ITS rRNA Gene Sequences Research Articles

Morphological and Molecular Diversity among Pin Nematodes of the Genus Paratylenchus (Nematoda: Paratylenchidae) from Florida and Other Localities and Molecular Phylogeny of the Genus.

Pin nematodes (Paratylenchus spp.) are root parasites found worldwide. They have different life cycles and feeding habits and can damage a wide range of plants. A remarkable diversity of pin nematode species was found in soil samples from Florida and other states of the USA, Canada, and Spain. Using integrative taxonomy, two new species (Paratylenchus hawaiiensis sp. n. and P. roboris sp. n.), six valid species (Paratylenchulus acti, P. aquaticus, P. goldeni, P. paralatescens, P. minutus (=P. shenzhenensis syn. n.), and P. straeleni), and two undescribed species were identified from Florida; P. goldeni, P. hamatus, P. hamicaudatus, P. holdemani, and P. pedrami were found in California, P. minutus in Hawaii, P. goldeni in Oregon and Washington, and one new species, Paratylenchus borealis sp. n., in Alaska. Outside the USA, Paratylenchus projectus was detected in samples from Canada and Spain as well as P. holdemani and Paratylenchus sp. from Spain. The pin nematode species from Belgium and Russia identified in former studies as Paratylenchus sp. F was herein described as a new species with the name of P. borealis sp. n., using a population from Alaska. Previously reported molecular type A of P. aquaticus from Hawaii was reclassified as P. hawaiiensis sp. n., using a population from Florida. Paratylenchus roboris sp. n. from Florida has obese sedentary females with a stylet 63-71 µm long. The results of the molecular analysis of P. shenzhenensis from Florida and China indicated that it was conspecific with P. minutus from Hawaii and considered here as its junior synonym. New 26 D2-D3 expansion segments of 28S rRNA, 17 ITS rRNA, and 20 COI gene sequences were obtained in this study. Phylogenetic relationships of Paratylenchus are reconstructed using the D2-D3 of 28S rRNA, ITS rRNA, and COI gene sequences. Congruence of molecular and morphological evolution and species identification problems are discussed. Obese females were found in two major clades of Paratylenchus. The problem of reference materials is discussed, and it is proposed to make more efforts to collect topotype materials of known Paratylenchus species for molecular study.

Diversity characterization of bacteria and fungi in water, sediments and biofilms from Songhua River in Northeast China

Water, sediments, and biofilms are the typical microbial carriers in natural water environments. However, comparative analysis of the distribution of bacterial and fungal communities in different carriers within the same habitat is relatively lacking. Therefore, this study employed 16 S and ITS rRNA gene sequencing to identify bacterial and fungal community structures in water, sediments, and biofilm. The results show that (1) the OTUs numbers revealed that the bacterial abundance, at the levels of species, genus, and family, followed the order of sediments > water > biofilms, while the fungal abundance order was water > sediments > biofilms. In addition, bacteria were mainly present in sediments, while fungi were mainly present in water. (2) The α diversity index (Shannon, ACE, Simpson, and Chao1) order, for bacteria was: sediments > water > biofilms, indicating that the diversity and homogeneity of bacteria in sediments were relatively higher; for fungi was: water > sediments > biofilms, indicating that the diversity and abundance of fungi in water were high. (3) The core phylum of bacterial in the water, sediments, and biofilms was Cyanobacteria (31.3–46.1%) and Actinobacteria (27.6–36.1%); Proteobacteria (35.0–41.8%), Cyanobacteria (14.7–36.6%); and Proteobacteria (63.3–69.2%), respectively. (4) The mainly colonized fungal phyla in biofilms in the water, sediments, and biofilms were Basidiomycota (29.3–38.7%) and Ascomycota (16.2–27.7%); Zygomycota (13.1–17.5%), Basidiomycota (5.6–17.6%); and Zygomycota (23.8–44.2%). (5) There were significant species differences in bacterial and fungal communities in water, sediments, and biofilm by NMDS analysis. Findings are useful for guiding significance for the Biogeochemical cycle of elements, the environmental fate of pollutants, and the study of water ecosystems.

Dynamics of Fine Root Decomposition in Different Vegetation Types: Investigating the Impact of Soil Fungal Communities and Enzyme Activities

Fine root decomposition plays a vital role in driving the carbon cycle in terrestrial ecosystems, as it constitutes a substantial part of annual net primary production and, as transient tissues, returns to the soil within relatively short timescales. Soil fungal communities and enzyme activities strongly influence this process. In this study, we used an in situ soil core decomposition method to compare the fine root decomposition rates of Liriodendron chinense (Hemsl.) Sargent, Cunninghamia lanceolata (Lamb.) Hook, and Phyllostachys edulis (Carrière) J.Houz forests over a 1-year period (March 2021–March 2022). We quantified the chemical attributes of fine roots and soil enzymatic activities across different forests, detected fungal communities via ITS rRNA gene sequencing, and forecasted fungal functional groups using the FUNGuild database. The results showed that fine root decomposition was fastest in the Liriodendron chinense (Hemsl.) Sargent forest (77.2%) and the slowest for Cunninghamia lanceolata (Lamb.) Hook (59.2%). Structural equation modeling (SEM) results indicated that the carbon content of fine roots and the functional groups of soil fungi are crucial to fine root decomposition. They not only directly influence fine root decomposition but also promote it through soil enzymatic activities, clearly suggesting that changes in soil enzymatic activities can be employed to explain the ecological effects of the root decomposition process. This study illuminates significant differences in the chemical characteristics of fine roots, soil enzymatic activities, and soil fungal communities among different forest types, all of which significantly affect fine root decomposition.

Dodder Parasitism Leads to the Enrichment of Pathogen Alternaria and Flavonoid Metabolites in Soybean Root

Dodders (Cuscuta chinensis) are rootless and holoparasitic herbs that can infect a variety of host plants, including the vitally important economic and bioenergy crop soybean (Glycine max). Although dodder parasitism severely affects the physiology of host plants, little is known about its effects on fungal communities and root secondary metabolites in hosts. In this study, variations in root-associated fungal communities and root metabolites of soybean under different parasitism conditions were investigated using ITS rRNA gene sequencing and UPLC–MS/MS metabolome detection technologies. The results showed that dodder parasitism significantly altered the composition and diversity of the fungal communities in the rhizosphere and endosphere of soybean. The relative abundance of the potential pathogenic fungus Alternaria significantly increased in the root endosphere of dodder-parasitized soybean. Furthermore, correlation analysis indicated that the fungal community in the root endosphere was susceptible to soil factors under dodder parasitism. Meanwhile, the content of soil total nitrogen was significantly and positively correlated with the relative abundance of Alternaria in the rhizosphere and endosphere of soybean. Metabolomic analysis indicated that dodder parasitism altered the accumulation of flavonoids in soybean roots, with significant upregulation of the contents of kaempferol and its downstream derivatives under different parasitism conditions. Taken together, this study highlighted the important role of dodder parasitism in shaping the fungal communities and secondary metabolites associated with soybean roots, providing new insights into the mechanisms of multiple interactions among dodder, soybean, microbial communities and the soil environment.

Differential distribution patterns and assembly processes of soil microbial communities under contrasting vegetation types at distinctive altitudes in the Changbai Mountain.

Diversity patterns and community assembly of soil microorganisms are essential for understanding soil biodiversity and ecosystem processes. Investigating the impacts of environmental factors on microbial community assembly is crucial for comprehending the functions of microbial biodiversity and ecosystem processes. However, these issues remain insufficiently investigated in related studies despite their fundamental significance. The present study aimed to assess the diversity and assembly of soil bacterial and fungal communities to altitude and soil depth variations in mountain ecosystems by using 16S and ITS rRNA gene sequence analyses. In addition, the major roles of environmental factors in determining soil microbial communities and assembly processes were further investigated. The results showed a U-shaped pattern of the soil bacterial diversity at 0-10 cm soil depth along altitudes, reaching a minimum value at 1800 m, while the fungal diversity exhibited a monotonically decreasing trend with increasing altitude. At 10-20 cm soil depth, the soil bacterial diversity showed no apparent changes along altitudinal gradients, while the fungal Chao1 and phylogenetic diversity (PD) indices exhibited hump-shaped patterns with increasing altitude, reaching a maximum value at 1200 m. Soil bacterial and fungal communities were distinctively distributed with altitude at the same depth of soil, and the spatial turnover rates in fungi was greater than in bacteria. Mantel tests suggested soil physiochemical and climate variables significantly correlated with the β diversity of microbial community at two soil depths, suggesting both soil and climate heterogeneity contributed to the variation of bacterial and fungal community. Correspondingly, a novel phylogenetic null model analysis demonstrated that the community assembly of soil bacterial and fungal communities were dominated by deterministic and stochastic processes, respectively. The assembly processes of bacterial community were significantly related to the soil DOC and C:N ratio, while the fungal community assembly processes were significantly related to the soil C:N ratio. Our results provide a new perspective to assess the responses of soil microbial communities to variations with altitude and soil depth.

Two new species of sedentary nematodes of the genus Meloidodera Chitwood, Hannon & Esser, 1956 (Tylenchida: Heteroderidae) from Mexico

Summary Two new species of the genus Meloidodera collected in Mexico are described here: M. ferrisi sp. n. parasitising roots of an oak tree in the State of Mexico and M. tecoacensis sp. n. parasitising roots of buffalo bur nightshade in the Tlaxcala State. Meloidodera ferrisi sp. n. is characterised by a spherical female body covered completely by a dark thick cuticular layer, length/width of the female body = 0.8-1.6, stylet = 35-43 μm and second-stage juvenile with average body = 340 μm and average tail length = 35.6 μm. Meloidodera tecoacensis sp. n. is characterised by the female having a spherical body covered with a yellow transparent material, length/width of the female body = 1.1-2.8, stylet = 20-33 μm and second-stage juvenile with average body = 340 μm and average tail length = 29.8 μm. These two species were molecularly characterised using the D2-D3 expansion segments of 28S rRNA, ITS rRNA and COI gene sequences. Phylogenetic analysis revealed that the two new species represent a separate evolutionary lineage within the subfamily Meloidoderinae. An identification key for 12 Meloidodera species is provided.

Piriformospora indica alter root-associated microbiome structure to enhance Artemisia annua L. tolerance to arsenic

Microorganisms in the rhizosphere are crucial allies for plant stress tolerance. Recent research suggests that by interacting with the rhizosphere microbiome, microorganisms can aid in the revegetation of soils contaminated with heavy metal(loid)s (HMs). However, it is unknown that how Piriformospora indica influences the rhizosphere microbiome to mitigate arsenic-toxicity in arsenic-enriched environments. Artemisia annua plants were grown in the presence or absence of P. indica and spiked with low (50) and high (150 µmol/L) concentrations of arsenic (As). After inoculation with P. indica, fresh weight increased by 37.7% and 10% in control and high concentration treated plants, respectively. Transmission electron microscopy showed that cellular organelles were severely damaged by As and even disappeared under high concentration. Furthermore, As was mostly accumulated by 5.9 and 18.1 mg/kg dry weight in the roots of inoculated plants treated with low and high concentrations of As, respectively. Additionally, 16 S and ITS rRNA gene sequencing were applied to analyze the rhizosphere microbial community structure of A. annua under different treatments. A significant difference was observed in microbial community structure under different treatments as revealed by non-metric multidimensional scaling ordination. The bacterial and fungal richness and diversity in the rhizosphere of inoculated plants were actively balanced and regulated by P. indica co-cultivation. Lysobacter and Steroidobacter were found to be the As-resistant bacterial genera. We conclude that P. indica inoculation could alter rhizosphere microecology, thereby mitigating As-toxicity without harming the environment.

Impacts of Different Reforestation Methods on Fungal Community and Nutrient Content in an Ex-Tea Plantation

Long-term monocultures of tea and the excessive use of chemical fertilizer lead to the degradation of soil quality. Improving the soil quality of ex-tea plantations through vegetation restoration is an important task. However, the changes in soil nutrients, fungal communities, and the effects of microorganisms on soil nutrients after reforestation remain unclear. Therefore, in this study, we aimed to explore the effects of Pinus and Chinese fir on soil nutrients and fungal communities in ex-tea plantation areas that were subjected to the reforestation modes of pure forest and mixed forest by measuring soil chemical properties and ITS rRNA gene sequences. The results showed that (1) after reforestation, the relative normalized difference vegetation index (NDVI) of the Mixed forest, Mixed Pine and Mixed Fir areas increased (p < 0.05) compared to that of pure forest; (2) the soil organic carbon (SOC), total nitrogen (TN), and N:P ratios of the mixed forest increased by an average of 54%, 90%, and 299% (p < 0.05) compared to pure forest, whereas the total phosphorus (TP) and available potassium (AK) decreased by an average of 39% and 89% (p < 0.05); and (3) there was no significant difference in the diversity of the fungal communities of the pure and mixed forests, but the fungal phyla Mucoromycota, Glomeromycota, and Rozellomycota were significantly different in the pure and mixed forests. This differing microbial composition led to a significant increase (p < 0.05) in symbiotrophs (ecotomycorhizal, ericoid mycorhizal) in the mixed forest, which was negatively correlated with the soil TP and positively correlated with the TN and the N:P ratio. In addition, there was also a significant decrease (p < 0.05) in complex nutrient types (ectomycorrhizal-fungal parasite-plant saprotroph-wood saprotroph), which were negatively correlated with the SOC and TN, and arbuscular mycorrhizas, which were positively correlated with the TP. Our results show that the chemical properties of soils and the structure of the fungal communities changed significantly due to the reforestation of Chinese fir and Pinus, and the mixed forest mode of reforestation was more conducive to improving the soil quality; therefore, a mixed forest of Chinese fir and Pinus can be used to improve degraded soils in ex-tea planting areas.

The characters of root-derived fungi from Gentiana scabra Bunge and the relations with their habitats

Aims Gentiana scabra Bunge (gentian) is one of the best-known traditional Chinese medicinal plants and its dry roots and rhizomes are usually used as medicine. To our knowledge, the main active metabolites of gentian, such as gentian polysaccharide and gentiopicroside, determine the quality and pharmaceutical effect of gentian. The root-derived fungi including endophytic fungi and rhizosphere fungi are key factors which affect the secondary metabolism and the utilization of soil nutrients of gentian. Therefore, it is necessary to investigate the characteristics and dynamics of root-derived fungi related to gentian, as well as their relationships with the quality of gentian.MethodsThe population, diversity, and the dominant type of endophytic and rhizosphere fungi in gentian were determined by using ITS rRNA gene amplicon and sequencing methods. The potential influences of different habitats on fungi communities and the correlation between fungi communities, the main active metabolites of gentian and soil physicochemical properties were analyzed by statistical methods.ResultsThe population and diversity of endophytic and rhizosphere fungi varied with both habitats and growth stages, showing a significant difference. Among them, the predominant genera of endophytic fungi were Lecidella, Leptoshaeria and unclassified_p_Ascomycota with the relative abundance of 35.1%, 9.0% and 7.3%, respectively, while the predominant genera of rhizosphere fungi were complicated. Compared to endophytic fungi, the diversity of rhizosphere fungi was obviously affected by soil physicochemical properties, including pH, water content, alkali hydrolysis nitrogen (AN), available phosphorus (AP), etc. Additionally, we found that the accumulation of gentiopicroside was positively correlated with endophytic fungi of Epicoccum and rhizosphere fungi of Mortierella, Solicoccozyma, Talaromyces and Trichoderma. The accumulation of gentian polysaccharide was negatively correlated with endophytic fungi of Lenzites, Mucor, Myrothecium and Saccharomycopsis and rhizosphere fungi, such as Botrytis, Cadophora, Cladophora, Didymela, Fusarium, etc.ConclusionsIn this work, the differences on population, diversity, and the dominant type of endophytic fungi and rhizosphere fungi in gentian were revealed. The relationship between the main active metabolites of gentian and root-derived fungi, and the relationship between soil physicochemical properties and root-derived fungi were clarified, respectively. It is believed that our work will guide to explore strategies on improving the quality of gentian by regulating soil factors and root-derived microbial community structure with microorganisms.

First Report of Meloidogyne graminicola Naturally Infecting Cyperus difformis in China.

Cyperus difformis is a problematic annual weed in rice fields and is widely distributed throughout tropical to warm temperate regions of the world. In June 2019, many galls were observed on the roots of C. difformis growing in rice fields in Heshan District, Hengyang City, Hunan Province, China. The infected plants did not exhibit obvious aboveground symptoms. Females, males, eggs, and second-stage juveniles (J2s) of Meloidogyne spp. were found within galls after dissection. The perineal patterns of females were dorsoventrally oval shape with low and round dorsal archs, smooth striae, and lacking distinct lateral lines. Morphological measurements of females (n = 20) included body length (L) = 589.4 ± 64.7 (482.1 to 693.8) μm, body width (BW) = 362.2 ± 84.6 (267.6 to 505.9) μm, stylet = 11.7 ± 1.5 (9.7 to 14.4) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 3.8 ± 0.6 (3.3 to 5.0) μm, vulval slit length = 23.7 ± 4.4 (15.5 to 28.9) μm, vulval slit to anus distance = 16.8 ± 2.7 (13.1 to 19.4) μm. The J2s were vermiform and had a long and slender tail with tapering hyaline tail terminus. Measurements of J2s (n = 20) were L = 464.4 ± 31.7 (415.0 to 508.3) μm, BW = 16.9 ±1.7 (14.1 to 19.7) μm, stylet = 13.2 ± 0.6 (12.5 to 14.9) μm, DGO = 3.3 ± 0.5 (2.6 to 4.4) μm, tail = 71.6 ± 5.5 (65.1 to 82.0) μm, hyaline tail length = 19.4 ± 2.6 (15.3 to 23.9) μm. These morphological characteristics were similar to those previously described for M. graminicola (Golden and Birchfield 1965). Genomic DNA extracted from a single J2 was used for molecular identification. The ITS rRNA gene and the mtDNA COII-16S rRNA region were amplified using primers 18s/26s (TTGATTACGT CCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and C2F3/1108 (GGTCAATGT TCAGAAATTTGTGG/TACCTTTGACCAATCACGCT), respectively (Powers and Harris 1993; Vrain et al. 1992). Both the ITS rRNA gene sequence (790 bp, GenBank accession no. MZ656127) and the mtDNA COII-16S rRNA region sequence (531 bp, OM161973) showed 100% identity with sequences of M. graminicola (e.g., MN647593, MG773553, MF320126; MG356945, MH332687, JN241939). Furthermore, species identification was also further validated using the M. graminicola-specific primers SCAR-MgFW/SCAR-MgRev (GGGGAAGACATTTAATTGATGATCAAC/GGTACCGAAACTTAGGGAAAG) (Bellafiore et al. 2015). The PCR products yielded the expected fragment size of 640 bp, which was identical to that previously reported for M. graminicola (Bellafiore et al. 2015). To verify the pathogenicity of this nematode, 15 30-day-old C. difformis seedlings planted in pots with sterilized soil were inoculated with 400 freshly hatched J2s from the original population of M. graminicola per plant, and five non-inoculated seedlings were used as controls. All plants were grown in a greenhouse at 26 to 28 °C with a 16 h light/8 h dark photoperiod. At 30 days after inoculation, all inoculated plants showed gall symptoms on the roots identical to those observed in the fields. The nematode reproduction factor (final population/initial population) was 12.6. No symptoms were observed on non-inoculated plants. These results confirmed the pathogenicity of M. graminicola on C. difformis. To our knowledge, this is the first report of M. graminicola naturally infecting C. difformis in China. C. difformis is an alternative host of M. graminicola and could serve as a potential reservoir for M. graminicola in field. Therefore, weed management could be an effective way to reduce the disease by eliminating source of infection of M. graminicola.

Importance of soil labile organic carbon fractions in shaping microbial community after vegetation restoration

Studies have been increasingly focusing on soil carbon (C) pools to facilitate the sequestration and stabilisation of soil organic carbon (SOC). However, interactions between different SOC fractions and microbial communities have remained largely unexplored after vegetation restoration on the Loess Plateau. To address this gap, we analysed 16S and ITS rRNA gene sequencing, active SOC (Ca), slow SOC (Cs), passive SOC (Cp) and edaphic factors to decipher the importance of soil C fractions in shaping microbial communities after vegetation restoration. Compared to CK (Control, cropland), the average of SOC contents improved 70.52 % (p < 0.05), and the Ca, Cs and Cp improved 83.18 % (p < 0.05), 128.74 % (p < 0.05) and 18.69 % (p > 0.05). Under different land use types, the relative abundance of four bacterial phyla and two fungal phylum were > 80 % and 75 %, respectively. The Actinobacteria relative abundance in natural grassland and natural shrubland was higher than that in CK. The Shannon index, Chao index and OTUs of soil fungal and bacterial communities under CK were significantly lower than that of other land use types, except for artificial grassland (p < 0.05). The microbial communities transited from oligotrophic to copiotrophic groups according to the results of redundancy analysis (RDA), and the cumulative loads of two axes of RDA in bacterial and fungal communities approached 89.90 % and 88.19 %. The variation partitioning analysis showed that Ca and Cs exhibited large path coefficients in explaining the changes in soil microbial communities. And the microbial communities were mediated through change in labile organic C according to structural equation models, indicating that the structures and compositions of microbial communities were mainly under the control of labile SOC content after vegetation restoration. These results are referentially valuable for comprehending how to apply labile SOC in predicting variations of microbial communities and improving predictive ecosystem models for early-warning indicators of soil degradation.

Long-term fertilization altered microbial community structure in an aeolian sandy soil in northeast China.

Soil microorganisms play crucial roles in nutrient cycling and determining soil quality and fertility; thus, they are important for agricultural production. However, the impacts of long-term fertilization on soil microbial community remain ambiguous due to inconsistent results from different studies. The objective of this study was to characterize changes in bacterial and fungal diversity and community structures after 12 years of different fertilization in aeolian sandy soil by analyzing 16S rRNA and ITS rRNA gene sequences and the soil properties to discover the driving factors. Eight different fertilizer treatments have been set up since 2009: no fertilizer (CK), chemical N fertilizer (N), chemical N and P fertilizer (NP), chemical N, P and K fertilizer (NPK), pig manure only (M), pig manure plus chemical N fertilizer (MN), pig manure plus chemical N and P fertilizer (MNP), pig manure plus chemical N, P, and K fertilizer (MNPK). The results indicated that the long-term application of chemical fertilizer reduced soil pH, whereas the addition of pig manure alleviated a decrease in soil pH value. Chemical fertilizer plus pig manure significantly improved soil available nutrients and soil organic carbon. Long-term MNPK fertilization resulted in changes in bacterial diversity due to effects on specific bacterial species; by contrast, all fertilization treatments resulted in changes in fungal diversity due to changes in soil properties. Principal component analysis indicated that fertilization had a significant effect on soil microbial community structure, and the effect of chemical fertilizer combined with pig manure was greater than that of chemical fertilizer alone. Soil available phosphorus, total phosphorus, and pH were the most important factors that influenced bacterial taxa, whereas soil pH, total phosphorus, organic carbon, ammonium nitrogen and nitrate nitrogen were the most important factors influencing fungal taxa after 12 years of fertilization in aeolian sandy soil.

Soil Microbial and Organic Carbon Legacies of Pre-Existing Plants Drive Pioneer Tree Growth during Subalpine Forest Succession

Fast-growing pioneer tree species play a crucial role in triggering late successional development in forests. Experimental evidence of the soil legacy effects of pre-existing plants on pioneer tree performance is lacking. We explored the legacy effects of soils conditioned by early successional herbs (Poa poophagorum Bor and Potentilla fragarioides L.) and mid-successional shrubs (Rhododendron fortunei Lindl. and Enkianthus quinqueflorus Lour.) on late-successional ectomycorrhizal (ECM) pioneer tree (Betula platyphylla Sukaczev) seedling growth. The soils were analyzed for soil nutrient status and fungal and bacterial compositions using ITS and 16S rRNA gene sequencing. B. platyphylla seedlings produced higher biomass in soils conditioned by shrubs. Soil organic carbon (SOC) and bacterial and fungal legacies most impacted pioneer tree seedling growth. Additionally, the partial least squares path model revealed that soil nutrients, especially SOC, indirectly affected seedling biomass by their direct effects on the bacterial and fungal communities. The changes in bacterial community composition had a stronger effect on seedling biomass than those of fungi because bacteria with shorter turnover times are generally considered to be more efficient than fungi in enhancing nutrient availability. Our study integrates soil microbial and nutrient legacies to explain the potential mechanisms of pioneer tree regeneration.

DNA barcoding, phylogeny and phylogeography of the cyst nematode species of the Humuli group from the genus Heterodera (Tylenchida: Heteroderidae)

Summary The Humuli group of the genus Heterodera contains species that parasitise dicotyledons and are characterised by a lemon-shaped cyst having a bifenestrate vulval cone (ambifenestrate for H. fici), long vulval slit and weak underbridge. Presently, the Humuli group includes seven species: H. amaranthusiae, H. fici, H. humuli, H. litoralis, H. ripae, H. turcomanica and H. vallicola. In this study we provided comprehensive phylogenetic analyses of COI and ITS rRNA gene sequences of species from the Humuli group using Bayesian inference, maximum likelihood, and maximum and statistical parsimony. All seven valid species from the Humuli group, one putatively new species belonging to this group and the willow cyst nematode, H. salixophila, sharing a common ancestor with the Humuli group, were analysed. Some 84 COI and 5 ITS rRNA new gene sequences from 37 nematode populations collected from 12 countries were obtained in this study. Our results confirmed that the COI gene is a powerful DNA barcoding marker for identification of populations and species from the Humuli group. Based on the results of phylogeographical analysis and age estimation of clades with a molecular clock approach, it was hypothesised that some species of the Humuli group primarily originated and diversified in Western and Middle Asian regions during the Pleistocene and Holocene periods and then dispersed from this region across the world. Two secondary diversification centres of the Humuli group were likely located in East and Southeast Asia, Russian Far East, and Oceania.

Phylogeny of Amphidinium (Dinophyceae) from Guam and Okinawa, with descriptions of A. pagoense sp. nov. and A. uduigamense sp. nov.

ABSTRACT Marine benthic dinoflagellates within the genus Amphidinium were isolated from Guam and Okinawa. Isolated strains were identified to species-level using phylogenetic analyses of 28S rRNA and ITS-5.8S rRNA genes as well as microscopy. Of the six isolated strains, two were new species: A. pagoense sp. nov. and A. uduigamense sp. nov. Other isolates included strains of A. massartii and A. operculatum from Guam, and two strains of A. operculatum from Okinawa. Both new species were described using light and electron microscopy (SEM and TEM). The combination of characteristics that make A. pagoense sp. nov. unique includes a pair of centrally-located pyrenoids, variable cell shape, absence of scales and a long, curved ventral ridge. For A. uduigamense sp. nov., a combination of several morphological features distinguishes it from other species. These include a constriction near the anterior of the hypocone, two centrally located pyrenoids, a longitudinal flagellum inserted in the posterior one-third of the cell, cell size, cell division in the motile stage and the absence of scales. Toxicity was confirmed in these two novel species by testing methanol extracts in an Artemia bioassay. Previously unrecorded ITS rRNA gene sequences from A. operculatum were also sequenced from both locations. Species identified and newly described in this study expand the taxonomic knowledge of Amphidinium in the Pacific.

Assessment of cleaning techniques and its effectiveness for controlling biodeterioration fungi on wall paintings of Maijishan Grottoes

Biodeterioration is one of the main challenges in conservation of cultural heritage. This study tested and evaluated non-destructive methods to clean and control the microbial mycelia grown on the surface of wall paintings at the World Cultural Heritage Site of Maijishan Grottoes in China. Culture-dependent methods were used for isolation of fungi prior to identification by ITS rRNA gene sequences. The mycelia grown on the surface of wall paintings were removed with soft brushes under a negative pressure provided by a modified vacuum pump, and the pre-screened biocides were then selected and applied. Using a portable microscope, a microbial ATP bioluminescence detector, and a colorimeter, the effectiveness of cleaning and controlling against fungal mycelia on the wall paintings was evaluated. The results showed that the fungal isolates were dominated by Arachnomyces spp. with 92.28% sequence identity. Other major culturable fungal isolates were Parengyodontium album, Beauveria bassiana, and Scopulariopsis brumptii. The microscopic examination indicated the surface of the wall paintings was nearly free of visible fungal mycelia after the manual removal. There was a significant reduction of ATP bioluminescence before (43,303 ± 10, 280 RLU/cm2) and after (2,833 ± 388, RLU/cm2) the mechanical removal. The color difference (ΔE∗ab value) were less than 2.0 before and after biocide treatment, such difference could almost be ignored. Additionally, octylisothiazolinone was found to be the most efficient biocide for controlling fungal growth and could be an emergency protection measure. Furthermore, the key environmental factors that triggered periodic breakouts of the microorganisms on wall paintings were long-term higher relative humidity at the interface of earthen plaster layer and supporting sandstone during raining seasons and poor ventilation of the cave. This study provides a reference for the scientific conservation of biodeteriorated ancient wall paintings.

Chronic stress and captivity alter the cloacal microbiome of a wild songbird

There are complex interactions between an organism's microbiome and its response to stressors, often referred to as the 'gut-brain axis'; however, the ecological relevance of this axis in wild animals remains poorly understood. Here, we used a chronic mild stress protocol to induce stress in wild-caught house sparrows (Passer domesticus), and compared microbial communities among stressed animals, those recovering from stress, captive controls (unstressed) and a group not brought into captivity. We assessed changes in microbial communities and abundance of shed microbes by culturing cloacal samples on multiple media to select for aerobic and anaerobic bacteria and fungi. We complemented this with cultivation-independent 16S and ITS rRNA gene amplification and sequencing, pairing these results with host physiological and immune metrics, including body mass change, relative spleen mass and plasma corticosterone concentrations. We found significant effects of stress and captivity on the house sparrow microbiomes, with stress leading to an increased relative abundance of endotoxin-producing bacteria - a possible mechanism for the hyperinflammatory response observed in captive avians. While we found evidence that the microbiome community partially recovers after stress cessation, animals may lose key taxa, and the abundance of endotoxin-producing bacteria persists. Our results suggest an overall link between chronic stress, host immune system and the microbiome, with the loss of potentially beneficial taxa (e.g. lactic acid bacteria), and an increase in endotoxin-producing bacteria due to stress and captivity. Ultimately, consideration of the host's microbiome may be useful when evaluating the impact of stressors on individual and population health.

First Report of Meloidogyne enterolobii on Ormosia hosiei in China.

Ormosia hosiei is an evergreen tree that belongs to the family of Fabaceae. It is prized for ornamental and medicinal value and rosewood. In November 2020, galls were observed on roots of stunted O.hosiei plants in the Nanning arboretum (22°43'38″ N, 108°18'06″ E), Guangxi, China. Disease incidence was approximately 80% (150 plants evaluated). Females were obtained by dissecting galls and J2s were collected from a single egg mass hatching. The female white body was pear to globular-shaped with a distinct neck region, while the perineal pattern usually was oval-shaped with a moderately high dorsal arch. J2 bodies were translucent with narrow tails and pointed tips, with hyaline tail termini. Those morphological characters were consistent with description of Meloidogyne enterolobii (Yang and Eisenback 1983; Brito et al. 2004). Morphological measurements (mean, standard deviation and range) of J2s (n = 20) included body length= 436.07 ± 12.5 (411.8 to 464.3) µm, body width = 16.01 ± 1.1 (14.6 to 17.7) µm, stylet length = 12.4 ± 0.8 (11.3 to 13.5) µm, dorsal esophageal gland orifice to the stylet base (DGO) = 3.8 ± 0.3 (3.3 to 4.3) µm, tail = 53.6 ± 4.3 (48.9 to 60.6) µm, and hyaline tail length = 15.9 ± 1.5 (13.6 to 18.3) µm. Measurements of females (n = 20) were: body length = 669.5 ± 43.8 (549.9 to 709.4) μm, body width = 641.9 ± 45.2 (559.3 to 732.8) μm, DGO = 5.3 ± 0.52 (4.6 to 6.1) μm, and stylet length = 14.9 ± 0.86 (13.8 to 16.8) μm. These measurements were also consistent with M. enterolobii (Yang and Eisenback. 1983). The ITS rRNA gene sequence and D2-D3 expansion segment of 28S rDNA were amplified in the DNA of individual J2 using the primers 18S/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006 ). The sequences were submitted in the NCBI with GeneBank Accessions No. MZ617284 (766-bp) and OK072889 (759-bp). The homology of the genes was 99% to 100% identical to that of M. enterolobii in ITS rRNA gene sequence MT406251, MG773551, KF418369. The D2-D3 region of 28S rRNA gene revealed 100% identity with M. enterolobii sequences from MT193450, MF467276, MZ541997 etc. Neighbor-joining phylogenetic analysis showed that it was the most similar to M. enterolobii. For further confirmation, M. enterolobii species-specific primer pairs Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/ TCAGTTCAGGCAGGATCAACC) were used for amplification of the ribosomal intergenic spacer 2. An expected PCR fragment of approximately 236-bp was obtained (Long et al. 2006). Pathogenicity test was conducted in greenhouse with 26 to 30˚C temperature. Eggs were multiplied in the greenhouse using a single eggmass hand-picked from infested O. hosiei roots. Twelve eight-month-old O. hosiei healthy seedlings were inoculated with 5,000 eggs/pot containing autoclaved soil mix (clay: substrate =1:3, v/v), and 6 noninoculated seedlings were controls. After 10 weeks, the control plants displayed no symptoms. The roots of all inoculated plants showed galling symptoms. The reproduction factor (final population/initial population) was 5.2. Furthermore, the morphological and molecular identification of the nematode was identical to the original samples. M. enterolobii has a broad host range (Philbrick et al. 2020). To our knowledge, this is the first report of M. enterolobii parasitizing O. hosiei worldwide. This finding expands the host range of this nematode.

Linking carbon-degrading enzyme activity to microbial carbon-use trophic strategy under salinization in a subtropical tidal wetland

Although increasing studies have reported that microorganisms play an important role in carbon (C)-degrading enzyme activities under salinization, there is little experimental evidence for the associations between C-degrading enzyme activities and microbial community structure. Here, we examined the C-degrading enzyme activities, bacterial and fungal community abundance and composition (16S and ITS rRNA gene sequencing), soil organic carbon (SOC) storage, carbon/nitrogen (C/N) ratios, labile organic carbon (LOC) levels, and LOC/SOC ratios along an estuarine salinity gradient [range: 0.1–2.2 part per thousand (ppt)] of a subtropical tidal wetland. To help isolate salinity effects, sampling sites were selected to be similar in plant community composition, soil texture, and tidal influence. Our results indicated that the SOC storage, LOC levels, and LOC/SOC ratios decreased, whereas C/N ratios increased with salinization. The activities of β-1,4-glucosidase, cellobiohydrolase, phenol oxidase, and peroxidase increased by 485%, 147%, 699%, and 868%, respectively, with increasing salinity. The α-diversities of bacterial and fungal communities did not change, whereas the abundances of bacterial and fungal communities decreased with increasing salinity. Both bacterial and fungal oligotrophs/copiotrophs ratios were positively associated with salinity, suggesting that bacterial and fungal communities shifted from being copiotroph-dominated to oligotroph-dominated as salinity increased. All C-degrading enzyme activities were correlated with the relative abundance of typical bacterial and fungal oligotrophs, e.g., α-Proteobacteria, δ-Proteobacteria, Chloroflexi, Acidobacteria, and Basidiomycota. Overall, the C-degrading enzyme activities were co-determined by the C/N and LOC/SOC ratios and the fungal and bacterial oligotrophs/copiotrophs ratios. Our observations indicated that salinization influenced C-degrading enzyme activities via modulating substrate quality and lability and causing shifts in microbial C-use trophic strategies. Our proposed oligotrophic–copiotrophic scheme could be a novel method for incorporating vast taxonomic data of microbial communities into enzyme activity prediction in an ecologically meaningful manner.

Dynamics of the Gut Bacteria and Fungi Accompanying Low-Carbohydrate Diet-Induced Weight Loss in Overweight and Obese Adults.

BackgroundLow-carbohydrate (e.g., Atkins) dietary pattern is one of the most effective diets for weight loss, but little is known about the characteristics of the gut microbiota accompanying low-carbohydrate diets-induced weight loss. This study aims to profile dynamics of gut bacteria and fungi accompanying modified Atkins diets-induced weight loss among overweight and obese adults.MethodsOverweight and obese adults were screened to follow a modified Atkins diet plan (30% of energy from protein, 40% from carbohydrate and 30% from fat). We longitudinally profiled dynamics of gut bacteria and fungi based on 16S rRNA and ITS rRNA gene sequencing data, respectively.ResultsA total of 65 participants followed the modified Atkins diets for 20–231 days, with 61 and 27 participants achieving a weight loss of at least 5 and 10%, respectively. Most of the participants who achieved 10% weight loss also experienced improvements on metabolic health. The diversity of gut bacteria and fungi increased after a weight loss of 5% and kept stable thereafter. Bacteria genera including Lachnoclostridium and Ruminococcus 2 from Firmicutes phylum were depleted, while Parabacteroides and Bacteroides from Bacteroidetes phylum were enriched after weight loss. The inter-kingdom analysis found an intensive covariation between gut fungi and bacteria, involving more than half of the weight loss-associated bacteria.ConclusionsThis study confirmed the modulation of bacterial and fungal composition during weight loss with the low-carbohydrate diets and showed previously unknown links between intestinal bacteria and fungi accompanying the weight loss.