Length Of Spicules Research Articles

Redescription of Physaloptera sarcophili Johnston & Mawson, 1940 and the description of Physaloptera dasyuri sp. nov. (Nematoda: Spirurida) parasitic in Australasian dasyurid marsupials

ABSTRACT Physaloptera sarcophili Johnston & Mawson, 1940 (Nematoda: Spirurida), originally described from the Tasmania devil, Sarcophilus harrisii (Boitard), is redescribed based on additional material from this host species. Physaloptera dasyuri sp. nov. is described from quolls, Dasyurus maculatus (Kerr) from Tasmania, Dasyurus hallucatus Gould from the Northern Territory and the Kimberly District of Western Australia and Dasyurus albopunctatus Schlegel from New Guinea. The two nematode species are distinguished by measurements, with values of those of P. sarcophili being approximately twice as large as those of P. dasyuri sp. nov. and by differences in the ratio of right to left spicule lengths. Limited morphological variation in the distribution of the papillae on the caudal bursa is described. Both species are differentiated from congeners in Australian mammals by the presence of four sessile post-cloacal papillae arranged in a single row, the arrangement of the three pairs of post-cloacal sessile papillae and spicule measurements. The differentiation of both species from congeners in South American marsupials and eutherian carnivores is also discussed.

First Record of Aphelenchoides oryzae on Foxtail Millet (Setaria italica (L.) P. Beauv.) in Jilin Province of China.

Aphelenchoides oryzae Yokoo caused a large reduction in rice yields in Japan (1948). It was later synonymised with A. besseyi by Allen (1952), but Subbotin et al. (2021) considered it a valid species. In the main foxtail millet (Setaria italica (L.) P. Beauv.) production area of western Jilin Province, China, many plants were stunted, with thin spikes and open, smooth, shiny glumes. Severely affected spikes were noticeably shorter, fluffy at the top, and erect. In August 2023, 10 foxtail millet samples were collected and nematodes were isolated from 9 of them. A population from Songyuan City, Jilin Province (E:123.64, N:44.86) was studied. The average number of nematodes isolated per gram of ear was 510.7 ± 15.17. Female body slender, lip region rounded, lateral fields with 4 or 6 incisures, vulva located at 71.6% of the body length, post vulvar uterine sac (PUS) 3.7 times anal body width long but less than quarter distance from vulva to anus (VA), tail conical with 3 or 4 terminal spikes. The body length (L), maximum body width (W) and tail length of the female (mean, n=25) were 648 μm, 15.9 μm and 36.7 μm, respectively. PUS length / (VA)% = 23.5, L/W = 41.1, L/ tail length = 17.8. Male body tail curves like a sickle, lacks bursa and shows three pairs of copulatory papillae. Spicules typical of the genus except that the proximal end lacks a dorsal process and has only a moderately developed rostrum. Male measured (mean, n = 25): L = 525.8 μm, W = 14.8 μm, tail length = 34.0 ± 0.7 μm, spicule length = 16.4 μm; L/W = 35.6; L/tail length = 15.6 μm. Amplification of the D2-D3 expansion segments of the 28S ribosomal RNA and the cytochrome oxidase subunit I (COI) gene of mitochondrial DNA (mtDNA) with primers the forward D2A (5'-ACAAGTACCGTGAGGGAAAGTTG-3') and the reverse D3B (5'-TCGGAAGGAACCAGCTACTA-3') (Subbotin et al. 2006), and forward COI-F1 (5'-CCTACTATGATTGGTGGTTTTGGTAATTG-3') and the reverse COI-R2 (5'-GTAGCAGCAGTAAAATAAGCACG-3') (Kanzaki and Futai 2002). PCR conditions were as described by Ye et al. (2007). The sequences of 28S D2-D3 region (726 bp, PP573753- PP573761) of rDNA were 100% identical to A. oryzae (KY123700, KY123694) and COI region (698-700 bp, PP733171-PP733179), were 98.88% identical to A. oryzae (GU367867). Bayesian inference was used to construct phylogenetic tree of 28S D2-D3 region and COI gene, which showed that the Jilin populations clustered together with A. oryzae, which was a sister branch of A. besseyi. Pathogenicity was established via the infection of foxtail millet (cv. Jiyou 2). The germinated foxtail millet seeds were planted in pots containing 350 ml of sterile soil mixture. On the 15th day, every 10 seedlings were inoculated with 100 A. oryzae at the leaf sheet wounds and 3 plants were noninoculated as control. Three independent replicates were performed on different dates. Forty days post-inoculation, an average of 88.3 ± 2.26 A. oryzae were extracted from each nematode-inoculated plant, and the plants were yellowed and necrotic, uninoculated plants grew normally. The molecular and morphological identification of the nematodes obtained by re-isolation from the plants was identical to that of A. oryzae. Our findings clarify the pathogen species, which can be targeted to develop prevention and control strategies, which are important for ensuring safe grain production and helping promote sustainable local agricultural production. To our knowledge, this is the first record of A. oryzae on foxtail millet in Jilin, China.

A New Species of Heligmonellidae (Nematoda) in Euryoryzomys russatus (Rodentia: Sigmodontinae) in the Atlantic Forest of Northeast Brazil.

The genus Stilestrongylus (Freitas, Lent, and Almeida, 1937) is defined by having 24 or more subequal cuticular ridges, an asymmetrical caudal bursa, and a hypertrophied genital cone. It comprises 25 recognized species, mainly parasitizing cricetids, and shows significant diversification linked to the evolution of its hosts. Stilestrongylus magnumspiculum n. sp. is a newly described nematode species identified in the small intestine of the rodent Euryoryzomys russatus (Cricetidae, Sigmodontinae) from the Atlantic Forest of Northeast Brazil. This study aims to characterize the new species and its prevalence in host populations. A total of 43 Euryoryzomys russatus individuals were collected and analyzed for parasitic infections. Morphological features of Stilestrongylus magnumspiculum n. sp. were examined, focusing on the number of ridges, synlophe characteristics, caudal bursa type, lobe hypertrophy, and the spicule length to body length ratio. The new species exhibited a prevalence of 21% among the sampled hosts. Distinctive morphological features were observed, including:the synlophe structure exhibited specific ridge patterns that differentiate it from other species within the genus; the caudal bursa was identified as a type 2-2-1; hypertrophy of the right lobe was observed, indicating notable morphological adaptation; rays 4 and 5 were found to be equivalent in size and diverged at the distal end; the spicule length to body length ratio (SpL/BL) was measured at 30-36%, representing the largest ratio recorded for the genus. In comparison, other Stilestrongylus species displayed the following ratios: S. rolandoi (21-33%), S. lanfrediae (25-29%), S. kaaguyporai (20-24%), S. inexpectatus (20-23%), and S. stilesi (26-28%). This report presents Stilestrongylus magnumspiculum n. sp. as a new species of nematode, contributing to the diversity of the genus Stilestrongylus. The findings underscore the importance of studying host-parasite interactions within the Atlantic Forest ecosystem and provide a basis for future ecological and parasitological research.

Sychnotylenchus kulinichi sp. n. (Nematoda: Anguinoidea) from the Primorsky Krai of Russia with a tabular key to the genus Sychnotylenchus Rühm, 1956

Summary A new species of the genus Sychnotylenchus Rühm, 1956, S. kulinchi sp. n., inhabiting the bark beetle galleries of Pityogenes chalcographus in Pinus koraiensis was found in the Primorsky Krai of Russia. The new species differs morphologically from the closely related species S. yasinskii and S. mayor in having a shorter body length (626-1030 vs 1250-1280 and 1935-1455 μm, respectively) and from S. sparnugus in having a greater value of the ratio between spicule length and tail length (0.9-11 vs less than 0.7). Phylogenetic analysis of the partial 18S rRNA, D2-D3 expansion segments of the 28S rRNA, the ITS rRNA and COI gene sequences showed that the Russian S. kulinichi sp. n. population grouped with populations from Israel and an unspecified locality that were identified incorrectly as Ditylenchus forepolitor, which are considered conspecific with S. kulinichi sp. n. in this study. Phylogenetic analyses aiming to clarify the controversial taxonomic status of Neoditylenchus and Sychnotylenchus species indicated that, although the genus Sychnotylenchus was paraphyletic in some phylogenetic trees, testing of alternative topologies for the 18S rRNA, D2-D3 of 28S rRNA and ITS rRNA gene trees and datasets using the maximum likelihood method did not exclude the monophyly of this genus and did not justify the validity of the genus Neoditylenchus, which should be considered a junior synonym of Sychnotylenchus as proposed by Fortuner & Maggenti (1987). Molecular phylogeny showed close relationships of Sychnotylenchus with plant-parasitic nematodes from the genera Ficotylus, Orrina and Pterotylenchus, and also with the insect-associated genus Neomisticius. A polytomous key listing 24 morphological diagnostic characters for the identification of 33 species of Sychnotylenchus is provided, along with a table listing associated bark beetle species.

First report of Root-Knot Nematode Meloidogyne hapla infecting Siegesbeckia orientalis L. in Shaanxi, China.

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) μm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) μm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) μm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) μm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) μm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) μm, BW = 28.24 ± 2.38 (25.93-30.55) μm, ST = 20.23 ± 0.78 (19.42-21.04) μm, DGO = 4.89 ± 0.44 (4.56-5.22) μm, spicule length = 28.98 ± 1.68 (26.94-31.02) μm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) μm, BW = 15.09 ± 1.47 (12.02-16.82) μm, ST = 12.74 ± 0.61(11.46-13.84) μm, DGO = 2.58 ± 0.59 (1.61-3.7) μm, tail length= 74.15 ± 13.73 (50.92-95.09) μm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) μm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.

Further studies on the diversity of Cylicospirura Vevers, 1922 (Nematoda: Spirocercidae) in African carnivores, with description of a new species.

Cylicospirura Vevers, 1922 is a genus of gastrointestinal spirurid nematodes parasitizing mainly felid but also canid, hyaenid and dasyurid hosts. Presently, 11 species are recognized worldwide, of which 4, Cylicospirura subaequalis, Cylicospirura felinea, Cylicospirura crocutae and Cylicospirura pardalis, have been recorded from African carnivores. In the present study, we describe Cylicospirura phiri n. sp. from hyaenas, namely Crocuta crocuta (type host) in Zimbabwe and Hyaena hyaena in Cameroon. The new species is the second species in the genus with bicuspid teeth. Furthermore, it can be distinguished from its congeners by a combination of characters, such as the absence of accessory teeth, the length and shape of the muscular oesophagus, position of the nerve ring, deirids and excretory pore in relation to the muscular oesophagus, the position of the vulva, spicule length and the shape of the female tail. Additionally, based on new material, detailed morphological descriptions are provided for C. crocutae and C. pardalis whose original descriptions were based on fragmented material. The material from Felis lybica, currently deposited as C. subaequalis, is described as C. felinea. First-time scanning electron micrographs are presented for the 4 species confirmed in African carnivores.

Concurrent Infection of Oesophagostomum species in a Slaughtered Goat: A Case Report

The morbidity and mortality of gastrointestinal nematodes in goats made them one of the most significant parasites in the world, causing huge economic loss for farmers. It has been reported that the economic loss due to gastrointestinal parasitism was Rs. 372.35 per goat annually. In the present study, the intestinal sample was collected from a local slaughter house at Izatnagar, Bareilly, Uttar Pradesh, for screening the gastrointestinal nematodes. Initially, the pathological lesions like nodules, cyst and haemorrhagic patches etc. were examined for any parasitic infection. The found worms in the intestinal content were subjected for microscopic examination for the identification of the nematode and identified them as Oesophagostomum spp. based on buccal capsule with cephalic and cervical structures. Interestingly, both Oesophagostomum columbianum and O. asperum species were found in the same sample. The male and female Oesophagostomum species were also differentiated by examining the spicule and gubernacular length, position of the vulva and anus. This study reports the infection of Oesophagostomum spp. in a goat and the first case report of concurrent infection of O. columbianum and O. asperum in the Bareilly region of Uttar Pradesh.

MORPHOLOGICAL AND MOLECULAR CHARACTERIZATION OF A BRAND NEW ISOLATE OF ENTOMOPATHOGENIC NEMATODE, STEINERNEMA FELTIAE (FILIPJEV) (RHABDITIDA: STEINERNEMATIDAE) FROM THE UZBEKISTAN

Steinernema feltiae isolate Sf:1 changed into recovered from one soil pattern gathered from the Surkhandarya region, Uzbekistan. The new isolate may be prominent from different isolates through morphologic and morphometric data, and rRNA sequences. The first generation male is characterized through spicule duration 79,5 (73±87) mm, SW ratio [(spicule length/anal body diameter)*100] 160 13 (137±177), GS ratio GS [(gubernaculum/ spicule length)*100] 79 8 (62±87), genital papillae association and the second one technology male through a mucron 10 1 (9±11) mm long. For the infective juvenile, the frame is 883 82 (754±975) mm long, lateral fields with 8 similarly evolved ridges, head smooth, barely offset, massive gonad primordium cells, a protracted hyaline tail portion (identical to 1/2 of of tail duration), and pore-like phasmid at 41% of the tail duration to the semicircle anus are the differentiation factors.

ДВА НОВЫХ ДЛЯ НАУКИ ВИДА ОНХОЛАЙМИД (NEMATODA, ENOPLIDA, ONCHOLAIMIDAE) С КОРАЛЛОВЫХ РИФОВ ВО ВЬЕТНАМЕ

Two new for science species of the family Oncholaimidae Dujardin, 1845, found in coral reefs in Vietnam, are described and illustrated. Oncholaimus securus sp. n. is close to O. longispiculosus Gerlach, 1955 according to presence of papilla on tail and spicules length. It differs from it by the longer and thinner body, shorter pharynx and wider labial region. Viscosia graciloides sp. n. in body size and length of spicules is close to V. erasmi Furstenberg, Vincx, 1989, V. macrobursata Keppner, 1987 and V. dossena Leduc, Zhan, 2023. It differs from these species by the form of outer labial sensillae, thinner body, narrower labial region and shorter stoma.

Three New Species of Free-Living Marine Nematodes of the Order Enoplida Filipjev, 1929 (Nematoda) from the Yellow Sea, China

Three new nematode species belonging to the order Enoplida were discovered in the muddy and sandy sediment along the Shandong peninsula coast of the Yellow Sea during a biodiversity investigation of marine nematodes in the Yellow Sea. They are named Belbolla octobulba sp. nov., Ironella gracilis sp. nov. and Oxystomina longiseta sp. nov. Belbolla octobulba sp. nov. is characterized by having eight pharyngeal bulbs; spicules arcuate, broad and even; gubernaculum with a pair of dorso-caudal apophyses, about a third of the length of spicule; and two winged precloacal supplements. Ironella gracilis sp. nov. differs from known species by body slender, buccal cavity divided into conical vestibulum and cylindrical posterior portion, three sclerotized teeth located in the vestibulum; both circles of outer labial setae and cephalic setae 10 µm apart; elongated spicules weakly arcuate with central strip and cephalate proximal end; gubernaculum conical without apophysis; and a tubular precloacal supplement with a long seta at its anterior end. Oxystomina longiseta sp. nov. can be distinguished from other known species by the relatively long outer labial setae and cephalic setae; arcuate spicules expanded proximally with a median rib; gubernaculum small and oblong; and two unequal precloacal supplementary setae, anterior one short, posterior one very long. Updated keys to eighteen species of Belbolla and keys to four species of Ironella are given.

Morphological and molecular characterization of Geraldius galapagoensis (Nematoda: Chambersiellidae) associated with lichens in Argentina

Lichens are symbiotic organisms, usually composed of a fungal partner, the mycobiont, and one or more photosynthetic partners, the photobiont, which is most often either a green alga or a cyanobacterium, that harbor a diverse community of invertebrates such as rotifers, tardigrades, mites, springtails, crustaceans, and nematodes. In this work, we isolated the nematode Geraldius galapagoensis (Chambersiellidae) associated with the lichen Hyperphyscia syncolla (Physciaceae) in a region of Buenos Aires Province, Argentina. This species was discovered in a tropical forest of Ecuador and is characterized mainly by a head offset by a constriction from the rest of the body, a esophagus with a cylindrical pharyngeal corpus without a median bulb, a narrow isthmus and an oval basal pharyngeal bulb with strong transverse/butterfly valve apparatus, a tail curved ventrally, ending in dorsally hooked end; the male with seven pairs of latero-ventral pre-anal papillae and three pairs of post-anal in the following positions: one pair latero-ventral and two pairs dorso-lateral and two slightly curved spicules with asymmetric manubrium with an anterior extension. The comparison of the morphometrics of our G. galapagoensis male with that of the original description shows that the body length is shorter, as are the distance of the excretory pore to the anterior end and the tail. On the other hand, the distance from the anterior end to the nerve ring and the esophagus length are greater. The head width, body diameter and spicule length are quite similar. We provide a morphological and morphometrical characterization of a G. galapagoensis second isolate and the first world report of molecular sequences belonging to this species.

Morphological and molecular characteristics of the species Cosmocerca commutata and C. ornata (Nematoda: Cosmocercidae) in Uzbekistan

Abstract. Ikromov EE, Kuchboev AE, Ikromov EF, Sümer N, Yildirimhan HS, Amirov OO, Zhumabekova B. 2023. Morphological and molecular characteristics of the species Cosmocerca commutata and C. ornata (Nematoda: Cosmocercidae) in Uzbekistan. Biodiversitas 24: 4609-4616. In studies on the helminth fauna of amphibians conducted by numerous researchers, two species of the genus Cosmocerca, namely Cosmocerca ornata (Dujardin, 1845) Diesing, 1861 and C. commutata (Diesing, 1851), have emerged as the most common and extensively studied. This paper elucidates the morphology and molecular characteristics of two nematode species, Cosmocerca commutata and C. ornata, found in the intestines of Pelophylax sp. and Bufotes pewzowi in the Ferghana Valley of Uzbekistan. The captured amphibians were individually kept in plastic bags with water and vegetation until the examination. It is the first record of B. pewzowi as a host for both species C. commutata and C. ornata. Standard methods were used for the fixation and processing of nematodes. These nematodes ?orphologically differ in body size, relative length of spicules and gubernaculum (C. commutata has twice the length of gubernaculum and spicules compared to C. ornata), shape and number of plectanes (C. commutata has 8 pairs of plectans and 4 pairs of caudal papillae, while C. ornata has 5 pairs of plectanes and 3 pairs of caudal papillae), and tail morphology and length. The morphological evidence supports that C. commutata and C. ornata commonly parasitize anurans in Uzbekistan. This study provides molecular data of both species and their sequences differed by 1.5% (6 bp) in the ITS1+5.8S+ITS2 region. Each species of them formed a well-supported clade in the phylogenetic tree. Our findings contribute to the comprehension of species and genetic diversity of the genus Cosmocerca in Uzbekistan.

Quantitative assessment of spicule length in Heligmosomoides spp. (Nematoda, Heligmosomidae): distinction between H. bakeri, H. polygyrus and H. glareoli.

Nematode spicules play a vital role in the reproductive activity of species that possess them. Our primary objective was to compare the lengths of spicules of the laboratory mouse (Mus musculus) – maintained isolate H. bakeri – with those of H. polygyrus from naturally infected wood mice (Apodemus sylvaticus). On a more limited scale, we also included H. glareoli from bank voles (Myodes glareolus), a species reputed to possess longer spicules than either of the 2 former species. In total, we measured 1264 spicules (H. bakeri, n = 614; H. polygyrus n = 582; and H. glareoli, n = 68). There was a highly significant difference between the spicule lengths of the Nottingham-maintained H. bakeri (mean = 0.518 mm) and H. polygyrus (0.598 mm) from 11 different localities across the British Isles. A comparison of the spicules of H. bakeri maintained in 4 different laboratories in 3 continents revealed a range in the mean values from 0.518 to 0.540 mm, while those of worms from Australian wild house mice were shorter (0.480 mm). Mean values for H. polygyrus from wood mice from the British Isles ranged from 0.564 to 0.635 mm, although isolates of this species from Norway had longer spicules (0.670 mm). In agreement with the literature, the spicules of H. glareoli were considerably longer (1.098 mm). Since spicules play a vital role in the reproduction of nematode species that possess them, the difference in spicule lengths between H. bakeri and H. polygyrus adds to the growing evidence that these 2 are quite distinct species and likely reproductively isolated.

Comparative and cladistic analyses of the species of the genus Pelodera Schneider, 1866 (Rhabditidae: Nematoda) belonging to the coarctata group

Three new species of the genus Pelodera Schneider, 1866 viz., P. indica sp. nov., P. adeeli sp. nov. and P. paratretzeli sp. nov. collected from dung beetles and P. cylindrica (Cobb, 1898) collected from soil samples, are described and illustrated. Pelodera indica sp. nov. is characterised by sexual dimorphism in anterior region, cupola-shaped tail with a spike; males having punctated, striated and lobed bursa with no genital papillae originating anterior to cloaca. Pelodera adeeli sp. nov. is characterised by coarsely annulated cuticle; relatively narrow stoma; tail conoid without spike; males with punctated, lobed bursa and nine pairs of genital papillae arranged in a 2/1+2+P+3+1 configuration. Pelodera paratretzeli sp. nov. is characterised by sexual dimorphism in anterior region, stoma wide with three well-developed metastegostomal denticles; tail cupola-shaped with a long spike; males having spicules fused distally up to 12–14% of spicule length; bursa peloderan, anteriorly closed and punctated with nine pairs of genital papillae arranged in a 3/2+P+3+1 configuration. Pelodera cylindrica is described with additional details. The comparative analysis as well as phylogenetic relationship of the species belonging to the coarctata group have been elaborated by incorporating scanning electron microscopic observations. Information on the biogeographical distribution has also been provided.

Description of Devibursaphelencus lordeganensis sp. n. (Ektaphelenchinae) from Iran

Summary A population of the genus Devibursaphelenchus was collected from the inner part of the decaying Persian oak tree (Quercus brantii) from Lordegan city of Chaharmahal va Bakhtiari Province, Iran. The morphological and molecular characters confirmed the new species, namely D. lordeganensis sp. n. The new species is characterised by female body length (768-1026 μm), lip region separated from the rest of the body by a slight constriction, obscure lines on lateral fields, stylet length long, slender, wide-lumened, tripartite, composed of a conus with an aperture about half its length, a conophore about equal with the conus, and a shaft, taller than (conus + conophore) length, lacking basal knobs or swelling, excretory pore ca three metacorpal lengths posterior to the base of the metacorpus, post-uterine sac (PUS) (36-67 μm long; 1.3-3.7 times longer than vulval body diam.), absence or vestigial of rectum and anus, posterior end of the body conical with a rounded tip (in some specimens with a spherical protruded projection at tail tip), males 668 to 815 μm long, presence of two pairs of caudal papillae (P2 and P3), spicule length (15-17 μm) with long and wide bladed condylus, triangular rostrum with a blunt tip and small bursa flap ending at the tail tip. The molecular phylogeny based on 28S rDNA revealed that the new species stands close to D. alienae (LC629160) and D. lini (FJ768944, AM396570). The measurements, line illustrations, light microscopy photographs and phylogenetic analysis are given for the new species. In addition, a key to the species of Devibursaphelenchus is given.

First Report of Root-Knot Nematode Meloidogyne enterolobii on Antirrhinum majus in China.

Antirrhinum majus L. is a medicinal and ornamental herb commonly grown in China. In October 2022, A. majus plants were observed stunted in growth with yellowish leaves and containing a large number of galls on roots in a field in Nanning, Guangxi, China (N22°47'23.35″, E108°23'4.26). Ten samples were collected randomly from rhizosphere soil and roots of A. majus. Second-stage juveniles (J2) were isolated from fresh soil with a Baermann funnel, and a mean of 36 ± 2.9 per 500 cm3 of soil was recorded. Gall roots were dissected using a microscope, where 2+ 0.42 males per sample were recovered. The species was determined to be Meloidogyne enterolobii based on morphological characteristics, including the female perineal pattern, and DNA studies. Female perineal patterns and morphometric data were similar to the original description of M. enterolobii Yang and Eisenback 1983 from Enterolobium contortisilquum (Vell.) Morong in China (Yang and Eisenback 1983). The measurements of males (n = 10) included body length, 1600.7 ± 55.32 (1421.3 to 1924.3) µm; body diameter = 41.3 ± 0.80 (37.8 to 45.4) µm, stylt length = 20.5 ± 0.40 (19.1 to 22.2) µm, spicules length = 30.0 ± 0.47 (28.2 to 32.0) µm and DGO = 4.5 ± 0.3 (3.8 to 5.2) µm. Measurements of J2 (n = 20) included body length, 441.9 ± 5.42 (403.2 to 493.3) µm; body diameter = 16.6 ± 0.30 (14.4 to 8.7) µm, a = 26.8 ± 0.54 (21.9 to 31.2), c = 8.7 ± 0.27 (6.4 to 10.8), stylet length = 12.6 ± 0.17 (11.2 to 14.3) µm, DGO = 3.8 ± 0.10 (2.9 to 4.8) µm, tail length = 51.6 ± 1.27 (42.3 to 63.1) µm and hyaline tail terminus length = 11.7 ± 0.15 (10.2 to 13.1) µm. These morphological characteristics are similar to the original description of M. enterolobii (Yang and Eisenback 1983). Pathogenicity tests were conducted on A. majus 'Taxiti' plants directly germinated from seeds in a 10.5-cm-diameter pot filled with 600 ml of sterilized peat moss/sand (1:1, v/v) soil in the glasshouse. After 1 week, fifteen plants were inoculated with 500 J2/pot (nematode culture collected from the original field) and five uninoculated plants served as a control. After 45 days, aboveground parts of all inoculated plants showed symptoms similar to those observed in the field. No symptoms were observed on control plants. The RF value of the inoculated plants was determined by the method of Belair and Benoit (1996) 60 days after inoculation, and the average was 14.65. J2 were used in this test and sequenced on 28S rRNA-D2/D3, ITS, COII -16SrRNA 3 region and confirmed to be M. enterolobii. Species identification was confirmed by using polymerase chain reaction primers D2A/D3B (De Ley et al. 1999), F194/5368r (Ferris et al. 1993), C2F3/1108 (Powers and Harris, 1993). The sequences obtained GenBank accession numbers OP897743 (COII), OP876758 (rRNA) and OP876759 (ITS) were 100% similar to other M. enterolobii populations from China (MN269947), (MN648519) and (MT406251). M. enterolobii is a highly pathogenic species and has been reported in vegetables, ornamental plants, guava (Psidium guajava L.), and weeds in China, Africa and America (Brito et al. 2004; Xu et al. 2004; Yang and Eisenback 1983). The medicinal plant Gardenia jasminoides J. Ellis was also infected by M. enterolobii in China (Lu et al. 2019). Of concern is its ability to develop on crop genotypes carrying RKN resistance genes in tobacco (Nicotiana tabacum L.), tomato (Solanum lycopersicum L.), soybean (Glycine max (L.) Merr.), potato (Solanum tuberosum L.), cowpea (Vigna unguiculata (L.) Walp.), sweetpotato (Ipomoea batatas (L.) Lam.), and cotton (Gossypium hirsutum L.). Consequently, this species was added to the European and Mediterranean Plant Protection Organization A2 Alert List in 2010. This is the first natural infection report of M. enterolobii in Guangxi, China on the medicinal and ornamental herb A. majus. Acknowledgments This research was funded by the National Natural Science Foundation of China (31860492), Natural Science Foundation of Guangxi (2020GXNSFAA297076), and Guangxi Academy of Agricultural Sciences Fund, China (2021YT062, 2021JM14, 2021ZX24).

Two new species of Dichelyne Jägerskiöld, 1902 (Nematoda: Cucullanidae) parasitising marine fishes in Iraq.

Recent examinations of some marine fishes from off the southern coast of Iraq revealed the presence of two new species of Dichelyne (Dichelyne) Jägerskiöld, 1902 (Nematoda: Cucullanidae), both intestinal parasites, namely: D. (D.) lethrini n. sp. from the smalltooth emperor Lethrinus microdon Valenciennes (Lethrinidae, Acanthuriformes) and D. (D.) iraqiensis n. sp. from the humphead snapper Lutjanus sanguineus (Cuvier) (Lutjanidae, Acanthuriformes). Specimens are described and illustrated based on light and scanning electron microscopical examinations. Dichelyne (D.) lethrini n. sp. is mainly characterised by the length of spicules (522 µm), presence of a dorsal caecum, location of deirids at the level of the posterior end of oesophagus and the post-oesophageal position of the excretory pore, number (10 pairs) and distribution of caudal papillae in the male, and the presence of two minute terminal spines on the female tail tip. Dichelyne (D.) iraqiensis n. sp. differs from the species of the subgenus Dichelyne mainly based on the absence of caudal spines, the presence of a dorsal caecum, the length of spicules (789-884 µm), the location of deirids and the excretory pore approximately at the same level, and the size of eggs (72-78 × 42-51 µm). These new species infecting marine fishes in Iraq represent new geographic records of cucullanids of the subgenus Dichelyne from fishes in marine waters off Iraq.

First Report of Aphelenchoides besseyi Causing White Tip Disease of Rice in Heilongjiang Province of China.

Aphelenchoides besseyi is considered one of the most damaging plant parasitic nematodes to rice and can cause white tip disease. It was first discovered in Kyushu, Japan in 1915 and introduced into China from Japan in the 1940s. The disease is mainly found in rice-planting areas in South China (Zhu et al. 2016; Wang et al. 2017; Xu et al. 2019), causing yield losses of 30%-50% in irrigated rice (Wang et al. 2014). In summer 2021, rice plants displaying distortion and discoloration on new leaves, white tips on flag leaves, erect and shorter panicles, and fewer or less filled spikelets were observed in the rice field in Acheng district, Harbin city, Heilongjiang Province, China (13°32'33″S, 58°48'51″W). Plant samples with the typical symptoms of 'white tip' in the flag leaves were collected and transported to the laboratory for further pathogen identification. Nematodes were extracted from the leaves and panicles of diseased plants using Baermann funnel method, and the population density of nematode was an average of 57 individuals per sample (total 28 diseased samples). The main morphological characteristics of females (n = 20) and males (n = 15) were individually determined using a microscope (LEICA, DM2500). Female body was slender, and straight to ventrally curved when heat-relaxed, with a rounded cephalic region, the lateral field with four incisures, the excretory pore close to the anterior edge of the nerve ring, a narrow post-vulval sac and less than 1/3 the distance from the vulva to the anus, and a conoid tail with star-shaped mucro. Female measurements: body length = 724.6 (593.3 to 867.5) μm, stylet = 11.7 (10.9 to 12.5) μm, tail length = 39.4 (35.8 to 44.4) μm, a = 45.2 (38.6 to 51.0), b = 10.1 (9.4 to 10.7), c = 18.47 (14.7 to 21.4), and V = 71.1 (65.0 to 79.6). The body of male usually showed in a 'J' shape when relaxed, spicule length between 17.1 and 19.4 μm, and a conoid tail, with terminal mucro bearing two to four pointed processes. Male measurements: body length = 546.3 (521.7 to 587.6) μm, stylet = 11.9 (10.7 to 12.6) μm, tail length = 32.54 (29.53 to 34.35) μm, a = 37.7 (35.7 to 40.4), b = 8.7 (8.5 to 9.1), c = 17.8 (15.8 to19.4). The key morphological characteristics were coincident with the description of A. besseyi by Christie (1942), Ou et al. (2014) and Chen et al. (2020). DNA was extracted from six fresh nematodes, and the partial 18S-rRNA was amplified with a pair of primers 1813F/2646R (5'-CTGCGTGAGAGGTGAAAT-3'; 5'-GCTACCTTGTTACGACTTTT-3') (Holterman et al. 2006). PCR products of expected size were purified and sequenced. The newly obtained sequence (accession no. ON629604) was submitted to GenBank and displayed more than 99.5% identity with that of A. besseyi isolates (KT943536, KT454963, JQ957877). Additionally, the isolated nematodes were further confirmed using the species-specific primers Abess_11F/Abess_11R (5'-GTATTCAATCCCGCGACACT-3'; 5'-CATCCTGTTCGGGCATAGTT-3'), and the PCR amplification generated a 570 bp fragment which was specific to the 28S rDNA region of A. besseyi reported previously (Noronha et al. 2020). The pathogenicity test was confirmed in a pot assay. Approximately 2000 mixed-stage A. besseyi (juveniles, males and females) were obtained from the field-diseased rice plants, and ten-day-old rice seedlings (Japonica rice variety, Keyou 1) (n = 5) were inoculated with 400 nematodes per seedling and maintained in a greenhouse. During early growth stages (fifty days after inoculation), some young leaves of infected plants showed the chlorotic tips. Ninety days after inoculation, similar field symptoms (white tip on leaves) were observed on the aerial tissues of the inoculated plants, and an average of 237 A. besseyi were re-isolated from each plant. To the best of our knowledge, this is the first report of A. besseyi on rice plant in Heilongjiang Province of Northeast China. This finding indicates that A. besseyi could become a severe threat to rice production in Heilongjiang Province and contributes to the further inspection and prevention of white tip disease in rice-growing areas of Heilongjiang Province.

First Report of Meloidogyne incognita on Daylily (Hemerocallis citrina) in Shaanxi, China.

Daylilies (Hemerocallis citrina Baroni) are herbaceous perennials grown extensively as ornamental plants worldwide. In China, daylilies are important cash crops, which are used for their roots, leaves, and flowers as both food and medicine (Guo et al., 2022). Dali County, Shaanxi Province, is an important production region for the commercial cultivation of daylily in China. The daylily cultivation area of Dali County was 43.33 million m2 and the output reached 227 thousand kg, which worth more than 109.12 million dollars. In July 2021, numerous daylily plants (cv. Shayuan) showed chlorotic leaves and stunted growth in a field in Dali County. The area of daylily field we investigated was about 2000 m2, and the incidence of root-knot nematode disease was more than 90%. The inflorescences of diseased plants decreased by nearly 30%, which affected the yield seriously. The diseased plants exhibited obvious galling on the roots which were typical symptoms of infection by root-knot nematodes (RKNs). Population densities of second-stage juveniles (J2s) ranged from 300 to 350 in 100g soil layer of 10-20 cm. Nematodes were collected from root samples (n = 15) and were found in all of the diseased plant samples. Morphological and molecular analysis were conducted using females, males, and J2s. The perineal patterns of females (n = 20) showed a high dorsal arch, and with wavy striae, which mostly lacking obvious lateral lines. Morphological measurements of adult females (n = 20) include body length (BL) = 668.99 ± 24.56 (487.57-897.84) μm, body width (BW) = 433.73 ±12.84 (343.71-551.61) μm, stylet length = 15.64 ± 1.45 (10.86-28.26) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 2.57 ± 0.20 (1.41-3.68) μm, vulval slit length = 20.44 ± 0.91 (16.00-24.22) μm, and vulval slit to anus distance = 18.05 ± 1.06 (14.58-24.90) μm. The males showed a trapezoidal labial region, with a high head cap and concaved at the center of the top end in lateral view; and the stylet knobs were prominent, usually demarcated from the shaft. The morphological characters of males (n = 7) were as follows: BL = 1124.56 ± 53.97 (998.37-1336.52) μm, BW = 33.60 ± 0.79 (30.21-36.52) μm, stylet length = 23.63 ± 0.78 (20.14-26.37) μm, DGO = 3.04 ± 0.09 (2.69-3.38) μm, spicule length = 25.72 ± 0.57 (23.97-28.33) μm. The key morphometrics of J2s: BL = 439.13 ± 6.52 (398.32-481.33) μm, BW = 15.14 ± 0.26 (13.91-16.66) μm, stylet length = 13.44 ± 0.29 (10.96-14.60) μm, DGO = 2.13 ± 0.18 (1.22-3.10) μm, tail length = 57.46 ± 4.89 (38.85-101.33) μm, hyaline tail terminus = 16.93 ± 0.97 (11.45-22.54) μm. The morphological features of the females, males, and J2s match the original description of Meloidogyne incognita (Eisenback and Hirschmann, 1981). Eleven individual females were transferred to eleven different tubes for DNA extraction and the species-specific primers Mi2F4/Mi1R1 (ATGAAGCTAAGACTTTGGGCT/TCCCGCTACACCCTCAACTTC) were used for the identification of M. incognita (Kiewnick et al. 2013). A 300 bp target fragment was amplified by the primer pairs, confirming the RKNs collected from daylily plants were M. incognita. To confirm the result of species identification, the NADH dehydrogenase subunit 5 (nad5) from the mitochondrial DNA region was amplified using primers NAD5-F/R (TATTTTTTGTTTGAGATATATTAG/CGTGAATCTTGATTTTCCATTTTT) (Janssen et al. 2016). A fragment of 611 bp was obtained and the sequence (GenBank Accession No.OP115729) was 100% identical to the known sequence of M. incognita (GenBank Accession No. MT683461). The ITS region was amplified using the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992). The sequences from the ITS region were 768 bp (GenBank Accession No. OP095037) and showed 100% identical to the known sequence of M. incognita (GenBank Accession No. MH113856). An infection test was conducted in greenhouse conditions. Eighteen 5-weeks-old healthy daylily seedlings (cv. Shayuan) were individually cultured in 9 L pots filled with autoclaved-soil and each plant was inoculated with 3,000 J2s. Six non-inoculated daylily plants served as negative controls. After 60 days, all of the inoculated plant roots showed galling symptoms which were similar to those observed in the field, the nematodes were extracted from roots and were identified as M. incognita with the sequence-specificprimers Mi2F4/Mi1R1. No obvious symptoms were observed on control plants. An average of 9635 J2s were recovered from inoculated plants, (reproductive factor = 3.21), which confirmed the pathogenicity of M. incognita on daylily. Although it was reported that daylily was a host of M. incognita in Florida (Inserra et al. 1995), to our knowledge, this is the first evidence that M. incognita naturally infecting daylily in China. This root-knot disease leads to the yield reduction of daylily and may cause serious economic losses, so further studies should focus on the occurrence and effective control of this disease.

A New and Practical Method for Measuring Sponge Spicules

Binocular light microscopy (BLM) is an excellent match for a scanning electron microscope (SEM) and a trinocular light microscope equipped with a micrometer (TLM). The practicality, user-friendliness, and short-time analysis of BLM make this method a good choice for spicule analysis. However, its effectiveness and accuracy are yet to be confirmed. This study aimed to validate the effectiveness of BLM by comparing its usefulness to both TLM and the gold standard methods. BLM was first subjected to measuring megascleres and microscleres of 2 sponges. Then, by using the If function built-in Excell and t-test in SPSS 16.0, the compatibility of BLM was evaluated against SEM by measuring the length of spicules from 4 Sangihe sponges and their counterpart species from different locations. Furthermore, the t-test analysis was used to validate the compatibility and effectiveness of our method to the TLM by measuring the spicules of four sponges. Both the F-function and the t-test analysis proved BLM was compatible with SEM with both measurements showing a perfect match for megascleres typed spicules of 4 compared sponges. This new technique also showed a perfect match with SEM (p = 0.367, t-test) and with TLM (p = 0.963, t-test). Keywords: Spicules, sponges, SEM, Wallacea, biomaterial, sponge taxonomy