ITS Region Research Articles

Trichophyton mentagrophytes ITS genotype VII infections among men who have sex with men in France: An ongoing phenomenon.

Trichophyton mentagrophytes ITS genotype VII (TMVII) has recently been identified in France as the causative agent of dermatophyte infections transmitted during sexual activity among men who have sex with men (MSM). Our objective was to provide new insights into the epidemiology, clinical presentation and treatment of TMVII infections based on cases diagnosed from October 2022 to September 2023 in three medical mycology laboratories in Paris. Additionally, we aimed to perform molecular characterization of TMVII strains collected in Paris, as well as in Switzerland. We identified all isolates from skin and hair belonging to the T. mentagrophytes complex by sequencing the ITS region. For isolates corresponding to TMVII, clinical data were retrieved from medical records. For all available TMVII strains that we isolated since January 2021, we sequenced tef1α and tubb and determined the MAT locus idiomorph. We identified 32 cases of TMVII Infections. All cases occurred in men, 30 of whom reported having sex with men. Fifteen cases were sporadic cases including four among sex workers. The other 17 cases belonged to a single cluster involving a tantric masseur who infected 15 clients and his roommate. The median time from massage to lesion onset was 16 [2-52] days. Except for one patient, all other patients received systemic antifungal treatment with terbinafine. We observed five patients whose cultures remained positive even after 3-4 weeks of treatment and five patients experienced a relapse of the infection after discontinuing antifungal treatment. All French isolates exhibited identical tef1α and tubb sequences, as well as the same MAT idiomorph locus. They displayed variations in the tef1α sequence compared to isolates from Switzerland and the Czech Republic. We confirm the active circulation of TMVII among MSM in France, which is associated with challenges in diagnosis, treatment and prevention.

The Fungus Phlebiopsis flavidoalba’s Pathogenicity and Virulence Toward the Fluted Scale (Praelongorthezia acapulcoa) Pest of Rice and Sugarcane Crops

Sugarcane is one of the main crops in Morelos State, Mexico. The presence of the insect pest Praelongorthezia acapulcoa (Morrison), commonly known as the fluted scale insect, was observed in sugarcane and rice crops, causing losses of up to 30% of production in both crops. In this work, a fungus isolated from the mycosic cadavers of P. acapulcoa was identified as the basidiomycete Phlebiopsis flavidoalba (Cooke) Hjortstam via morphological and molecular identification using the ITS, tef 1, and 28S regions. Its pathogenicity toward P. acapulcoa was verified in laboratory tests, causing a mortality rate higher than 60%. Its virulence toward P. acapulcoa, estimated as the mean lethal concentration (LC50), was 9.7 × 106 conidia mL−1. This work constitutes the first report about a basidiomycete with direct entomopathogenic activity and biological control of the fluted scale insect, P. acapulcoa.

Assessing Normandy Soil Microbial Diversity for Antibacterial Activities Using Traditional Culture and iChip Methods

Uncultured microorganisms represent a promising and untapped source of antibacterial compounds, crucial in the fight against the significant threat of antimicrobial resistance (AMR). In this study, both traditional and isolation chip (iChip) cultivation techniques were employed to enhance the recovery of known and unknown microorganisms from soils located in Normandy, France. The isolates obtained were identified using 16S rDNA or ITS regions analysis and MALDI-TOF mass spectrometry and were screened for antibacterial activity. A total of 386 isolates, belonging to 6 microbial phyla and distributed across 65 genera, were recovered using both methods. In total, 11 isolates are potentially new bacterial species, and 34 were associated with 22 species described recently. The iChip method yielded a higher diversity of microorganisms (47 genera) than the traditional method (38 genera) and was particularly effective in enriching Actinomycetota. Antibacterial screening against target bacteria showed that 85 isolates (22%) exhibited antibacterial activity. The Streptomyces, Pseudomonas, and Bacillaceae taxa accounted for most antibacterial-producing bacteria with some presenting promising undescribed characteristics. Other active isolates were affiliated with less-known antibacterial producers such as Arthrobacter, Chryseobacterium, Delftia, Ensifer, Flavobacterium, Rahnella, and Stenotrophomonas, among others. These results highlight the potential of our microbial collection as a source of new antibacterial natural products.

Effects of Coffea canephora genotypes on the microbial community of soil and fruit

In recent years, the role of microbial communities in agricultural systems has received increasing attention, particularly concerning their impact on plant health and productivity. However, the influence of host plant genetic factors on the microbial composition of coffee plants remains largely unexplored. This study provides the first comprehensive investigation into how genotype affects the microbial communities present in the rhizosphere and fruits of Coffea canephora. Conducted on a commercial coffee farm in Brazil, we analyzed six genotypes of C. canephora var. Conilon. Soil and fruit samples were collected from which microbial DNA was extracted and sequenced, targeting the V3-V4 region of the 16 S rDNA and the ITS1 region for fungi. A total of 12,239,769 reads were generated from the 16 S rDNA and ITS1 regions. The PCoA revealed distinct patterns of beta diversity, with genotype 153 exhibiting significant isolation in soil bacterial communities. The dominant bacterial orders included Rhizobiales and Rhodobacterales, while the fungal community comprised diverse taxa from Saccharomycetales and Hypocreales. LEfSe analysis identified key metagenomic biomarkers, highlighting genotype Baiano 4 for its richness in fruit-associated taxa, whereas genotype 153 exhibited lower diversity in both soil and fruit samples. This work enhances our understanding of the microbiomes associated with different coffee genotypes, providing evidence of how host genetic variation influences microbial community composition. Our findings indicate that specific microbial taxa are enriched in the fruits and soil of various genotypes. Future research should focus on identifying these microorganisms and elucidating their specific functions within the rhizosphere and coffee fruits.

Molecular genetic and morphological characteristics of Micractinium thermotolerans and M. inermum (Trebouxiophyceae, Chlorophyta) from pyroclastic deposits of the Kamchatka Peninsula (Russia)

During the study of algal diversity in pyroclastic deposits of the Kamchatka Peninsula, Chlorella-like green algae strains VCA-72 and VCA-93 were isolated from samples collected from along the Baydarnaya river bed on the Shiveluch volcano in 2018 and at the outlet of thermal vapors along the edge of the caldera on the southern slope of the Gorely volcano in 2020. Identification of the strains was carried out within the framework of an integrative approach using microscopic and molecular genetic methods, including preliminary taxon identification, obtaining nucleotide sequences of the small subunit and the internal transcribed spacer rRNA, reconstruction of phylogenetic trees and secondary structures of the ITS1 and ITS2 rRNA regions. On the phylogenetic tree, strain VCA-93 was clustered in the Micractinium thermotolerans species clade. No differences were found when comparing the helical domain models of ITS1 and ITS2 in M. thermotolerans. Strain VCA-72 occupied a basal position in the M. inermum clade. The secondary structure patterns of the helices of strain VCA-72 were generally similar to those of M. inermum, but intraspecific variability was noted, mainly due to substitutions in the apical and lateral loops. Five hCBC substitutions were found in the helical regions of the studied M. inermum strains, while no CBC substitutions were found. A detailed analysis of morphology and life cycle allowed us to identify the characteristics of the cells in aging cultures: their size was significantly higher than in vegetative ones and they were pear-shaped, oval, and ellipsoidal with a shallow, wide constriction in the center. In addition, cells with colorless lipid droplets were detected in aging cultures of both species. The ability to synthesize and accumulate lipids indicates the great potential of the strains for the production of biodiesel fuel. A review of the habitats of previous and new findings allowed us to note the ecological plasticity of the studied species. The results obtained complement the information on the biogeography of the species: this is the first record of M. inermum for the territory of Russia, and that of M. thermotolerans, for the Kamchatka Peninsula.

Molecular and morphoanatomical characterization of Urocystis heteropogonis sp. nov.: a novel smut fungus infecting Heteropogon contortus

BackgroundA new species of smut fungus, Urocystis heteropogonis, was discovered infecting Heteropogon contortus in Shawar Valley, Swat district, Khyber Pakhtunkhwa, Pakistan. The study aimed to characterize this fungus based on its morpho-anatomical and molecular features and clarify its phylogenetic position within the genus Urocystis.ResultsUrocystis heteropogonis was identified as a novel species, distinct from other Urocystis species. Morphologically, it is characterized by larger spore balls (14–69 × 11–45 μm) and central spores that are 14–28 × 11–20 μm in size, with each spore containing1–8 central spores. The spore walls measure 0.9–2.5 μm in thickness and the species differs in infection patterns compared to other Urocystis species. Phylogenetic analysis based on the ITS and LSU regions of nuclear ribosomal DNA (nrDNA) further confirmed the novelty of the species, placing it within a distinct clade alongside U. agropyri, U. occulta, U. piptatheri, and U. tritici.ConclusionsThe discovery of Urocystis heteropogonis adds to the diversity of smut fungi infecting grasses and highlights the need for further research into its ecological and agricultural implications. Future studies should focus on the disease’s spread, management, and potential impact on host populations.

Morphological and molecular characterization of Purpureocillium lilacinum along with its biopesticidal effect against fall armyworm (Spodoptera frugiperda) in Southern Taiwan

BackgroundFall armyworm (FAW), Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae), a key agricultural pest, impacts a broad spectrum of crop species, such as cotton, maize, rice, sorghum, and a range of vegetables. Chemical pesticides and transgenic maize are commonly used to protect crops against this major pest. However, biological control offers a safer and more sustainable solution for long-term FAW management. Entomopathogenic fungi (EPF), a substitute for synthetic insecticides, have been proven to be an effective biocontrol agent for managing pest populations. The present study objective is to isolate and identify the EPF, Purpureocillium lilacinum from soil using morphological and molecular techniques and evaluate its pathogenicity against FAW eggs and various larval stages under different spore concentrations.ResultsThe micro-morphological characteristics fluctuated in growth behavior, appearance, and color under diverse growth media and temperatures. Molecular analysis, which involved constructing a phylogenetic tree from ITS and TEF gene regions, confirmed that PT-02 was P. lilacinum. The pathogenicity of the fungus was tested on FAW eggs, neonates, and larvae at multiple concentrations (1 × 108, 1 × 107, and 1 × 106 spores/ml), resulting in variation mortality. The egg mortality rate at 1 × 108, 1 × 107, and 1 × 106 spores/ml was 98, 98 and 96%, respectively. The neonate mortality rate was 100%, while first and second instars larvae mortality ranged from 10–36% across three concentrations, seven days after treatment (DAT). The median lethal concentration (LC50) values of P. lilacinum PT-02 against FAW eggs, first and second instars, were 3.02 × 107, 1.38 × 108, and 2.56 × 108 spore/ml, respectively.ConclusionsThe findings revealed that the native strain of P. lilacinum exhibited strong virulence against FAW, suggesting its potential use as an effective biocontrol agent for managing field pest populations.

The rDNA Diversity, Interseasonal Dynamic, and Functional Role of Cyanobacteria Synechococcus in the Sub-Arctic White Sea.

Planktonic unicellular cyanobacteria are the dominant biomass producers and carbon fixers in the global ocean ecosystem, but they are not abundant in polar seawater. The interseasonal dynamics of picocyanobacterial (PC) abundance, picophytoplankton primary production, and phylogenetic diversity of PC Synechococcus were studied in the sub-Arctic White Sea. The PC abundance varied from 0.2-0.3 × 106 cells/L in February to 5.2-16.7 × 106 cells/L in July. Picophytoplankton primary production ranged from 0.22 mg C/m3 per day in winter to 11.32 mg C/m3 per day in summer. Synechococcus abundance positively correlated with water temperature and river discharge that increased in recent years in the White Sea. Phylogenetic analysis of the 16S rRNA gene and ITS region clone libraries from the White Sea and Barents Sea eDNA revealed picocyanobacterial sequences related to marine Synechococcus subclusters 5.1-I, 5.I-IV, 5.2, and 5.3. All Synechococcus S5.1-I were common in the White and Barents seas and were consistently present in the picophytoplankton composition throughout the year. Synechococcus S5.2 and S5.3 appear in the PC community in summer, suggesting their river origin, and Synechococcus S5.1-IV inhabits only the Barents Sea and was not detected in the White Sea. A unique Synechococcus phylotype was revealed. It is expected that the increase in the abundance of PC and their increasing role in ecosystem functioning, as well as the enrichment of the species composition with new phylotypes in the semi-enclosed sub-Arctic White Sea, which is vulnerable to the effects of climate change, will be characteristic of all Arctic seas in general.

Effect of Integrated Crop–Livestock Systems on Soil Properties and Microbial Diversity in Soybean Production

Integrated crop and livestock systems (ICLSs) have been considered an important management-based decision to improve soil health by carbon sequestration. A two-year study (2019–2021) at CPBES in Newton, MS, was conducted to evaluate the effect of an ICLS on soil microbial diversity in the southeastern region of the USA, representing agroclimatic conditions that are warm and humid. Amplicons targeting bacterial 16S rRNA genes and fungal ITS2 regions were sequenced. Taxonomic assignment and characterization of microbial diversity were performed using QIIME2®. Soil fungal diversity pattern showed significant difference (alpha diversity, p = 0.031 in 2020 and beta diversity, p = 0.037 in 2021). In contrast, no significant differences were observed in bacterial diversity. However, there were several beneficial bacterial phyla, such as Proteobacteria and Actinobacteria, and fungal phyla such as Ascomycota, which were dominant in both years and did not show significant differences due to cover crop treatments. Canonical Correspondence Analysis (CCA) and Mantel test showed significant influence on fungal diversity due to carbon (rm = 0.2581, p = 0.022), nitrogen (rm = 0.2921, p = 0.0165), and electrical conductivity (rm = 0.1836, p = 0.0583) in 2021, and on bacterial diversity due to EE-GRSP (rm = 0.22, p = 0.02) in 2020. However, the results showed that there were no significant differences between the cover crop treatments that were consistent over a two-year study period. However, the mix of different cover crops such as oats (Avena sativa L.), crimson clover (Trifolium incarnatum L.), and tillage radish (Raphanus sativus L.) demonstrated higher positive correlation and lower negative correlation with different bacterial and fungal phyla. Long term study of ICLS is suggested to understand the shift in microbiome that would help in understanding the role of cover crops and grazing in improving crop production sustainably.

First Report of Fusarium compactum Causing Fusarium Head Blight of Wheat in China.

Fusarium head blight (FHB), a devastating wheat disease caused by several species of Fusarium, threatens global wheat yield and quality (Erenstein et al. 2022). In August 2023, wheat spikes exhibiting clear FHB symptoms were observed in fields in Yunnan, China (24°16'46″ N, 102°29'46″ E), with an incidence rate of approximately 10%. Diseased wheat spikes exhibited a bleached, wilted appearance, with abundant orange sporodochia on the glumes, similar to previous reports (Osborne et al. 2007). Twenty-four symptomatic spikes were collected from a single field, and sporodochia were washed with sterile water to prepare a spore suspension of 1 × 10³ spores/ml, which was inoculated onto potato dextrose agar (PDA) to obtain monosporic cultures. Four reference strains (KUNCC 3418 to KUNCC 3420, and KUNCC 3431) were deposited at the Kunming Institute of Botany Culture Collection, Chinese Academy of Sciences (KUNCC). For species identification, four strains were cultured on PDA and carnation leaf agar (CLA) at 25°C, with incubation under a 12-hour near-UV light/dark cycle on CLA and in complete darkness for 24 hours on PDA. Colonies on PDA grew rapidly, appearing white and loosely flocculent. Abundant pale orange, translucent sporodochia formed on CLA. Sporodochial conidiogenous cells were monophialidic or polyphialidic, subulate to subcylindrical, 9.5-12 μm × 3-3.5 μm. Sporodochial macroconidia were naviculate to fusiform, with an elongate, tapering apical cell and a foot-shaped basal cell, 3-6-septate, 33-67.5 μm × 3.5-5.5 μm. The ITS, tef1-α, rpb1, rpb2, and cam regions were amplified and sequenced using primers ITS1/ITS4, EF-1/EF-2, rpb1-F7/G2R, rpb2-5F2/11aR, and CL1/CL2A, respectively (White et al. 1990; O'Donnell et al. 2000; O'Donnell et al. 2010; Reeb et al. 2004; O'Donnell et al. 1998). These sequences were deposited in GenBank for cam (PP951603 to PP951606), ITS (PP946846 to PP946849), tef-1α (PP719217, PP731572 to PP731574), rpb1 (PP719219, PP737839 to PP737841), and rpb2 (PP719218, PP951607 to PP951609). BLASTn analyses of these sequences showed an identity range of 99.7% to 100% with the epitype strain NRRL 36323 of F. compactum (GenBank: cam = GQ505560, ITS = MH855177, tef-1α = GQ505648, and rpb2 = GQ505826), with base pair matches of 663/665 bp for cam, 488/488 bp for ITS, 641/641 bp for tef-1α, and 892/892 bp for rpb2. Both morphological and BLASTn analyses confirmed these isolates as F. compactum (Leslie & Summerell 2006; Han et al. 2023). Pathogenicity tests were performed by spraying 1 ml of spore suspension (1 × 108 spores/ml) of F. compactum strains onto spikes of the wheat cultivar Yunmai 126 at the flowering stage (n = 9). Controls (n = 9) were treated only with sterile water. Following treatment, the wheat spikes were covered with plastic bags and incubated at 25°C for 10 days. After 14 days, the inoculated spikes turned bleached and dry, showing FHB symptoms, while the wheat spikes in the control treatment remained asymptomatic. The pathogenic fungus re-isolated from all diseased samples was confirmed as F. compactum. It has been frequently reported in association with crown and root rot of wheat, particularly in regions such as Turkey and Iran (Tunali et al. 2008; Besharati et al. 2017). To our knowledge, this is the first report of F. compactum on diseased wheat spikes in China. This finding provides valuable insights into the spread of F. compactum.

First Report of Almond Decline Syndrome Caused by Neofusicoccum parvum in Italy

Almond (Prunus dulcis Mill. D. A. Webb) is considered a major crop in the Mediterranean countries. In Italy, almond orchards cover an area of 54,939 ha, with a yield of 82,146 t, with the cultivation widely distributed across several areas, such as southern regions. During the summer of 2023, 3-year-old almond plants cultivated in a commercial orchard in southern Piedmont (44°32’41.92’’ N; 7°57’25.7’’ E) showed wilting and sudden decline of the whole plant with an incidence of 15%. Main symptoms were cankers on the trunk characterized by a chocolate-brown discoloration of wood, cambium and even bark and occasional presence of gummy exudate. Symptomatic bark samples were rinsed with water, then blotted dry, and briefly soaked in ethanol for 15 s. Small pieces (5 × 5 mm) from the margin of necrotic areas were cut and placed on potato dextrose agar (PDA) plates amended with streptomycin sulphate (150 μg/ml). After incubation in the dark at 25 °C for 4 days fungal colonies emerging from the plated fragments were subcultured as monohyphal fungal cultures. They were fast-growing, turning from withish to smoky grey or grey-olivaceous after a week. Stromatic conidiomata were produced in pine needle agar, with pycnidia forming hyaline, globose to ellipsoidal, unicellular conidia, ranging in size from 16.9–17.3 μm × 5.4–5.6 μm. The causal agent was preliminary identified as Neofusicoccum sp. based on morphology. Two representative isolates (MTB3, MTC4) were identified by sequencing the ITS region and translation elongation factor 1-alpha (TEF1-α) gene with the primer pairs ITS1/ITS4 (White et al. 1990) and EF1-728F/EF1-986R (Carbone and Kohn 1999). The sequences of the two isolates were deposited in NCBI GenBank with accession numbers PP930646 / PP930647 (ITS), and PP933185 / PP933186 (TEF-1α). BLAST analysis revealed 99% similarity with reference sequences of Neofusicoccum parvum isolate CMW9081. A maximum-likelihood phylogenetic tree was constructed using MEGA7 software based on the combined ITS and TEF1-α dataset. The phylogenetic tree demonstrated that the two isolates grouped with N. parvum in a clade with the ex-type CMW9081. The pathogenicity of both isolates was evaluated on 1-year-old ‘Vairo’ almond potted plants grafted on GF677 rootstock, to assess Koch’s postulate. For the inoculation, 5 mm in diameter mycelium plugs taken from a 7-days-old PDA culture were placed on the surface of fresh wounds made with a sterile cork-borer (5 mm-diameter) on the stem. Control plants were inoculated with sterile PDA plugs. The test was conducted twice. Three blocks of three plants per isolate and control were arranged in a randomized block design. All inoculated plants showed symptoms of shoot blight and cankers 2-weeks after inoculation. Additionally, gumming, pycnidia production and internal wood discoloration developed on the inoculation sites, with lesion length spreading for 16.8 ± 1.6 and 15.4 ± 3.0 cm for MTB3 and MTC4, respectively. Most of the plants died one month after inoculation. Control plants showed no symptoms. The pathogen was consistently reisolated from inoculated plants and the identity was confirmed through TEF-1α sequencing. Thus, results of Koch postulate clearly identify N. parvum as the etiological agent of the observed disease of almond in Piedmont. N. parvum was recently reported in the same area on hazelnut (Waqas et al. 2021) and blueberry (Guarnaccia et al. 2021), and as causal agent of band canker and branch dieback in almond trees in US and Spain (Moral et al. 2019). To our knowledge, this is the first report of N. parvum as the causal agent of almond decline syndrome in Italy. Considering the increasing of almond cultivation in Italy, this disease represents a threat for the future production.

First Report of Root-knot Nematode, Meloidogyne enterolobii, on Luffa cylindrica (L.) in Guangxi, China.

Luffa cylindrica (L.), an annual climbing herb of the Cucurbitaceae family, has a long planting history in China and is deeply loved by people due to its nutritional and medicinal value (Partap S, Kumar A et al., 2012). April 2023, symptoms such as plant dwarfism, decreased yield and serious root-knots appeared on L. cylindrica sampled from a commercial production base in Beihai, Guangxi, China (GPS 21°55'79″ N;109°49'61″ E). The investigated area of L. cylindrica was about 1.3 ha, the incidence of root-knot nematode disease was almost 90%. The roots of 20 L. cylindrica were dug up and many root-knots and egg masses were found. Nematodes in samples at different stages were collected by shallow dish method, and morphological identification was caried out. Males were worm-like, annulated, with the anterior part slightly conical. Females were globular to pyriform. The perineal pattern was oval, with the dorsal arch being moderately high to tall. The tail of the second-stage juvenile (J2) was very slender with a sharp tip. The transparent tail end was clearly visible. Morphological measurements of females (n = 20): body length = 677.2 ± 34.4 μm, body width = 512.8 ± 45.4 μm, stylet = 13.7 ± 0.5 μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 5.7 ± 0.8 μm. The measurements of J2s (n = 20): body length = 412.5 ± 19.4 μm, body wide = 16.2 ± 1.3 μm, stylet lengths = 12.6 ± 0.92 μm, DGO length = 3.1 ± 0.3 μm. Average tail length = 45.44 ± 4.1μm. The observed typical characteristics of M. enterolobii were consistent with those previously described by Yang & Eisenback (1983) and EPPO (2016). J2s hatched by single egg mass were used for DNA extraction and identification of molecular biology. Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), the specific primers of M. enterolobii, was used to validate this pathogen (Long et al., 2006). Consistent with that described before, the target amplification product was about 236 bp, and no product was obtained from the negative control, M. incognita and M. javanica (Chen et al., 2023). Using V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG), the rDNA ITS region was obtained and sequenced (Vrain et al., 1992). The target product was 765 bp (GenBank accession no. PQ205316), which was 100% homologous to those M. enterolobii ITS sequence available in the GenBank (KX823372, KJ146863). Koch's postulates were used to verify the pathogenicity of M. enterolobii on L. cylindrica, twelve 2-week-old L. cylindrica were planted in sterilized soil and inoculated with M. enterolobii J2s at a rate of 3,000 individuals per plant. The plants were grown at 26°C in a greenhouse, with non-inoculated controls set up. After 8 weeks, the roots of the non-inoculated plants (n = 12) showed no root-knot and grew well, while all inoculated plants developed root-knots and exhibited stunted growth. The average reproduction factor of the inoculated plants was 19.5, and the average root-knot rating was 7.2 (on a scale of 0 to 10) (Bridge and Page 1980), confirming the pathogenicity of M. enterolobii on L. cylindrica. We found that this is consistent with the description of M. enterolobii infecting Coriandrum sativum in Shanxi, China (Pan et al., 2024) and the infection of Selenicereus costaricensis in Guangxi, China by M. enterolobii (Wu et al., 2023). To our knowledge, this is the first report of M. enterolobii parasitizing L. cylindrica in Guangxi, China. With the increase of vegetable planting area, root-knot nematodes are becoming more and more serious and have become a limiting factor on vegetable production. This finding is of significant importance for vegetable growers to control M. enterolobii in this region, based on which suitable management measures will be taken.

First Report of Southern Blight of Epimedium sagittatum Caused by Agroathelia rolfsii in Henan, China.

Epimedium [Epimedium sagittatum (Sieb. et Zucc.) Maxim., E. brevicornu Maxim., E. pubescens Maxim., E. koreanum Nakai] plants are perennial herbs and the dry leaves were used in traditional Chinese medicine with different medicinal effects (Chinese Pharmacopoeia, 2020 edition). In early August 2022 (the high temperature was 33 ℃ and the low temperature was 25 ℃ on average with above 70% relative humidity), large necrotized leaf spots were initially observed in one-year and two-year old E. sagittatum plants in Dengzhou (32°35'26.84" N, 112°11'8.37" E), Henan province, China. White mycelia, yellow and brown sclerotia were observed along the petioles and colonized to the back of leaves and also on soil-petioles interface around the diseased Epimedium plants. White mycelia spread rapidly from the disease plants as a center to neighboring plants and the infected plants eventually wilted. The disease incidence was 16.0% and 28.0% in the surveyed cultivation fields in Dengzhou (Henan) and Danjiangkou (Hubei), respectively, which resulted in above 20% of yield loss. The symptomatic tissues (petioles, n≥10) were cut into 0.5 cm sections with autoclaved scissors and surface sterilized with 75% ethanol for 30 s, followed by 3 min in 1% NaClO, rinsed three times with distilled sterile water, plated on autoclaved filter paper to remove excess moisture in a biological laminar hood, transferred onto potato dextrose agar (PDA) plates and incubated at 28℃ in incubator in the dark for 3-5 days. Twelve fungal isolates with white radial colony morphology were obtained and purified by hyphal-tip method. The isolates formed radial colonies showing abundant aerial mycelia with a growth rate of 19.25 to 22.25 mm/day (mean = 21.67 ± 0.77 mm; n = 36) and white abundant sclerotia were observed after 5-7 days post inoculation at 28℃. The hyphae of the isolates were hyaline, branched with clamp connections at septa. The isolates formed dark brown sclerotia on PDA plate post 10-14 days incubation. The diameter of mature brown sclerotia ranged from 1.31 to 3.07 mm (mean = 1.91 ± 0.39 mm; n = 40) and 13 to 45 sclerotia (mean = 28; n = 24) were observed on each Petri dish. The isolates were tentatively identified as Agroathelia rolfsii based on morphological characteristics (Yi Y., et al. 2024) and isolate YYHBJ1 was selected as representative isolate for molecular identification and pathogenicity test. The genomic DNA was extracted using CTAB method. For molecular identification, ITS region, translation elongation factor-1alpha (TEF-1α) and nuclear large-subunit ribosomal DNA (nLSU-rDNA) were amplified (White et al. 1990, Wendland and Kothe, 1997). The sequences 684-bp ITS (OR428367), 534-bp TEF1α (OR485567), and 965-bp nLSU-rDNA (OR426612) of isolate YYHBJ1 were deposited in GenBank. Sequence analysis revealed that ITS, TEF1α and nLSU-rDNA sequences of YYHBJ001 showed 100%, 99.63%, and 100% identity to ITS (MN380242 and JF819727), EF1α (MN262527) and nLSU-rDNA (MT225781 and AY635773) sequences of Agroathelia rolfsii (Sacc.) Redhead & Mullineux (Redhead and Mullineux 2023). Pathogenicity tests was confirmed by inoculating 1 year-old E. sagittatum plants grown in pots with sterile soil. PDA plug (5 mm diameter) colonized with 3 brown sclerotia and the fungal culture which was cultivated for 12 days was deposited beside the petiole on the surface of the soil. The control plants were inoculated with PDA plugs without the pathogen. Five plants were used in each treatment. The plants were cultivated in incubator at 28℃ with 80% relative humidity. Fourteen days later, white mycelia growing out from the sclerotia and spread along the petioles to the leave and the infected leaves were yellow. After 21 to 24 days, all inoculated plants displayed symptoms like those observed in field, while no symptoms were observed on the controls. The fungus was re-isolated from the inoculated plants as described above, fulfilling Koch's postulates. The pathogenicity tests were repeated three times. Based on morphological feature and DNA sequences, the pathogen of southern blight on Epimedium plants was identified as A. rolfsii (anamorph S. rolfsii). The pathogen A. rolfsii usually infect kinds of crops and cause southern blight, such as peanuts, chili peppers, green onion and so on (Daunde et al. 2018). To our knowledge, this is the first report of A. rolfsii causing southern blight on E. sagittatum plants in Henan in China.

Tick Infestation and Molecular Detection of Tick-Borne Pathogens from Indian Long-Eared Hedgehogs (Hemiechinus collaris) in Pakistan.

Hedgehogs can act as reservoirs for the transmission of tick-borne pathogens (TBPs) to domestic livestock, wild animals, and humans. Understanding host-tick dynamics is essential to evaluate the impact of TBPs. This study was conducted in Pakistan and aimed to determine the prevalence and species of TBPs in the blood and ticks of Indian long-eared hedgehogs captured from various environments. A total of 64 hedgehogs were captured to check for tick infestation. Tick species were identified morphologically and molecularly including ITS-2 region amplification by PCR and subsequent Sanger sequencing. Moreover, TBPs were identified in both ticks and the blood of hedgehogs through conventional PCR and sequencing, targeting the regions msp1b, 18S rRNA, and cytb for Anaplasma spp., Babesia spp., and Theileria spp., respectively. Out of 64 hedgehogs, 16 (25%) were found to be infested with ticks. Morphological and molecular analysis identified all 109 collected ticks as Rhipicephalus turanicus. Only one hedgehog (6.2%) was infected with A. marginale. From the tick samples, 3.7% tested positive for Theileria lestoquardi, 2.8% for Anaplasma marginale, and another 2.8% for Babesia bigemina. This study provides critical insights into circulating TBPs in this region and what possible role hedgehogs might play in disease maintenance for Anaplasma marginale while identifying multiple pathogens that are of concern to human and animal health.

Phylogenetics and reticulation among koelerioid clades, part I: Contraction of Trisetum, expansion of Acrospelion, Graphephorum, and Tzveleviochloa; Graciliotrisetum gen. nov. and resurrection of Aegialina (Poaceae, Pooideae, Poeae, Aveninae)

AbstractKoelerioid grasses (subtribe Aveninae, tribe Poeae; Pooideae) resolve into two major clades, here called Koelerioid Clades A and B. Phylogenetic relationships among koelerioid grasses are investigated using plastid DNA sequences of rpl32‐trnL, rps16‐trnK, rps16 intron, and ITS regions, focusing on Trisetum, Acrospelion, and some annual species (Rostraria p.p. and Trisetaria p.p.) closely related to Trisetum flavescens in Koelerioid Clade A. Phylogenetic analyses of several selected data sets performed for 80 taxa and using maximum likelihood and Bayesian methods, revealed mostly congruent topologies in the nuclear and plastid trees, but also reticulation affecting several lineages. Trisetum is restricted to one species, T. flavescens, which is a sister to the clade formed by Trisetum gracile and Trisetaria aurea. The latter two species are classified here in the genus Graciliotrisetum gen. nov. The sister clade includes three species of Rostraria and Trisetaria lapalmae, all of which are classified here in a resurrected genus, Aegialina, which includes four species. Acrospelion is enlarged to include 13 species after the addition of other species formerly classified in Trisetum sect. Trisetum and T. sect. Acrospelion. We also transfer Trisetum ambiguum, Trisetum longiglume, and Koeleria mendocinensis to Graphephorum; and Helictotrichon delavayi to Tzveleviochloa, expanding these genera to eight and six species, respectively. We evaluate cases of reticulate evolution between Koelerioid Clades A and B and within Koelerioid Clade A, which probably gave rise to Graphephorum, Rostraria cristata, and Rostraria obtusiflora. Finally, we comment on polyploidy and biogeographic patterns in koelerioid grasses. We propose the following 26 new combinations: Acrospelion alpestre, Acrospelion altaicum, Acrospelion argenteum, Acrospelion bertolonii, Acrospelion buschianum, Acrospelion buschianum subsp. transcaucasicum, Acrospelion fuscum, Acrospelion laconicum, Acrospelion macrotrichum, Acrospelion rigidum, Acrospelion rigidum subsp. teberdense, Acrospelion tamonanteae, Acrospelion velutinum, Aegialina lapalmae, Aegialina pubescens, Aegialina pumila, Aegialina pumila subsp. fuscescens, Aegialina salzmannii, Aegialina salzmannii subsp. cossoniana, Graciliotrisetum aureum, Graciliotrisetum gracile, Graphephorum ambiguum, Graphephorum longiglume, Graphephorum mendocinense, Graphephorum orthochaetum, and Tzveleviochloa delavayi. Lectotypes are designated for the names Aegialitis tenuis, Aira melicoides, Avena aspera var. parviflora, Avena delavayi, Koeleria grisebachii var. mendocinensis, Koeleria pubescens subsp. cossoniana, Koeleria pumila, Koeleria salzmannii, Phalaris pubescens, Trisetum aureum, Trisetum cernuum, Trisetum fuscescens, Trisetum longiglume, and Trisetum wolfii; and we designate one neotype for Alopecurus litoreus.

Amphisphaeria hongheensis sp. nov. (Amphisphaeriaceae, Amphisphaeriales) from Yunnan Province, China

Yunnan Province encompasses the highest fungal diversity in China, and novel fungal species are regularly introduced. Several saprobic fungi were collected during surveys of fungi associated with woody plants in Yunnan Province, Southwestern China. The fungi samples were initially identified as Amphisphaeria. Multi-gene phylogenetic analysis based on combined datasets of LSU, ITS, rpb2, and tub2 regions and morphological characteristics confirmed that the samples represent a previously unidentified fungus belonging to Amphisphaeria, which is named A. hongheensis sp. nov. This paper provides a full description, illustrations, and a phylogenetic tree showing the new species' taxonomic placement.

Proteomic analysis of psychedelic mushroom isolate and exploring potential antimicrobial peptides against bacteria

Psychedelic mushrooms belonging to basidiomycota have gained prominence in research due to the range of hallucinogenic compounds. To combat the challenge of antimicrobial resistance, exploring alternative antimicrobial peptides has become crucial. In this study, we present the proteomic analysis of psychedelic mushroom. Psilocybe cubensis was identified by molecular characterisation using the ITS1 and ITS4 regions. Subsequently, LC-MS/MS and gene ontology analyses were used to characterise the proteome of P. cubensis. The proteomic analysis unveiled several antimicrobial peptides. The results revealed favourable binding scores, suggesting the potential efficacy of these peptides against Staphylococcus aureus. Hence the inhibition of bacterial growth, supporting the antimicrobial properties of the identified peptides. In our findings, the individual peptides from P. cubensis against S. aureus suggest a promising avenue for the discovery of novel antimicrobial peptides.

New Data on the Distribution and Systematic Position of Marsupella minutissima, a Poorly Known Species from Gymnomitriaceae (Marchantiophyta).

Marsupella minutissima was recorded for the first time outside of Japan in Jeju-do in the Republic of Korea. The new data significantly improve the knowledge of the species distribution. An analysis of the phylogenetic affinities of the species based on nuclear ITS and plastid trnL-trnF regions showed that it is resolved within the clade corresponding to Marsupella sect. Ustulatae, which is where the most morphologically similar M. funckii and M. sprucei are placed. These tree taxa are well delimited geographically. When found within the same region, such as a mountain chain, they occupy different altitudinal belts. Our results showed clear molecular delimitation; however, we failed to estimate the affinities of M. minutissima within the section based on the available molecular data. A description, line-art illustrations and photographs of the collected materials are provided; data on the oil bodies of the species were obtained for the first time.

Morphometric and Molecular Characterization of Fasciola spp. in Livestock From Northwestern Provinces of Iran.

Liver flukes from the genus Fasciola are the causative agents for human and livestock fascioliasis. Accurate identification of Fasciola spp. is essential to understanding the epidemiology of fascioliasis. This study aimed to determine the morphometric and molecular characterization of Fasciola spp. in livestock from Northwestern provinces of Iran. Five hundred adult Fasciola flukes were obtained from different definitive hosts (cattle, sheep, goats, and buffaloes) in four local abattoirs in the northwestern provinces of Iran (West-Azerbaijan, East-Azerbaijan, Ardabil, and Zanjan) from September 2021 to August 2022. All samples were examined by morphometric criteria; then, 49 samples were identified using PCR-RFLP based on ITS1 region and 23 sequence of isolates analyzed by cox1 marker. PCR-RFLP methods compared morphometric results, and cox1 gene sequences were used to confirm PCR-RFLP results and phylogenetic analysis. The differences between the body length, body width, cephalic cone length, cephalic cone width, body area, and distance between the ventral sucker and posterior end of the body in two species were significant (p < 0.05). Based on the morphometric criteria, 139 samples (27.8%) were identified as Fasciola gigantica and 361 (72.2%) as Fasciola hepatica. Similarly, PCR-RFLP analysis of ITS1 region confirmed morphometric results. No hybrid forms of Fasciola were detected. Partial sequences of cox1 showed 13 variable sites with eight haplotypes in F. hepatica and 12 variable sites with five haplotypes in F. gigantica. Based on the results of this study, the PCR-RFLP method can be used to confirm the morphological method of Fasciola species, but it is insufficient to study their genetic diversity. Also, sequences of cox1 results of the present study showed that F. hepatica and F. gigantica species in the Northern provinces of Iran have different genetic structures and haplotypes.

Soil Properties and Rhizosphere Microbes Community Structure Reveal Nitrogen Uptake Preferences and Nitrogen Use Efficiency of Two Ecotypes of Paphiopedilum micranthum

Paphiopedilum micranthum, an IUCN Red List species, is discontinuously distributed in the karst limestone mountain of southwest China and exhibits ecological specialization, typically through lithophytic and terrestrial ecotypes. Whether the distribution of rhizosphere bacteria and fungi in these different habitats is random or reflects soil preferences requires further investigation. A total of 73 samples from the core distribution areas in China, representing all habitats in two sites, were analyzed for soil differences by comparing edaphic properties and microbial community structure based on high-throughput sequencing of bacterial 16S rRNA genes and fungal ITS region sequences, alongside soil physiochemical data. The results showed no significant differences in microbial community richness and diversity across the heterogeneous habitats. However, significant differences in taxa were observed across various habitats. Dominant bacterial phyla included Actinobacteriota, Proteobacteria and Acidobacteriota, with dominant genera such as Crossiella, Pseudonocardia, 67-14, Mycobacterium and RB41. The primary fungal phyla were Basidiomycota and Ascomycota, featuring prominent genera such as Phlegmacium, Archaeorhizomyces, Trechispora, and Lepiota. There were 16 bacterial genera and 13 fungal genera associated with nitrogen transformation and fixation. Alkali-hydrolyzed nitrogen (AN) was identified as a main driver of soil bacterial and fungal community variation. Based on an analysis of soil physicochemical properties, ammonium nitrogen content was consistently higher than nitrate nitrogen across different habitats. Furthermore, across all heterogeneous habitats, P. micranthum showed no significant differences in nitrate nitrogen, ammonium nitrogen, or their ratio. The nitrogen-use efficiency of P. micranthum ranged from 7.73% to 9.87%, with the highest efficiency observed in the terrestrial habitat of Shedu. These results suggest that P. micranthum prefers habitats rich in organic matter and nitrogen, showing a preference for ammonium nitrogen uptake in natural conditions. Heterogeneous habitats affect plant nitrogen-use efficiency as well as changes in microbial community composition.