells, we found that costimulation with vasoactive intestinal peptide (V) and phorbol ester (P) synergistically activated viral infection, but this effect waned over time. Coupling retinoic acid (R), an inducer of neuronal differentiation, to VP pulse stimulation attenuated the decline in viral activity and promoted the spread of the active infection through concentric layers of neighboring cells as cellular differentiation progressed. R stimulation alone was unable to activate the infection. The MIE enhancer cis-regulatory mechanisms responsible for this result were characterized by a strategy of combinatorial mutagenesis of five cis-acting element types (retinoic acid receptor binding elements [RARE], cyclic AMP [cAMP] response elements [CRE], NF-κB binding sites [kB], serum response element, and ETS/ELK-1 binding site) and multiple methods of assessment. We found that the CRE and kB combination sets the preinduction enhancer tone, is the major initiator and amplifier of RVP-induced MIE gene expression, and cooperates with RARE during cellular differentiation to enhance viral spread. In predifferentiated NTera2, we also found that the CRE-kB combination functions as initiator and amplifier of unstimulated HCMV MIE gene expression and cooperatively interacts with RARE to enhance viral spread. We conclude that RVP-stimulated signaling cascades and cellular differentiation operate through the enhancer CRE-kB-RARE core in strengthening induction of HCMV MIE gene expression in linkage with viral propagation.IMPORTANCE Cytomegalovirus-seropositive persons commonly lack detectable levels of cytomegalovirus replication, even when profoundly immunocompromised. In a human NTera2 cell model of primitive neural stem cells carrying resting cytomegalovirus genomes, we show that costimulation of protein kinase A and C-delta signaling cascades in conjunction with retinoic acid-induced neuronal differentiation brings about progeny virus propagation. Iterated DNA binding sites for retinoic acid receptor, CREB, and NF-κB family members in the cytomegalovirus major enhancer are at the crux in the pathway to HCMV activation. The stimulated CREB and NF-κB binding site combination vigorously initiates and amplifies the active cytomegalovirus infection and cooperates with activated retinoic acid receptor binding sites to further promote viral proliferation and spread between differentiated cells. These results support a paradigm in which a specific combination of stimuli coupled with cellular differentiation satisfies a core cis-activating code that unlocks enhancer silence to repower the cycle of cytomegalovirus propagation.

CTCF binding to the first intron of the major immediate early (MIE) gene of human cytomegalovirus (HCMV) negatively regulates MIE gene expression and HCMV replication.

Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin-organizing factor, CTCF, has been found to facilitate human CMV gene expression, which affects viral replication. We also identified a CTCF-binding motif in the first intron (also called intron A) that directly binds to CTCF and is required for CTCF to repress MIE gene expression. Finally, we show that the CTCF-binding motif is conserved in CMV because a similar DNA sequence was found in murine CMV (MCMV) that is required for CTCF to bind to MCMV MIE gene to repress MCMV MIE gene expression.

Inhibition of human cytomegalovirus replication by overexpression of CREB1

Expression of the human cytomegalovirus (HCMV) major immediate-early (MIE) genes is regulated by a strong enhancer-containing promoter with multiple binding sites for various transcription factors, including cyclic AMP response element binding protein 1 (CREB1). Here we show that overexpression of CREB1 potently blocked MIE transcription and HCMV replication. Surprisingly, CREB1 still exhibited strong inhibition of the MIE promoter when all five CREB binding sites within the enhancer were mutated, suggesting that CREB1 regulated the MIE gene expression indirectly. Promoter deletion analysis and site-directed mutagenesis identified the region between −130 and −50 upstream of the transcription start site of the MIE gene as the “CREB1 responsive region”. Mutations of SP1/3 and NF-κB binding sites within this region interrupted the inhibitory effect induced by CREB1 overexpression. Our findings suggest that overexpression of CREB1 can cause repression of HCMV replication and may contribute to the development of new anti-HCMV strategies.

Phorbol ester-induced human cytomegalovirus major immediate-early (MIE) enhancer activation through PKC-delta, CREB, and NF-kappaB desilences MIE gene expression in quiescently infected human pluripotent NTera2 cells.

The ways in which human cytomegalovirus (HCMV) major immediate-early (MIE) gene expression breaks silence from latency to initiate the viral replicative cycle are poorly understood. A delineation of the signaling cascades that desilence the HCMV MIE genes during viral quiescence in the human pluripotent N-Tera2 (NT2) cell model provides insight into the molecular mechanisms underlying HCMV reactivation. In this model, we show that phorbol 12-myristate 13-acetate (PMA) immediately activates the expression of HCMV MIE RNA and protein and greatly increases the MIE-positive (MIE(+)) NT2 cell population density; levels of Oct4 (pluripotent cell marker) and HCMV genome penetration are unchanged. Decreasing PKC-delta activity (pharmacological, dominant-negative, or RNA interference [RNAi] method) attenuates PMA-activated MIE gene expression. MIE gene activation coincides with PKC-delta Thr505 phosphorylation. Mutations in MIE enhancer binding sites for either CREB (cyclic AMP [cAMP] response element [CRE]) or NF-kappaB (kappaB) partially block PMA-activated MIE gene expression; the ETS binding site is negligibly involved, and kappaB does not confer MIE gene activation by vasoactive intestinal peptide (VIP). The PMA response is also partially attenuated by the RNAi-mediated depletion of the CREB or NF-kappaB subunit RelA or p50; it is not diminished by TORC2 knockdown or accompanied by TORC2 dephosphorylation. Mutations in both CRE and kappaB fully abolish PMA-activated MIE gene expression. Thus, PMA stimulates a PKC-delta-dependent, TORC2-independent signaling cascade that acts through cellular CREB and NF-kappaB, as well as their cognate binding sites in the MIE enhancer, to immediately desilence HCMV MIE genes. This signaling cascade is distinctly different from that elicited by VIP.

Synergism between the components of the bipartite major immediate-early transcriptional enhancer of murine cytomegalovirus does not accelerate virus replication in cell culture and host tissues

Major immediate-early (MIE) transcriptional enhancers of cytomegaloviruses are key regulators that are regarded as determinants of virus replicative fitness and pathogenicity. The MIE locus of murine cytomegalovirus (mCMV) shows bidirectional gene-pair architecture, with a bipartite enhancer flanked by divergent core promoters. Here, we have constructed recombinant viruses mCMV-DeltaEnh1 and mCMV-DeltaEnh2 to study the impact of either enhancer component on bidirectional MIE gene transcription and on virus replication in cell culture and various host tissues that are relevant to CMV disease. The data revealed that the two unipartite enhancers can operate independently, but synergize in enhancing MIE gene expression early after infection. Kick-start transcription facilitated by the bipartite enhancer configuration, however, did not ultimately result in accelerated virus replication. We conclude that virus replication, once triggered, proceeds with a fixed speed and we propose that synergism between the components of the bipartite enhancer may rather increase the probability for transcription initiation.

Breaking human cytomegalovirus major immediate-early gene silence by vasoactive intestinal peptide stimulation of the protein kinase A-CREB-TORC2 signaling cascade in human pluripotent embryonal NTera2 cells.

The triggering mechanisms underlying reactivation of human cytomegalovirus (HCMV) in latently infected persons are unclear. During latency, HCMV major immediate-early (MIE) gene expression breaks silence to initiate viral reactivation. Using quiescently HCMV-infected human pluripotent embryonal NTera2 cells (NT2) to model HCMV reactivation, we show that vasoactive intestinal peptide (VIP), an immunomodulatory neuropeptide, immediately and dose-dependently (1 to 500 nM) activates HCMV MIE gene expression. This response requires the MIE enhancer cyclic AMP response elements (CRE). VIP quickly elevates CREB Ser133 and ATF-1 Ser63 phosphorylation levels, although the CREB Ser133 phosphorylation level is substantial at baseline. VIP does not change the level of HCMV genomes in nuclei, Oct4 (pluripotent cell marker), or hDaxx (cellular repressor of HCMV gene expression). VIP-activated MIE gene expression is mediated by cellular protein kinase A (PKA), CREB, and TORC2. VIP induces PKA-dependent TORC2 Ser171 dephosphorylation and nuclear entry, which likely enables MIE gene activation, as TORC2 S171A (devoid of Ser171 phosphorylation) exhibits enhanced nuclear entry and desilences the MIE genes in the absence of VIP stimulation. In conclusion, VIP stimulation of the PKA-CREB-TORC2 signaling cascade activates HCMV CRE-dependent MIE gene expression in quiescently infected NT2 cells. We speculate that neurohormonal stimulation via this signaling cascade is a possible means for reversing HCMV silence in vivo.

Roles of Polypyrimidine Tract Binding Proteins in Major Immediate-Early Gene Expression and Viral Replication of Human Cytomegalovirus

Human cytomegalovirus (HCMV), a member of the beta subgroup of the family Herpesviridae, causes serious health problems worldwide. HCMV gene expression in host cells is a well-defined sequential process: immediate-early (IE) gene expression, early-gene expression, DNA replication, and late-gene expression. The most abundant IE gene, major IE (MIE) gene pre-mRNA, needs to be spliced before being exported to the cytoplasm for translation. In this study, the regulation of MIE gene splicing was investigated; in so doing, we found that polypyrimidine tract binding proteins (PTBs) strongly repressed MIE gene production in cotransfection assays. In addition, we discovered that the repressive effects of PTB could be rescued by splicing factor U2AF. Taken together, the results suggest that PTBs inhibit MIE gene splicing by competing with U2AF65 for binding to the polypyrimidine tract in pre-mRNA. In intron deletion mutation assays and RNA detection experiments (reverse transcription [RT]-PCR and real-time RT-PCR), we further observed that PTBs target all the introns of the MIE gene, especially intron 2, and affect gene splicing, which was reflected in the variation in the ratio of pre-mRNA to mRNA. Using transfection assays, we demonstrated that PTB knockdown cells induce a higher degree of MIE gene splicing/expression. Consistently, HCMV can produce more viral proteins and viral particles in PTB knockdown cells after infection. We conclude that PTB inhibits HCMV replication by interfering with MIE gene splicing through competition with U2AF for binding to the polypyrimidine tract in MIE gene introns.

Repression of human cytomegalovirus major immediate early gene expression by the cellular transcription factor CCAAT displacement protein

Initiation of human cytomegalovirus (HCMV) productive infection is dependent on the major immediate early (MIE) genes ie1 and ie2. Several putative binding sites for CCAAT displacement protein (CDP or CUX1) were identified within the MIE promoter/regulatory region. Binding assays demonstrated binding of CUX1 to MIE-region oligonucleotides containing the CUX1 core binding sequence ATCGAT and mutagenesis of this sequence abrogated CUX1 binding. Furthermore, CUX1 repressed expression of a luciferase reporter construct controlled by the MIE promoter, and mutation of CUX1 binding sites within the promoter diminished this repressive function of CUX1. In the context of virus infection of HEK293 cells transfected with the CUX1 expression vector, CUX1 showed evidence of association with the HCMV MIE regulatory region and inhibited the capacity of the virus to express ie1 and ie2 transcripts, suggesting that this cellular factor regulates MIE gene expression following virus entry. These data identify a role for CUX1 in repressing HCMV gene expression essential for initiation of the replicative cycle.

Role of the cytomegalovirus major immediate early enhancer in acute infection and reactivation from latency.

The cytomegalovirus (CMV) major immediate early (MIE) enhancer-containing promoter regulates the expression of the downstream MIE genes, which have critical roles in reactivation from latency and acute infection. The enhancer consists of binding sites for cellular transcription factors that are repeated multiple times. The primate and nonprimate CMV enhancers can substitute for one another. The enhancers are not functionally equivalent, but they do have overlapping activities. The CMV MIE enhancers are located between divergent promoters where the leftward genes are critical and essential for reactivation from latency and acute infection and the rightward gene is nonessential. The rightward transcription unit is controlled by an enhancer for murine CMV. In contrast, human CMV has a set of repressor elements that prevents enhancer effects on the rightward viral promoter. The human CMV enhancer that controls the leftward transcription unit has a distal component that is nonessential at high multiplicity of infection (MOI), but has a significant impact on the MIE gene expression at low MOI. The proximal enhancer influences directly the level of transcription of the MIE genes and contains an essential Sp-1 site. The MIE promoter has a site adjacent to the transcription start site that is essential at the earliest stage of infection. The MIE enhancer-containing promoter responds to signal transduction events and to cellular differentiation. The role of the CMV MIE enhancer-containing promoter in acute infection and reactivation from latency are reviewed.

A cis Element between the TATA Box and the Transcription Start Site of the Major Immediate-Early Promoter of Human Cytomegalovirus Determines Efficiency of Viral Replication

The promoter of the major immediate-early (MIE) genes of human cytomegalovirus (HCMV), also referred to as the CMV promoter, possesses a cis-acting element positioned downstream of the TATA box between positions -14 and -1 relative to the transcription start site (+1). We determined the role of the cis-acting element in viral replication by comparing recombinant viruses with the cis-acting element replaced with other sequences. Recombinant virus with the simian CMV counterpart replicated efficiently in human foreskin fibroblasts, as well as wild-type virus. In contrast, replacement with the murine CMV counterpart caused inefficient MIE gene transcription, RNA splicing, MIE and early viral gene expression, and viral DNA replication. To determine which nucleotides in the cis-acting element are required for efficient MIE gene transcription and splicing, we constructed mutations within the cis-acting element in the context of a recombinant virus. While mutations in the cis-acting element have only a minor effect on in vitro transcription, the effects on viral replication are major. The nucleotides at -10 and -9 in the cis-acting element relative to the transcription start site (+1) affect efficient MIE gene transcription and splicing at early times after infection. The cis-acting element also acts as a cis-repression sequence when the viral IE86 protein accumulates in the infected cell. We demonstrate that the cis-acting element has an essential role in viral replication.

Murine Cytomegalovirus Major Immediate-Early Enhancer Region Operating as a Genetic Switch in Bidirectional Gene Pair Transcription

Enhancers are defined as DNA elements that increase transcription when placed in any orientation relative to a promoter. The major immediate-early (MIE) enhancer region of murine cytomegalovirus is flanked by transcription units ie1/3 and ie2, which are transcribed in opposite directions. We have addressed the fundamental mechanistic question of whether the enhancer synchronizes transcription of the bidirectional gene pair (synchronizer model) or whether it operates as a genetic switch, enhancing transcription of either gene in a stochastic alternation (switch model). Clonal analysis of cytokine-triggered, transcription factor-mediated MIE gene expression from latent viral genomes provided evidence in support of the switch model.

Reversal of human cytomegalovirus major immediate-early enhancer/promoter silencing in quiescently infected cells via the cyclic AMP signaling pathway.

The human cytomegalovirus (HCMV) major immediate-early (MIE) enhancer contains five functional cyclic AMP (cAMP) response elements (CRE). Because the CRE in their native context do not contribute appreciably to MIE enhancer/promoter activity in lytically infected human fibroblasts and NTera2 (NT2)-derived neurons, we postulated that they might have a role in MIE enhancer/promoter reactivation in quiescently infected cells. Here, we show that stimulation of the cAMP signaling pathway by treatment with forskolin (FSK), an adenylyl cyclase activator, greatly alleviates MIE enhancer/promoter silencing in quiescently infected NT2 neuronal precursors. The effect is immediate, independent of de novo protein synthesis, associated with the phosphorylation of ATF-1 serine 63 and CREB serine 133, dependent on protein kinase A (PKA) and the enhancer's CRE, and linked to viral-lytic-cycle advancement. Coupling of FSK treatment with the inhibition of either histone deacetylases or protein synthesis synergistically activates MIE gene expression in a manner suggesting that MIE enhancer/promoter silencing is optimally relieved by an interplay of multiple regulatory mechanisms. In contrast, MIE enhancer/promoter silence is not overcome by stimulation of the gamma interferon (IFN-gamma) signaling pathway, despite the enhancer having two IFN-gamma-activated-site-like elements. We conclude that stimulation of the cAMP/PKA signaling pathway drives CRE-dependent MIE enhancer/promoter activation in quiescently infected cells, thus exposing a potential mode of regulation in HCMV reactivation.

Human Cytomegalovirus Latency is Associated with the State of Differentiation of the Host Cells: an in vitro Model in Teratocarcinoma Cells

The human cytomegalovirus (HCMV) major immediate-early (MIE) gene is not transcribed in undifferentiated NTera-2 embryonal carcinoma cells, but is transcribed in their differentiated derivatives, offering a model with which to study the developmental regulation of the activity of a viral gene during the differentiation of these cells. The molecular mechanisms involved in the blockade of the MIE gene expression in undifferentiated NTera2 cells include covalent closure of the circular conformation of the viral genome, silencing of the viral MIE promoter by histone deacetylation, and increases in the expression of negatively regulating transcription factors responsible for the recruitment of the histone deacytylases around the viral MIE promoter (MIEP), resulting in repression of the MIEP in undifferentiated cells. The treatment of NTera2 cells with retinoic acid induces the differentiation of these cells. In HCMV-infected differentiated NTera2 cells, the MIEP becomes associated with hyperacetylated histones, which results in an open structure of chromatin, enhancing the access of DNA-binding factors which positively regulate MIE gene expression and viral replication. This model system contributes to an understanding of HCMV latency and reactivation in vivo in the cells of the myeloid lineage.

Geldanamycin, a Potent and Specific Inhibitor of Hsp90, Inhibits Gene Expression and Replication of Human Cytomegalovirus

The effect of geldanamycin (GA), a specific inhibitor of heat shock protein 90 (Hsp90), on gene expression and replication of human cytomegalovirus (HCMV) was studied in human embryonic lung (HEL) fibroblasts. Kinetic analysis indicated that GA delayed synthesis of major immediate early (MIE), early and late viral proteins, and blocked a second tier of the synthesis of these proteins that occurred in untreated cells after 48 h post-infection (pi). Moreover, when HCMV-infected HEL cells were maintained with medium containing 40 nM GA for 6 days, with medium changes at 2-day intervals, the virus yield was reduced to an undetectable level. On a molecular level, the cellular kinase Akt and the transcription factor NFkappaB were activated in HCMV-infected cells within 30 min pi. NFkappaB was shown to be essential for MIE gene expression. However, in GA-treated cells, activation of both Akt and NFkappaB was greatly inhibited. Because LY294002, an inhibitor of cellular phosphatidylinositol 3-kinase (PI3-K), also prohibited HCMV-mediated activation of Akt and NFkappaB and synthesis of the MIE proteins, PI3-K signalling was necessary for expressing the MIE genes. These results suggest that the inhibitory effect of GA on HCMV replication is primarily caused by the disruption of the PI3-K signalling pathway, leading to the activation of NFkappaB, which plays a crucial role in expression of the critical MIE genes.

Requirement of Multiple cis -Acting Elements in the Human Cytomegalovirus Major Immediate-Early Distal Enhancer for Viral Gene Expression and Replication

We have shown previously that the human cytomegalovirus (HCMV) major immediate-early (MIE) distal enhancer is needed for MIE promoter-dependent transcription and viral replication at low multiplicities of infection (MOI). To understand how this region works, we constructed and analyzed a series of HCMVs with various distal enhancer mutations. We show that the distal enhancer is composed of at least two parts that function independently to coordinately activate MIE promoter-dependent transcription and viral replication. One such part is contained in a 47-bp segment that has consensus binding sites for CREB/ATF, SP1, and YY1. At low MOI, these working parts likely function in cis to directly activate MIE gene expression, thus allowing viral replication to ensue. Three findings support the view that these working parts are likely cis-acting elements. (i) Deletion of either part of a bisegmented distal enhancer only slightly alters MIE gene transcription and viral replication. (ii) Reversing the distal enhancer's orientation largely preserves MIE gene transcription and viral replication. (iii) Placement of stop codons at -300 or -345 in all reading frames does not impair MIE gene transcription and viral replication. Lastly, we show that these working parts are dispensable at high MOI, partly because of compensatory stimulation of MIE promoter activity and viral replication that is induced by a virion-associated component(s) present at a high viral particle/cell ratio. We conclude that the distal enhancer is a complex multicomponent cis-acting region that is required to augment both MIE promoter-dependent transcription and HCMV replication.

The human cytomegalovirus major immediate-early distal enhancer region is required for efficient viral replication and immediate-early gene expression.

The human cytomegalovirus (HCMV) major immediate-early (MIE) genes, encoding IE1 p72 and IE2 p86, are activated by a complex enhancer region (base positions -65 to -550) that operates in a cell type- and differentiation-dependent manner. The expression of MIE genes is required for HCMV replication. Previous studies analyzing functions of MIE promoter-enhancer segments suggest that the distal enhancer region variably modifies MIE promoter activity, depending on cell type, stimuli, or state of differentiation. To further understand the mechanism by which the MIE promoter is regulated, we constructed and analyzed several different recombinant HCMVs that lack the distal enhancer region (-300 to -582, -640, or -1108). In human fibroblasts, the HCMVs without the distal enhancer replicate normally at high multiplicity of infection (MOI) but replicate poorly at low MOI in comparison to wild-type virus (WT) or HCMVs that lack the neighboring upstream unique region and modulator (-582 or -640 to -1108). The growth aberrancy was normalized after restoring the distal enhancer in a virus lacking this region. For HCMVs without a distal enhancer, the impairment in replication at low MOI corresponds to a deficiency in production of MIE RNAs compared to WT or virus lacking the unique region and modulator. An underproduction of viral US3 RNA was also evident at low MOI. Whether lower production of IE1 p72 and IE2 p86 causes a reduction in expression of the immediate-early (IE) class US3 gene remains to be determined. We conclude that the MIE distal enhancer region possesses a mechanism for augmenting viral IE gene expression and genome replication at low MOI, but this regulatory function is unnecessary at high MOI.