Instituto De Ciencias Research Articles

Treatment outcomes of Limited Stage Grade 3A Follicular Lymphoma

Introduction: While radiotherapy is an established standard of care for limited stage, low grade follicular lymphoma (FL), the management of localized FL grade 3A (FL3A) disease remains controversial. We reviewed the outcomes of grade 3A patients treated with definitive RT, combined modality therapy (CMT), or systemic therapy (ST) alone. Methods: We retrospectively analyzed a single institution database to identify newly-diagnosed, grade FL3A patients with Ann Arbor stage I/II disease treated between 2000 and 2021. Patients were stratified by definitive treatment modality including RT monotherapy, CMT, or ST. Best post-RT imaging response was evaluated using Lugano criteria for all by CT, and by PET if available. Rate of complete response (CR) was compared between the three treatment modalities. Progression-free survival (PFS) and Overall survival (OS) were calculated using Kaplan Meier from first day of treatment. Univariable Cox regression was used to assess possible clinicodemographic associations with PFS. Results: 84 patients (median age 62, 38% male) were analyzed with median follow-up of 6.9 years from initiation of treatment. Patients were stage I (73%) or II (27%) and 92% were initially PET staged at diagnosis. 29 (35%) had extranodal disease. The median (IQR) maximum SUV and size prior to treatment were 9.8 (5.4, 14.0) and 3.2 (2.0, 4.5) cm respectively. RT was the most common treatment modality (n = 48, 57%), followed by CMT (n = 21, 25%), then ST (n = 15, 18%). For RT/CMT patients the planned RT dose was most commonly 36 Gy (32%, range 4–40 Gy). 2 patients (3%) received very low dose of 4 Gy. Of the CMT/ST patients the most common regimen was 3–4 cycles of R-CHOP (53%). 3 patients (8%) received Rituximab alone. Compared to RT patients, ST patients were most likely to have been diagnosed after 2010 (p = 0.002) and have stage II disease (p < 0.001), while CMT patients were more likely to be female (p = 0.03) and have grade 3 disease not further characterized (p = 0.002). The rates of CR post-treatment were 88% for RT, 100% for CMT, and 87% for ST. Factors significantly associated with PFS univariably included the treatment modality (CMT vs. RT HR 0.30, 95% CI: 0.10–0.91, p = 0.03), and presence of low-grade FL component in the biopsy (HR 3.33, 95% CI: 1.43–7.78, p = 0.005). Age, sex, stage, extranodal status, Ki67 score, size, and SUV were not predictive of PFS. The probability of transformation to DLBCL was 4.2% (95% CI: 1.1%–11%) at 5 years after treatment. Overall survival was excellent for all treatment modalities with median OS of 18 years for CMT, and not reached for RT or ST. Keywords: Combination Therapies, Indolent non-Hodgkin lymphoma, Radiation Therapy Conflicts of interests pertinent to the abstract. A. Zelenetz Consultant or advisory role: ADC Therapeutics, AbbVie, Adaptive Biotechnologies Corp Arvinas, Inc. AstraZeneca BeiGene, Ltd. Bristol-Myers Squibb, Curio Science LLC, Dava Oncology, Genentech, Instituto de Ciencias Integradas, Kyowa Kirin Co., Ltd. MEI Pharma, Inc., Medscape, Oncopeptides, AB Sandoz, Inc., Secura Bio, Inc., Suzhou Liang Yihui Network Science and Technology Company, Limited G. Salles Consultant or advisory role: AbbVie, Aptitude Health, Bayer, BeiGene, Ltd., Bio Ascend, Bristol-Myers Squibb, Celgene, Epizyme, Everest Clinical Research Corporation, GenMab, Genentech, Gilead Pharmaceutical, Incyte, Ipsen, Janssen Pharmaceutical, Nordic Nanovector ASA, s, Inc., Loxo Oncology, Miltenyi Biotec Incorporated, MorphoSys AG, Novartis, Owkin, Inc., Physicians' Education Resource, RAPT Therapeutics, Regeneron Pharmaceuticals, Inc., Roche, Scientific Education Support Ltd., Takeda Millennium J. Yahalom Consultant or advisory role: Convergent R.N.R Ltd. B. Imber Consultant or advisory role: GT Medical Technologies, Inc.

Paracyclops fiersi sp. nov. (Copepoda, Cyclopoida, Cyclopidae), a new freshwater cyclopoid from north-western Mexico

Abstract Several individuals of free-living copepods were found in tap water of the Unidad Académica Mazatlán (Instituto de Ciencias del Mar y Limnología). These copepods turned out to belong to a new species of the freshwater genus Paracyclops. Paracyclops poppei, P. hirsutus, and P. chiltoni were the only species reported in Mexican freshwater ecosystems, and the record of P. fiersi sp. nov. is the fourth confirmed species of the genus from Mexico. The new species seems to be related to P. hardingi and P. bromeliacola. The new species differs in the ornamentation of the female antennary coxobasis, and in the posterior, subdistal, medial spinules on the coxa of the first–fourth leg in both sexes. The city of Mazatlan is supplied with groundwater from an aquifer of the Presidio River (south of Mazatlan), and the new species is most probably distributed in the southern state of Sinaloa (north-western Mexico).

Expression of Concern: Caspase-dependent initiation of apoptosis and necrosis by the Fas receptor in lymphoid cells: onset of necrosis is associated with delayed ceramide increase.

There are issues in J. Cell Sci. (2002) 115, 4671-4683 (doi:10.1242/jcs.00153).There are irregularities with the background in Fig. 3E and Fig. 9A. Also, in Fig. 4, several data points are unexpectedly similar between the two FACS plots in panel A, and the first two lanes of the blot in panel D are duplicated. The authors no longer have the original data, but state that the conclusions of the paper are not affected.A report by Instituto de Ciencias Biomédicas, Universidad de Chile, decided that there had been ‘to some extent data manipulation but not falsification’ of this and other papers authored by Claudio Hetz and concluded that the key findings of this paper are unaffected.Without the original data, it is difficult to determine how these issues arose, so the journal is publishing this note to alert readers to our concerns.

Mincy mesosiderite metallic nodules analyzed byEBSD: An approach to understanding their thermal history

AbstractMeteorites carry information about the most common processes that have been active in the early solar system. In particular, mesosiderites are meteorites with a structure considered to be composed of equal parts of iron–nickel metal and silicates. A natural delimitation in the study of such complex systems is the discrimination of the iron–nickel metallic and silicate domains. In this work, we focus on the metallic phases of the Mincy mesosiderite, a specimen available at the Instituto de Ciencias Astronómicas, de la Tierray y del Espacio repository. In Mincy, the metallic phases are iron–nickel–carbon alloys that are distributed forming metallic lumps or pebbles (referred to as metallic nodules in the article) in which kamacite and taenite are present, and taenite is found both at the kamacite/silicate interface and surrounded by kamacite, that is, isolated from the silicates. We made use of the electron backscattered diffraction technique to determine the crystallographic orientation relationships along the taenite/kamacite boundaries as well as for characterizing the (hkl)‐specific grain boundaries regarding the underlying tilt, twist, or twinning mechanism to assist the interpretation of the phase transformations and mechanisms that could explain the formation of these metallic nodules. From the results, each of the metallic nodules has a unique temperature–pressure history and kinetics to undergo phase transformations (mainly partial melting, heterogeneous nucleation‐controlled solidification, and possible evaporation–condensation) as well as liquid‐phase sintering and recrystallization in its own way.

Abstracts of oral and poster presentations given at the 12th International Workshop on Grapevine Trunk Diseases, Mikulov, Czech Republic, 10–14 July 2022

The 12th International Workshop on Grapevine Trunk Diseases (12th IWGTD) was held in Mikulov, Czech Republic, from 10 to 14 July, 2022. The Workshop was chaired by Dr Aleš Eichmeier and organized by Mendel University in Brno and Svaz Vinařů České Republiky/Union of Winemakers of the Czech Republic. The ICGTD Council meeting took place on 10 July, and that evening the welcome reception was opened by Rostislav Koštial (Mayor of Mikulov, Senator and viticulturist), Dr Martin Chlad (President of Svaz Vinařů České Republiky/Union of Winemakers of the Czech Republic), and Dr Svatopluk Kapounek (Vice-Rector, Mendel University, Brno).The scientific programme was opened by Dr Alena Salašová (Dean, Faculty of Horticulture, Mendel University, Brno). The Workshop was attended by 133 researchers from 25 countries, presenting 61 oral and 49 poster papers. These presentations were in five sessions, including; Pathogen Characterization and Identification, Epidemiology, Plant-pathogen Interactions, Microbial Ecology, and Disease Management in Nurseries and Vineyards. The Disease Management session aimed to provide grape growers with an overview of practical options for trunk disease control. This session included contributions from researchers who have completed field trials on trunk disease management. David Gramaje (Instituto de Ciencias de la Vid y el Vino (ICVV), Logroño, La Rioja, Spain, outlined an evaluation of treatments for protection of grapevine pruning wounds from natural pathogen infections; Francois Halleen (University of Stellenbosch, South Africa) presented detailed results of efficiency of hot water treatments in nurseries; and Josè Úrbez-Torres (Agriculture and Agri-Food Canada SuRDC) outlined research on biological control of Botryosphaeria dieback in grapevines.A field trip (13 July) visited vineyards in the South Moravia. Delegates were presented with an overview of grapevine production in South Moravia, followed by discussions on the main diseases (including GTDs) affecting grapevines in the Czech Republic. Vineyards affected by GTD pathogens were also visited, where the growers outlined their viewpoints. The field trip focused on presenting the current situation of GTDs in South Moravia, and the management strategies being adopted. &#x0D; Student competitions for best oral and poster presentations included papers presented by 29 postgraduate students. For best posters:1st place went to Catarina Leal (University of Reims Champagne-Ardenne, France, and Polytechnic University of Valencia, Spain), “Evaluation of Trichoderma atroviride SC1 and Bacillus subtilis PTA-271 combination against grapevine trunk diseases pathogens in nursery propagation process”;2nd place went to Marcelo Bustamante (University of California, Davis, United States of America), “Investigating the role of Fusarium spp. in young vine decline in California”;&#x0D; 3rd place went to María Julia Carbone (Universidad de la República, Montevideo, Uruguay), “Interactive effects of Dactylonectria macrodidyma inoculation on the rhizosphere and root microbiome of grapevine”.For best oral presentations:1st place went to Catarina Leal, (University of Reims Champagne-Ardenne, France, and Polytechnic University of Valencia, Spain), “Beneficial effects of Bacillus subtilis PTA-271 and Trichoderma atroviride SC1 against the Botryosphaeria-dieback pathogen Neofusicoccum parvum may vary with grapevine cultivar”;2nd place went to Isidora Silva-Valderama (University of British Columbia, Vancouver, Canada), “Predicting pathogens virulence: linking host breadth and pathogenicity of the Botryosphaeriaceae fungal family in wine grapes (Vitis vinifera)”;3rd place went to Colin Todd (University of California, Riverside, United States of America), “Tracking the fungal pathobiome associated with young grapevine decline in California nurseries”.The 13th IWGTD will be held in Ensenada, Mexico, in 2025.

Book Reviews

Nuno Palma of University of Manchester and Instituto de Ciencias Sociais, Universidade de Lisboa reviews “The Cambridge Economic History of the Modern World. Volume 1. 1700 to 1870” edited by Stephen Broadberry and Kyoji Fukao. The Econlit abstract of this book begins: “Volume 1 of a two-volume set contains nineteen papers that provide an overview of the modern world economy from 1700 to 1870, examining the beginnings of modern economic growth and the main factors governing differential outcomes in different parts of the global economy.”

First Report of Fusarium temperatum Causing Fruit Blotch of Capsicum pubescens in Puebla, México.

Puebla is one of the provinces in Mexico that produces manzano pepper (Capsicum pubescens). Recently, the producers of manzano pepper from the northern highlands of Puebla reported an aggressive fruit blotch that caused severe damage and substantial economic losses. Symptoms were rot spots with mycelial growth at the center of the spot, necrosis in the periphery, a change in fruit size, loss of turgor and discoloration. The symptoms were observed at different fruit ripening stages. Around 50% of fruits of a plant (n=50) were infected. Diseased fruits were collected from March to September 2020 in Yaonáhuac Puebla, Mexico. These samples were sanitized (20% sodium hypochlorite for 20 min) and stored in humidity chambers (n=20) for 10 days at 28 °C and 70% relative humidity, to identify the causal agent of rot. Two fungal isolates were isolated and purified in potato dextrose agar (PDA) and the isolate with the less abundant mycelium was identified as Cylindrobasidium torrendii by ITS markers. C. torrendii did not exert pathogenic activity whereas the second isolate had evident pathogenic properties. Morphological identification of the causal agent was done from the monosporic cultures of the 2nd isolate developed in PDA (Tariq et al. 2018). The fungus showed white cottony mycelium, becoming pinkish-white after 10 days of incubation and it turned the culture medium to dark-violet color. Koch's postulates were conducted with 1,000 conidia inoculated in the pericarp of sanitized asymptomatic peppers by mechanical penetration using a Hamilton syringe (n=20; 28 °C and 70% relative humidity for 12 days). After 6 days, the samples inoculated with the conidia showed the same symptoms as those observed under the field conditions. Microscopic characteristics were obtained from PDA and Spezieller Nahrstoffarmer agar (SNA). The fungus showed hyaline mycelium with septate hyphae containing erect-branched conidiophores with 1 to 3 phialides. The size of macro- and microconidia (n=100) was 20.3-43.1 μm and 6.2-14.3 µm, respectively (Pintos et al. 2013). Molecular analysis were done according to the method described by Morales-Mora et al. (2019) by sequencing the translation elongation factor 1 alpha (EF-1H- ATGGGTAAGGAAGACAAGAC and EF-2T-GGAAGTACCAGTGATCATGTT) (Molnár et al. 2015; Scauflaire et al. 2011) . The amplicon (671 bp) was sequenced with the oligonucleotide EF-2T and compared with the sequences of the accessions HM067686, HM067687 (Scauflaire et al. 2011) and KT447148 (Lanza 2016) of the National Center for Biotechnological Information (NCBI), showing 100% homology with Fusarium temperatum. The partial sequence of EF-1α from F. temperatum isolated in this study, was deposited at NCBI databank with the accession MW570680. Since F. temperatum has been reported as the infective agent of maize around the world (Pintos et al.), F. temperatum causing fruit blotch can be a new threat to the producers of manzano pepper in México. The identification of this pathogen is the first, important step to develop management strategies for the control of this disease.

Contributors

Contributors

Sensitivity Analysis of OTEC-CC-MX-1 kWe Plant Prototype

The Mexican Caribbean Sea has potential zones for Ocean Thermal Energy Conversion (OTEC) implementation. Universidad del Caribe and Instituto de Ciencias del Mar y Limnologia, with the support of the Mexican Centre of Innovation in Ocean Energy, designed and constructed a prototype OTEC plant (OTEC-CC-MX-1 kWe), which is the first initiative in Mexico for exploitation of this type of renewable energy. This paper presents a sensitivity analysis whose objective was to know, before carrying out the experimental tests, the behavior of OTEC-CC-MX-1 kWe regarding temperature differences, as well as the non-possible operating conditions, which allows us to assess possible modifications in the prototype installation. An algorithm was developed to obtain the inlet and outlet temperatures of the water and working fluid in the heat exchangers using the monthly surface and deep-water temperature data from the Hybrid Coordinate Ocean Model and Geographically Weighted Regression Temperature Model for the Mexican Caribbean Sea. With these temperatures, the following were analyzed: fluctuation of thermal efficiency, mass flows of R-152a and water and power production. By analyzing the results, we verified maximum and minimum mass flows of water and R-152a to produce 1 kWe during a typical year in the Mexican Caribbean Sea and the conditions when the production of electricity is not possible for OTEC-CC-MX-1 kWe.

Taxonomy of family Benthopectinidae (Echinodermata: Asteroidea) in the Mexican waters of the Gulf of Mexico

Introduction: The family Benthopectinidae is composed of deep-sea sea stars distributed in eight genera and approximately 70 valid species. So far, only five species of this family have been reported for the Mexican waters of the Gulf of Mexico. Objective: To provide an updated local taxonomy of this family. Methods: A total of 566 specimens deposited in the Echinoderm National Collection, Instituto de Ciencias del Mar y Limnología, Universidad Nacional Autónoma de México, and the National Museum of Natural History, Smithsonian Institution, collected from 1952 to 2015, were taxonomically examined. Results: We present descriptions, photographs, and an illustrated dichotomous key for Benthopecten simplex simplex, Cheiraster (Barbadosaster) echinulatus, Cheiraster (Cheiraster) planus, Cheiraster (Christopheraster) blakei, and Cheiraster (Christopheraster) mirabilis in the region. Conclusions: The five studied species represent 6 % of the world biodiversity of the family and can now be identified with the illustrated key.

Índice SPAD, nitratos y rendimiento en sorgo en respuesta al suministro de nitrógeno

Introducción. El nitrógeno (N) es el macronutriente que más afecta el rendimiento de los cultivos; sin embargo, su utilización por los cultivos se asocia a una baja eficiencia de recuperación; por esta razón es necesario analizar su absorción en el tejido vegetal durante el ciclo para obtener el beneficio deseado. Objetivo. Conocer el efecto de la fertilización nitrogenada en el crecimiento, concentración de nitratos en la base del tallo (NBT), índice SPAD (medición de clorofila) y el rendimiento en grano de sorgo (Sorghum bicolor L. Moench). Materiales y métodos. El estudio se realizó en el Instituto de Ciencias Agrícolas de la Universidad Autónoma de Baja California, México, durante el verano de 2012 y la primavera de 2013. Se evaluaron dosis crecientes de nitrógeno (N) (0, 64, 128, 192, 256 y 320 kg ha-1), bajo un diseño experimental completamente al azar. En el Experimento 1 (Verano 2012), se evaluaron las seis dosis de N en un suelo bajo labranza de conservación (LC). En el experimento 2 (Primavera 2013), se evaluaron las mismas dosis de N y además se incluyó un tratamiento de 128 kg N ha-1 utilizando sistema de labranza mínima (LM). Resultados. En el Experimento 1, se obtuvo mayor cantidad de peso seco del grano (PSg), planta completa (PSt), índice de cosecha (IC) y rendimiento de grano, que en el Experimento 2. El mayor PSg, PSt, IC, área foliar (AF) y rendimiento de grano se obtuvo con la dosis de 192 kg de N ha-1. El índice SPAD y la concentración de NBT presentaron correlación con el rendimiento. Los valores R2 en el índice SPAD fueron mayores que en NBT. Conclusiones. Los NBT y el índice SPAD resultaron significativamente asociadas al rendimiento. La mejor época de producción del cultivo de sorgo fue en verano con una dosis de192 kg de N ha-1.

Supervivencia y crisis del Instituto de Ciencias de Zacatecas (1884-1920)

El presente trabajo fue elaborado con base en el análisis y hermenéutica de fuentes primarias y secundarias. La educación superior tuvo diferentes etapas y evoluciones en México, con antecedentes históricos desde la cultura virreinal; nunca exenta de problemas, la moderna “vida universitaria” fue establecida en las más importantes ciudades. Durante la etapa conocida como Porfiriato la educación elemental y la superior quedaron perfiladas en el Positivismo, doctrina social y soporte del régimen político, con la participación en materia de instrucción pública de los funcionarios llamados “Científicos”. En los estados, cada gobernador, alineado a la autoridad federal, se enfrentó a diferentes problemas en materia educativa. Se trataba de alfabetizar a una gran población que carecía de la instrucción más elemental; también atender a una educación superior, desde el nivel de secundaria y preparatoria hasta el profesional. Es notorio el papel del Instituto de Ciencias en la formación del profesorado para la educación elemental en algunos etapas de su funcionamiento. La hipótesis del presente trabajo: en Zacatecas, la incursión de muchos gobernadores, la precaria economía de la mayoría de la población, la lucha armada iniciada en 1910, la crisis de valores, las pocas oportunidades del ascenso educativo y social y hasta el desinterés de la juventud, se combinaron para caracterizar una época de crisis académica en el Instituto Científico, máxima casa de estudios en la entidad. La situación no era privativa de este plantel; los conflictos y problemas internos caracterizaron a la gran mayoría de estas escuelas en todo el país. Se concluye que la situación económica y política en el estado de Zacatecas, los estilos en el ejercicio del poder y las ideas y concepciones filosóficas de los gobernantes, se reflejaron en la vida académica y en los problemas del Instituto.

Postcranial skeleton of Spalacopus cyanus (Rodentia: Octodontidae): description and functional aspects

The genus Spalacopus includes only one species, S . cyanus , endemic to central Chile and one of the species best adapted to a subterranean lifetyle in the family Octodontidae. It is a member of the lineage consisting in Octodontomys as a sister clade containing Octodon and of a clade represented by Spalacopus and Aconaemys . Although the external and cranio-dental morphology have been well studied, little is known of the postcranial morphology of S . cyanus . Because of the peculiarities of its lifestyle and locomotion among the members of the family, it is interesting to characterize details of the morphology of the postcranial skeleton of this species and to infer their functional aspects of the morphology. Twenty-nine specimens with postcranial material stored in two collections were studied: Museo de La Plata (MLP), La Plata, Buenos Aires, Argentina and Coleccion de Mamiferos del Instituto de Ciencias Ambientales y Evolutivas (UACH), Universidad Austral de Chile, Valdivia, Chile. To describe in detail the morphology of the bone elements, the skeleton was divided in the following regions: axial skeleton, scapular girdle and forelimb, and pelvis girdle and hindlimb. The structures included in the axial skeleton were mainly described in cranial-caudal orientation and the limbs in proximal-distal orientation. All structures were observed with stereoscopic microscopes Leica Wild M3Z and Nikon SMZ 745T including pictures to illustrate the descriptions. Highly conservative characteristics among members of the family Octodontidae were observed in the postcranial morphology of S . cyanus , although some characters are exclusive to this species. The axial skeleton has seven cervical vertebrae, 12 or 13 thoracic, six or seven lumbar, four sacral, 16 to 18 caudal vertebrae, 12 or 13 ribs and a sternum with five sternebrae. The elements of the scapular and pelvic girdles as well as forelimbs and hindlimbs are described in detail, except the carpus and tarsus due to their poor state of conservation, or because they not available. The morphological pattern observed in the postcranial skeleton of S . cyanus conforms to a typical anatomical plan for terrestrial species, and some bones (mainly humerus and ulna) present characteristics associated with digging. The information obtained provided will allow a better interpretation of the postcranial attributes, functionally related with different lifestyle, in a future, as well as the evolution of the traits in a phylogenetic context.

High-density seismic network for monitoring Alentejo region (Portugal) and Mitidja basin region (Algeria)

The seismic sensor network Alentejo (SSN-Alentejo) brings a new approach in seismological survey based on networked low-cost sensors and acquisition systems. It is developed by the Earth Sciences Institute (Instituto de Ciencias da Terra, University of Evora) to bring the most dense seismic sensor network ever deployed in Portugal. By combining high-sensitive sensors with low-cost sensors, this novel network aims to improve the characterisation of seismic activity in the region, by augmenting existing sensing and monitoring capabilities, enabling the opportunity to observe, for the first time in Portuguese territory, real-time monitoring of the seismic activity in high resolution. In this study, we start by describing the seismicity along the occidental border between the Eurasian-Nubian plates, including the two regions of our interest: the Arraiolos region, in Portugal, and the Mitidja basin, in Algeria. We then present our work in designing and implementing a high-density sensor network, including low-cost sensor systems and server platforms. The conducted tests have proven the feasibility of the overall platform, including its detectability capability. Future work includes the deployment of the sensor network in the Alentejo region. Since seismogenic zones such as the Mitidja or Chelif basins in Algeria will also benefit from having a high-density network, we will also seek collaboration with Algerian institutions.

Senecio scapioides (Compositae: Senecioneae: Senecioniinae): a new species from the Departamento de Boyac\xe1, in Andean Colombia

SummaryRoutine use of the virtual herbarium of the collections in COL (Instituto de Ciencias Naturales de la Universidad Nacional de Colombia) revealed the presence of an as yet undescribed species of Senecio amongst the material of Senecio adglacialis and S. leucanthemoides. Following subsequent herbarium studies and fieldwork, Senecio scapioides (Compositae: Senecioneae: Senecioniinae), from the Departamento de Boyacá, in Andean Colombia, was recognised and is described and illustrated; it is compared with S. adglacialis and S. leucanthemoides. Notes on its distribution and habitat, conservation status, phenology, and etymology are also provided, and the distribution of the three species mapped.

Scientific encounters between Colombia and the United States analyzed through publishing practices in Caldasia journal: The birds of the Republic of Colombia as a publishing event

In 1948, American ornithologist Rodolphe Meyer de Schauensee began publishing what would be the most complete list of birds from Colombia that had ever been printed up to that time. His work was called The Birds of the Republic of Colombia (TBRC), and at the invitation of Armando Dugand, the director of the Instituto de Ciencias Naturales at the Universidad Nacional de Colombia and of the Caldasia journal, this work was exclusively published in the journal in five installments spanning four years. This paper analyzes the publishing aspects that particularly influenced the process of carrying out this work, with the objective of showing that scientific practices and publishing practices are not two absolutely separate domains. The circuit of communication present in TBRC's development is analyzed, specifically the efforts of the editor, printer and author to bring this work to fruition. This analysis demonstrates the following: (i) how the scientific interests of Meyer and the Instituto de Ciencias Naturales converge, (ii) the contradictions between scientific interests that promoted the publication of TBRC and the publishing rationale of a journal and (iii) how unforeseen publishing issues of the time, such as the increase in printing costs due to inflation, influenced the final structure of the work.

The Tadpoles of Two Atelopus Species (Anura: Bufonidae) from the Sierra Nevada de Santa Marta, Colombia, with Notes on their Ecology and Comments on the Morphology of Atelopus Larvae

We describe for the first time the tadpole of two endemic harlequin frogs of the Sierra Nevada de Santa Marta, north of Colombia: Atelopus nahumae and A. laetissimus. In addition, we provide further morphological data for a third species, A. carrikeri. We also discuss some external morphological features for the tadpoles of these species and compare them with data currently available in the literature for the genus and with other larvae deposited in the amphibian collection of the Instituto de Ciencias Naturales of the National University of Colombia. The examined characters comprise eight morphometric variables and many traits of external morphology related with the oral apparatus, abdominal disc, fins, and dorsal color pattern. The tadpoles of A. nahumae and A. laetissimus are gastromyzophorous and morphologically similar, sharing a great number of features with their congeners. The tadpoles of A. nahumae, A. laetissimus, and A. carrikeri contrast morphometrically; total length and tail width are the morphometric traits that are useful to differentiate among them. They are also differentiated by the size of the abdominal sucker and spiracle. In A. carrikeri, the abdominal sucker is large relative to that of A. nahumae and A. laetissimus; the spiracle of A. laetissimus and A. carrikeri is not visible in ventral and dorsal view, whereas it is large and conspicuous in A. nahumae. The tadpoles of the species from Sierra Nevada de Santa Marta differ from most of their congeners found in the Cordillera Oriental and Central of Colombia by lacking a dark band on the fins and caudal musculature. We recorded abiotic factors of the microhabitat where tadpoles of A. nahumae were observed (temperature, dissolved oxygen, and water depth). Our results indicate that the probability of finding A. nahumae tadpoles depends on the depth of the stream.

Numerical evaluation of the corrosion effects in prestressed concrete beams without shear reinforcement

AbstractCorrosion of prestressed concrete structures causes size reduction of strands, degradation of mechanical properties of steel, cracking of the surrounding concrete, and bond decay at steel‐to‐concrete interface. In this paper, a numerical approach able to take into account all the effects involved in the corrosion process by using nonlinear finite element analysis (NLFEA) and membrane or shell elements modeling is proposed. Two different strategies are adopted to model strands: the smeared and the discrete approaches. The results obtained using these latter strategies are validated by comparing NLFEA results with experimental measurements of a naturally corroded prestressed beam tested at the “Instituto de Ciencias de la Construcción Eduardo Torroja” in Madrid. Finally, pros and cons of the proposed modeling approach are critically analyzed, demonstrating that considering the actual spatial corrosion distribution is necessary to predict the position where failure occurs.

Estimates of Fast Radio Burst Dispersion Measures from Cosmological Simulations

Abstract We calculate the dispersion measure (DM) contributed by the intergalactic medium (IGM) to the total measured DM for fast radio bursts (FRBs). We use the MareNostrum Instituto de Ciencias del Espacio (MICE) Onion Universe simulation to track the evolution of the dark matter particle density over a large range of redshifts. We convert this dark matter particle number density to the corresponding free electron density and then integrate it to find the DM as a function of redshift. This approach yields an intergalactic DM of pc cm−3, with the large errors representative of the structure in the IGM. We place limits on the redshifts of the current population of observed FRBs. We also use our results to estimate the host galaxy contribution to the DM for the first repeater, FRB 121102, and show that the most probable host galaxy DM contribution, pc cm−3, is consistent with the estimate made using the Balmer emission lines in the spectrum of the host galaxy, pc cm−3. We also compare our predictions for the host galaxy contribution to the DM for the observations of FRB 180924 and FRB 190523, both of which have been localized to a host galaxy.

Museus e Coleções da UFPA: os espaços existentes no Instituto de Ciências Biológicas (ICB)

A partir das investigações, iniciadas em 2016, acerca dos museus universitários existentes no campus Belém da Universidade Federal do Pará (UFPA), identificamos mais de cinco espaços. Para este trabalho centramos nos museus localizados no Instituto de Ciências Biológicas (ICB): Museu de Anatomia Humana e Museu de Zoologia. Discutimos como esses espaços se enxergam – pois se autodenominam museu – e o que aparentam ser, com base nos conceitos de museu e coleção universitária coletados de bibliografias sobre o tema. Destacamos, também, se há visibilidade dos espaços dentro da universidade e qual o papel da museologia e dos museólogos nesses locais.