Luteinizing Hormone/choriogonadotropin Research Articles

Expression and function of the luteinizing hormone choriogonadotropin receptor in human endometrial stromal cells

The human luteinising hormone choriogonadotropin receptor (LHCGR) is a G-protein coupled receptor activated by both human chorionic gonadotropin (hCG) and luteinizing hormone (LH), two structurally related gonadotropins with essential roles in ovulation and maintenance of the corpus luteum. LHCGR expression predominates in ovarian tissues where it elicits functional responses through cyclic adenosine mononucleotide (cAMP), Ca2+ and extracellular signal-regulated kinase (ERK) signalling. LHCGR expression has also been localized to the human endometrium, with purported roles in decidualization and implantation. However, these observations are contentious. In this investigation, transcripts encoding LHCGR were undetectable in bulk RNA sequencing datasets from whole cycling endometrial tissue and cultured human endometrial stromal cells (EnSC). However, analysis of single-cell RNA sequencing data revealed cell-to-cell transcriptional heterogeneity, and we identified a small subpopulation of stromal cells with detectable LHCGR transcripts. In HEK-293 cells expressing recombinant LHCGR, both hCG and LH elicited robust cAMP, Ca2+ and ERK signals that were absent in wild-type HEK-293 cells. However, none of these responses were recapitulated in primary EnSC cultures. In addition, proliferation, viability and decidual transformation of EnSC were refractory to both hCG and LH, irrespective of treatment to induce differentiation. Although we challenge the assertion that LHCGR is expressed at a functionally active level in the human endometrium, the discovery of a discrete subpopulation of EnSC that express LHCGR transcripts may plausibly account for the conflicting evidence in the literature.

Expression of LHCG receptors in the human penis

The aim of this study is to investigate the expression of the luteinizing hormone/choriogonadotropin (LHCG) receptor in the human penis to see, if the luteinizing hormone (LH) effects are possible in the spongious and cavernous tissue of the penis. The number of men with erection disturbances increases significantly simultaneously with the elevated LH concentrations between 40 and 70 years. It is possible that the elevated LH concentrations may influence locally the erectile mechanisms. The precondition for this is the expression of LHCG receptors in the penis. Penile tissue was obtained from three patients undergoing total or partial penectomy due to a rectal cancer with secondary penile metastasis or squamous cell carcinoma of the penis. Immunohistochemistry was used for the detection of the LHCG receptor. Positive immunoreaction for LHCG receptors was discovered in the endothelial cells of cavernous spaces in the corpus cavernosum and corpus spongiosum penis, also in the endothelial cells of the capillary walls in all patients. Our results show that LHCG receptor is expressed in the spongious and cavernous tissue of the human penis. This finding suggests that LH can affect the spongious and cavernous tissue in human and play a significant role in the development of erectile dysfunction among the aging men.

Case Report: A 54 base pair inactivating mutation of LHCGR in a 28-year old woman with poor ovarian response

The luteinizing hormone/choriogonadotropin (LH/CG) receptor plays an important role in male and female infertility. Many studies have demonstrated that mutations at specific sites in LHCGR gene may result in mild or complete loss of receptor function. Insertions in exon-1 of LHCGR gene were first studied in male Leydig cell hypoplasia and later extended to female reproductive disorders. Previous studies have shown that these insertions play an important role in intrauterine insemination (IUI) and in vitro fertilization (IVF) outcome. Here we report a 54bp insertion in a 28-year old woman with infertility, recurrent cyst formation and failed stimulated IUI cycles. As the patient showed a blunted response to the ovarian stimulation and human chorionic gonadotropin (hCG) stimulation test, follicle stimulating hormone receptor (FSHR) and luteinizing hormone/choriogonadotropin (LHCGR) gene sequencing was performed. Gene sequence analysis revealed a 54bp homozygous insertion (GCTGCTGAAGCTGCTGCTGCTGCTGCAGCTGCTGAAGCTGCTGCTGCTGCTGCA) in the exon-1 of LHCGR gene. This mutation might have caused a decrease in receptor function in the present infertile patient, thus resulting in poor ovarian response.

Desensitization of the Luteinizing Hormone/Choriogonadotropin Receptor in Ovarian Follicular Membranes Is Inhibited by Catalytically Inactive ARNO+

We have investigated the participation of endogenous ADP-ribosylation factor (ARF) nucleotide-binding site opener (ARNO) in desensitization of the luteinizing hormone/choriogonadotropin (LH/CG) receptor, independent of receptor internalization, using a cell-free plasma membrane model. We recently showed that the addition of recombinant ARNO promotes binding of beta-arrestin1 to the third intracellular (3i) loop of the active LH/CG receptor, thereby reducing the ability of the receptor to activate the stimulatory G protein and signal to adenylyl cyclase. In the present report we determined whether ARNO is detectable in follicular membranes and whether the catalytically inactive E156K ARNO mutant, containing a mutation in the Sec7 domain, can act in a dominant negative manner to block LH/CG receptor desensitization. Results show that ARNO is readily detected in follicular membranes and that levels of membrane-associated ARNO increase with follicular maturation. The addition of catalytically inactive E156K ARNO blocks both the release of beta-arrestin1 from its membrane docking site, based on Western blot analysis, and development of LH/CG receptor desensitization. We also investigated whether a point mutation in the pleckstrin homology (PH) domain of ARNO (R280D), which blocks binding of phosphoinositides like phosphatidylinositol 3,4,5-trisphosphate and phosphatidylinositol 4,5-bisphosphate (PIP(2)) but not catalytic activity, disrupts LH/CG receptor desensitization. R280D ARNO neither promotes nor inhibits LH/CG receptor desensitization, consistent with a requirement of the PH domain of ARNO for its association with the plasma membrane. LH/CG receptor activation of ARNO is not mediated by activation of phosphatidylinositol 3-kinase (PI 3-kinase) or by G protein beta gamma subunits. Taken together, these results suggest that LH/CG receptor promotes beta-arrestin1 release from its membrane docking site to bind to the 3i loop of the LH/CG receptor via activation of membrane delimited endogenous ARNO. As ARNO activation is independent of PI 3-kinase and G beta gamma, our results are consistent with a role for PIP(2) in receptor-stimulated ARNO activation.

A direct role for arrestins in desensitization of the luteinizing hormone/choriogonadotropin receptor in porcine ovarian follicular membranes.

The luteinizing hormone/choriogonadotropin (LH/CG) receptor (R) is a heptahelical R that, upon agonist binding, activates the stimulatory guanine nucleotide-binding protein (Gs) and the downstream effector adenylyl cyclase (AC). Like other G protein-coupled Rs, the LH/CG R subsequently exhibits reduced agonist-dependent effector activity, or desensitization, in response to saturating agonist. Unlike desensitization of many other G protein-coupled Rs, the in vivo desensitization response of LH/CG R-stimulated AC activity of ovarian follicles to the preovulatory surge of LH can be mimicked under cell-free conditions. Based on evidence that porcine ovarian follicular membranes unexpectedly contained beta-arrestin-1, the role of arrestins in desensitization of the LH/CG R was investigated. Results showed that neutralizing arrestin antibodies blocked the development of desensitization and that desensitization was rescued with a synthetic peptide corresponding to the antibody-binding epitope on beta-arrestin-1. These results suggest that endogenous beta-arrestin-1 participates in agonist-dependent desensitization of the LH/CG R. Addition of recombinant purified beta-arrestin-1 mimicked human chorionic gonadotrophin to promote desensitization of human chorionic gonadotrophin-stimulated AC activity, in the presence of the ATP phosphorylation antagonist adenylyl-imidodiphosphate, with an ED50 of approximately 0.1 nM. Increased levels of an 87-kDa protein reactive with glycoprotein hormone R-reactive antibody, consistent with the LH/CG R, coimmunoprecipitated with follicular membrane beta-arrestin-1 in response to LH/CG R activation compared with unactivated R. Taken together, these results show that ovarian follicles contain membrane-associated beta-arrestin-1, that beta-arrestin-1 participates in agonist-dependent desensitization of the LH/CG R, and that the trigger for beta-arrestin-1 binding to the LH/CG R appears to be R activation.

Ligand-induced receptor dimerization may be critical for signal transduction by choriogonadotropin

A mechanism of signal transduction by human choriogonadotropin (hCG) has been proposed. Competitive inhibition of the binding of hCG to its receptor by the serine protease inhibitors led to the identification of local structural homology of an extracellular region of the receptor with the reactive site loop of chymotrypsin inhibitor. Synthetic peptides from the extracellular domain of luteinizing hormone-choriogonadotropin (LH/CG) receptor, rationally designed on the basis of this homology, were found to affect hormone-receptor binding and bioactivity. A receptor peptide incorporating one complete structural unit of the leucine-rich repeats motif of the extracellular domain of the receptor significantly increased hCG-receptor binding in a dose-dependent manner. However, the testosterone production in a Leydig cell bioassay was inhibited in the presence of this peptide. The agonistic effect on the hCG-receptor binding and the antagonistic effect on the testosterone production of a receptor peptide suggests the possibility of more than one quasi-equivalent receptor-binding site on the hormone. Hormone-induced receptor oligomerization may therefore be involved in the mechanism of signal transduction by hCG.

Molecular Cloning, Genomic Organization, and Developmental Regulation of a Novel Receptor from Drosophila melanogaster Structurally Related to Members of the Thyroid-stimulating Hormone, Follicle-stimulating Hormone, Luteinizing Hormone/Choriogonadotropin Receptor Family from Mammals

Using oligonucleotide probes derived from consensus sequences for glycoprotein hormone receptors, we have cloned an 831-amino acid residue-long receptor from Drosophila melanogaster that shows a striking structural homology with members of the glycoprotein hormone (thyroid-stimulating hormone (TSH); follicle-stimulating hormone (FSH); luteinizing hormone/choriogonadotropin (LH/CG)) receptor family from mammals. This homology includes a very large, extracellular N terminus (20% sequence identity with rat TSH, 19% with rat FSH, and 20% with the rat LH/CG receptor) and a seven-transmembrane region (53% sequence identity with rat TSH, 50% with rat FSH, and 52% with the rat LH/CG receptor). The Drosophila receptor gene is >7.5 kilobase pairs long and contains 17 exons and 16 introns. Seven intron positions coincide with introns in the mammalian glycoprotein hormone receptor genes and have the same intron phasing. This indicates that the Drosophila receptor is evolutionarily related to the mammalian receptors. The Drosophila receptor gene is located at position 90C on the right arm of the third chromosome. The receptor is strongly expressed starting 8-16 h after oviposition, and the expression stays high until after pupation. Adult male flies express high levels of receptor mRNA, but female flies express about 6 times less. The expression pattern in embryos and larvae suggests that the receptor is involved in insect development. This is the first report on the molecular cloning of a glycoprotein hormone receptor family member from insects.

Processing of the LH/CG receptor and bound hormone in rat luteal cells after hCG-induced down-regulation as studied by a double immunofluorescence technique in conjunction with confocal laser scanning microscopy.

We developed a double immunofluorescence technique for detection of the rat luteinizing hormone/choriogonadotropin (LH/CG) receptor and bound hCG in the same rat ovarian section and used it in conjunction with confocal laser scanning microscopy (CLSM) to study the fate of the receptor-hormone complex in luteal cells during the hCG-induced down-regulation. Pseudopregnant immature females rats were perfusion-fixed before (0 hr) and 2, 6, 12, 24, or 36 hr after a down-regulating dose of hCG (500 IU IV). The cryosections were stained for the LH/CG receptor and bound hormone by sequential incubations with a polyclonal rabbit antiserum to purified rat LH/CG receptor and a mouse monoclonal antibody (MAb) to hCG, followed by sequential incubation with TRITC- and FITC-conjugated secondary antibodies to rabbit and mouse immunoglobulins, respectively. The results were semiquantitatively analyzed by a pseudo-three-dimensional (3D) plotting of the intensities of the receptor and hormone-specific fluorescence in luteal cells by CLSM. The analysis suggested that the majority of the LH/CG receptors are located on the luteal cells before induction of the down-regulation and that their content seem to vary not only among cells but also on the surface of single cells, thus supporting the previous concept of the functional heterogeneity among the cells and their functional compartmentation. At 2 hr after injection of the down-regulating dose of hCG, the LH/CG receptor-specific and hCG-specific fluorescences clearly co-localized on the luteal cells. Both the LH/CG receptor- and hCG-specific fluorescences disappeared from the luteal cell surfaces in a parallel fashion within 36 hr without a detectable accumulation of either fluorescence deep in the cell interior. These results suggest that the LH/CG receptor and bound hCG do not differ in their manner of in vivo processing in luteal cells. Therefore, the disappearance of the receptor and bound hormone occurs in a parallel fashion and without detectable internalization.

The chromosomal localization of the human follicle-stimulating hormone receptor gene (FSHR) on 2p21-p16 is similar to that of the luteinizing hormone receptor gene.

Two cDNA probes (5' and 3' region) corresponding to the human follicle-stimulating hormone receptor gene (FSHR) were used for chromosomal localization by in situ hybridization. The localization obtained on chromosome 2p21-p16 is similar to that of the luteinizing hormone/choriogonadotropin (LH/CG) receptor gene.