Influence Disease Course Research Articles

Hormone Receptor-Positive/Human Epidermal Growth Receptor 2-Negative Metastatic Breast Cancer in Young Women: Emerging Data in the Era of Molecularly Targeted Agents.

Breast cancer is the most common malignancy in young women worldwide, accounting for an estimated 30% of new cancer diagnoses and 25% of cancer deaths. Approximately two thirds of young women with breast cancer have hormone receptor–positive (HR+)/human epidermal growth receptor 2–negative (HER2−) tumors. Numerous studies, primarily in early‐stage breast cancer, have demonstrated that young age is an independent risk factor for more aggressive disease and worse outcomes. Although more limited data are available regarding outcomes in young patients with advanced disease, these age‐related disparities suggest that breast cancer in premenopausal women has distinct clinicopathologic and molecular features that can impact treatment outcomes. Until recently, limited data were available on the intrinsic molecular subtypes and genetics of young patients with HR+/HER2− metastatic breast cancer (mBC). In this review, we explore insights into the clinical and pathologic features of HR+/HER2− mBC in younger women derived from recent clinical trials of the cyclin‐dependent kinase 4/6 inhibitors palbociclib (PALOMA‐3), ribociclib (MONALEESA‐7), and abemaciclib (MONARCH 2) and the implications of these findings for clinical practice, guideline development, and future research.Implications for PracticeThis review provides clinicians with an overview of emerging data on the unique clinicopathologic and molecular features of hormone receptor–positive/human epidermal growth receptor 2–negative metastatic breast cancer (mBC) in premenopausal women, summarizes findings from the most recent clinical trials of endocrine‐based treatment in this patient population, and explores the implications of these findings for clinical practice, guideline development, and future research. Improved understanding of the key factors influencing disease course and treatment response in premenopausal patients with mBC may lead to more timely incorporation of evidence‐based treatment approaches, thereby improving patient care and outcomes.

Marital Status and Survival in Patients with Multiple Myeloma: The Role of Marriage in the Management of Multiple Myeloma

Multiple myeloma (MM) is plasma cell neoplasm characterized by notable inter-patient and intra-clonal heterogeneity that is gradually decoded over the last decades. Despite the deeper and better understanding of its biology and the development of novel therapeutic strategies that have prolonged overall survival, MM still remain largely incurable. This warrants a better understanding of socio-demographic factors that may influence disease course and outcomes across MM patient. Positive influence of marital status is extensively examined and established for many solid and liquid cancers.

Schistosoma mansoni soluble egg antigen (SEA) and recombinant Omega-1 modulate induced CD4+ T-lymphocyte responses and HIV-1 infection in vitro

Parasitic helminths evade, skew and dampen human immune responses through numerous mechanisms. Such effects will likely have consequences for HIV-1 transmission and disease progression. Here we analyzed the effects that soluble egg antigen (SEA) from Schistosoma mansoni had on modulating HIV-1 infection and cytokine/chemokine production in vitro. We determined that SEA, specifically through kappa-5, can potently bind to DC-SIGN and thereby blocks DC-SIGN mediated HIV-1 trans-infection (p<0.05) whilst not interfering with cis-infection. DCs exposed to SEA whilst maturing under Th2 promoting conditions, will upon co-culture with naïve T-cells induce a T-cell population that was less susceptible to HIV-1 R5 infection (p<0.05) compared to DCs unexposed to SEA, whereas HIV-1 X4 virus infection was unaffected. This was not observed for DCs exposed to SEA while maturing under Th1 or Th1/Th2 (Tmix) promoting conditions. All T-cell populations induced by SEA exposed DCs demonstrate a reduced capacity to produce IFN-γ and MIP-1β. The infection profile of T-cells infected with HIV-1 R5 was not associated with down-modulation of CCR5 cell surface expression. We further show that DCs maturing under Tmix conditions exposed to plant recombinant omega-1 protein (rω-1), which demonstrates similar functions to natural ω-1, induced T-cell populations that were less sensitive for HIV-1 R5 infection (p<0.05), but not for X4 virus infection. This inhibition associated again with a reduction in IFN-γ and MIP-1β expression, but additionally correlated with reduced CCR5 expression. We have shown that SEA parasite antigens and more specifically rω-1 can modulate HIV-1 infectivity with the potential to influence disease course in co-infected individuals.

Effect of Cognitive Behavioral Therapy on Clinical Disease Course in Adolescents and Young Adults With Inflammatory Bowel Disease and Subclinical Anxiety and/or Depression: Results of a Randomized Trial.

Anxiety and depressive symptoms are prevalent in patients with inflammatory bowel disease (IBD) and may negatively influence disease course. Disease activity could be affected positively by treatment of psychological symptoms. We investigated the effect of cognitive behavioral therapy (CBT) on clinical disease course in 10-25-year-old IBD patients experiencing subclinical anxiety and/or depression. In this multicenter parallel group randomized controlled trial, IBD patients were randomized to disease-specific CBT in addition to standard medical care (CBT + care us usual [CAU]) or CAU only. The primary outcome was time to first relapse in the first 12 months. Secondary outcomes were clinical disease activity, fecal calprotectin, and C-reactive protein (CRP). Survival analyses and linear mixed models were performed to compare groups. Seventy patients were randomized (CBT+CAU = 37, CAU = 33), with a mean age of 18.3 years (±50% < 18 y, 31.4% male, 51.4% Crohn's disease, 93% in remission). Time to first relapse did not differ between patients in the CBT+CAU group vs the CAU group (n = 65, P = 0.915). Furthermore, clinical disease activity, fecal calprotectin, and CRP did not significantly change over time between/within both groups. Exploratory analyses in 10-18-year-old patients showed a 9% increase per month of fecal calprotectin and a 7% increase per month of serum CRP in the CAU group, which was not seen in the CAU+CBT group. CBT did not influence time to relapse in young IBD patients with subclinical anxiety and/or depression. However, exploratory analyses may suggest a beneficial effect of CBT on inflammatory markers in children.

P146 NOD2 IS REQUIRED FOR RECOVERY AGAINST MYCOBIOTA-DRIVEN INTESTINAL DISEASE AND FOR GENERATION OF PROTECTIVE TYPE 1 AND 3 HOST RESPONSES

The microbiota has emerged as a critical contributor to intestinal inflammatory diseases, however most studies have focused on bacteria despite the presence of fungi. Several clinical and experimental observations have shown that the mycobiota are important for the course of inflammatory bowel disease (IBD). Crohn’s disease patients have higher levels of Candida tropicalis compared to healthy counterparts, and majority of the fungal species in a DSS–induced colitis murine model is comprised of C. tropicalis. Moreover, susceptibility loci for IBD, such as the pattern recognition receptor NOD2 (nucleotide oligomerization domain-containing protein 2), are known not only to recognize bacterial components, but also to detect a fungal cell wall element, chitin. Recent studies have shown that this interaction induces anti-inflammatory cytokine responses, however the role of these recognition receptors in regulating immune responses toward intestinal fungal pathogens remains poorly defined. To further clarify the consequences of the interactions of host and fungi to intestinal disease, we infected wildtype (WT) C57Bl/6 mice and mice lacking NOD2 (NOD2 KOs) with C. tropicalis prior to the induction of DSS colitis and all through out to mimic IBD patients with increased fungal burden. Mice were subsequently allowed to recover for two weeks after DSS treatment. Here we present data to show that C. tropicalis infection impairs recovery from intestinal damage induced by DSS colitis, indicating that fungi found commonly in the gut can influence disease course and healing. We demonstrate that NOD2 is critical for host defense against C. tropicalisinfection. We also show that C. tropicalis-infected NOD2 KOs exhibit more severe colitis symptoms such as weight loss and worse stool consistency, as well as lesser chances of survival, shorter colon lengths, and greater disease activity than WT, indicating that NOD2 is protective against mycobiota-driven intestinal inflammation. Previous studies have shown that IFNγ and IL-17-secreting innate cells mediate control of fungal burden in opportunistic fungal infections. Here we show that NOD2 KOs infected with C. tropicalis have less colonic IFNΥ expression and reduced percentage and absolute numbers of mesenteric lymph node – derived group 3 innate lymphoid cells (ILC3s) compared to WT mice, suggesting that the delay in fungal clearance and recovery in NOD2 KO mice may be due to inability to mount protective type 1 and 3 immune responses. Overall, our data reveal a role for commensal fungi in impeding intestinal healing, and a protective role for NOD2 in inhibiting experimental colitis possibly via an IFNγ- or IL-17-mediated mechanism. These findings also establish that NOD2 deficiencies exemplify an appealing system to understand the development of irregular antifungal immune responses towards commensal mycobiota.

The effect of surgical specimen-derived phosphorus and lead concentrations in non small cell lung cancer patients on disease course.

Lung cancer is one of the leading causes of cancer-related mortality. There are many exogenic and endogenic factors associated with the development of lung cancer. One of these factors is trace elements. Under- or overabundance of trace elements can disrupt cellular functions and lead to the formation of cancer. In this study we conducted elemental analysis of lung cancer tissue and normal lung tissue to investigate the role of tissue trace element concentrations in lung cancer. Elemental analysis was performed on 30 lung cancer tissue samples and a control group of 15 normal lung tissue samples, all taken from patients diagnosed, treated and followed at our hospital between 2005 and 2010. The solubilized tissue samples were analyzed for the presence of 19 elements using inductively coupled plasma-optical emission spectroscopy (ICP-OES). Total element amounts in the tissue were calculated. Concentrations of magnesium, potassium, zinc, manganese, lead, boron, chromium and phosphorus were significantly higher in the patient group compared to the control group. Deceased patients had significantly lower phosphorus concentrations and significantly higher lead concentrations than the other patients. Elevated levels of magnesium, potassium, zinc, manganese, lead, boron, chromium and phosphorus in lung cancer tissue indicate that these elements may play a role in the development of lung cancer. The results of our evaluation of the association between trace elements and lung cancer suggest that, together with other factors, low phosphorus concentration and high lead concentration in tumor tissue may influence disease course.

Variable Clinical Presentation of Congenital Thrombotic Thrombocytopenic Purpura in a Large Cohort of Patients Carrying a New Mutation in the CUB1 Domain of ADAMTS13 Gene

Introduction:Congenital TTP (Thrombotic Thrombocytopenic Purpura) is a rare life-threatening inherited disorder, resulted from mutations in ADAMTS13 gene. Such mutations interfere with ADAMTS13 enzyme production or function, subsequently resulting in microangiopathic hemolytic anemia (MAHA) and microvascular thrombosis. The investigation of congenital TTP is challenging because of its rarity with an estimated prevalence ranging from 0.4 to 16.7 cases per million and about 150 identified mutations. Recently, we identified a cohort of patients with congenital TTP from three consanguineous families of Arab Bedouin origin in southern Israel. All patients have the same, previously unidentified mutation c.3772 delA in the ADAMTS13 gene. In this single center prospective cohort study, we present patients' genetic, clinical and laboratory data and results of the abnormal ADAMTS13 protein Western blot analysis.Methods:Patients with episodes of MAHA and thrombocytopenia were diagnosed with congenital TTP by abnormally low ADAMTS13 activity and absence of inhibitory autoantibodies (Table 1). Subsequently, patients were referred for genetic testing. Patients' DNA served for PCR amplification of the exons of ADAMTS13 (NM_139026) followed by direct sequencing of the PCR products. The mutation was found in exon 28, the primers used for PCR were forward: atgtccctatgtcccacctg and reverse: ctgtccagaatcacagcacaa (annealing temperature 61°C).Western blot analysis of the abnormal ADAMTS13 protein was performed according to the method previously described by Zheng et al, using antihuman ADAMTS13 rabbit polyclonal antibody (ab28274; Abcam, Cambridge, UK).Patients' clinical and laboratory parameters were collected at diagnosis and during follow-up.The study was approved by the institutional research ethics board.Results:We identified a novel mutation on chromosome 9:136323172del A (GRCh37/hg19) in coding exon 28, c.3772 del A (NM_139026), causing p.N1258T fs Ter 15 of ADAMTS13 gene close to the C-terminus of the 1427-amino acid long protein (Fig.1). We validated that all patients in our cohort are homozygous for the mutation. The mutation is found within the CUB1 domain and the frameshift is predicted to result in the loss of the next 169 highly conserved amino acids of the full-length protein that contains the CUB2 domain, normally responsible for cleavage of large VWF multimers under flow conditions.Our Western blot analysis of the abnormal protein (Fig. 2) demonstrates that a 170-190 Kd band is missing in plasma of five patients, compared to four controls. These results suggest that the mutation may interfere with the entire enzyme production.The cohort consists of 17 homozygotic patients (3 males and 14 females), all belong to three closely related families of Arab Bedouin descent with high rate of consanguinity. All 17 patients in this cohort have blood group A. This finding may represent genetic linkage disequilibrium between the ADAMTS13 gene and the transferase gene, both found on chromosome 9 in close proximity.Despite the fact that all the patients are homozygous for the same mutation and belong to three closely related families, their presenting symptoms and disease severity were markedly heterogenous (Table 1): eight of 14 female patients initially presented with complications of pregnancy, two presented with laboratory abnormalities, two presented with stroke and two asymptomatic female patients were recognized on family screening. Of three male patients, one presented with Budd-Chiari syndrome, one had laboratory abnormalities alone and one developed a stroke.Conclusion:To the best of our knowledge, this is one of the largest congenital TTP cohorts described in the literature. This cohort is unique due to the fact that all members carry the same, previously unreported, ADAMTS13 gene mutation in the CUB1 domain of the gene. Our findings support an assumption that environmental and hereditary modifiers may influence disease course. Further research of the involved families may enable us to expand the understanding of the pathophysiology and develop better treatment options for this understudied rare condition. [Display omitted] DisclosuresNo relevant conflicts of interest to declare.

Puberty onset and pediatric multiple sclerosis activity in boys

ObjectivesTo determine the association of age of onset and puberty with relapse rate in boys with pediatric multiple sclerosis (MS). BackgroundWhile sex steroid hormones have been shown to have immune effects, it is not known how age or puberty influence disease course in boys with MS. We have previously shown an association in girls with menarche and risk of relapse. MethodsPatients from the UCSF Regional Pediatric MS Center were included in this retrospective study. Age of disease onset was used to stratify patients into three groups approximating pubertal stage: age less than 11 years, between 11–14 years, and greater than 14 years, corresponding to pre-, peri-, and post-puberty, respectively. Negative binomial regression was used to determine the association between pubertal status at disease onset with relapse rate. Results58 male pediatric patients with onset of relapsing-remitting MS before 18 years of age participated to the analyses (<11 onset, n = 21; 11–14 onset, n =21; >14 onset, n = 16). 60% of patients identified as White, and 43% as Hispanic. Median follow-up was 3.17 years (IQR 1.42–5.35). Univariate negative binomial regression models demonstrated a 2.4 fold increased relapse rate for boys with disease onset in the peri-puberty age group compared to the post-puberty age group (IRR = 2.43, 95% CI 1.33–4.47, p = 0.004). Adjustments for race, ethnicity, and use of disease-modifying therapy did not change these results (IRR = 2.39, 95% CI 1.20–4.79, p = 0.014). No differences in relapse rate between the pre-pubertal onset group and post-pubertal onset group were found. ConclusionsPubertal onset of MS may be associated with increased relapses in boys. Further investigation is indicated to understand the intersection of pubertal effects and MS pathophysiology.

Astrocytic NF-κB brings the best and worst out of microglia.

The role of astrocytes and microglia in neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS) remains incompletely understood. In this issue of The EMBO Journal , Alami et al (2018) employ a sophisticated genetic system that allows precise temporal control of NF‐κB activation in astrocytes to demonstrate that the timing of astrocyte activation is a key determinant of disease progression. Their results suggest that astrocyte activation drives microglia proliferation and that this can amplify not only the protective microglial effects in the presymptomatic phase of ALS, but also the detrimental microglial effects in the symptomatic phase.

P814 Latent cytomegalovirus infection does not influence disease course in inflammatory bowel disease

P814 Latent cytomegalovirus infection does not influence disease course in inflammatory bowel disease

Statistical challenges in high‐dimensional molecular and genetic epidemiology

AbstractMolecular and genetic association studies conducted in well‐characterized longitudinal cohorts offer a powerful approach to investigate factors influencing disease course or complex trait expression. As measurement technologies continue to develop and evolve, studies based on existing cohorts raise methodological challenges. Five such challenges are illustrated in two long‐term inter‐disciplinary collaborations. In one, molecular genetic prognostic factors in the natural history of node‐negative breast cancer are investigated using a combination of hypothesis‐testing and hypothesis‐generating molecular approaches. In the other, genome‐wide association methods are applied to identify genes for multiple traits in extended follow‐up data from participants of a therapeutic RCT in type 1 diabetes. The Canadian Journal of Statistics 46: 24–40; 2018 © 2017 Statistical Society of Canada

Glucocerebrosidase mutations and neuropsychiatric phenotypes in Parkinson's disease and Lewy body dementias: Review and meta-analyses.

Heterozygous mutations in glucocerebrosidase gene (GBA) are a major genetic risk factor for Parkinson's disease (PD) and dementia with Lewy bodies (DLB). Recently, there has been a considerable focus on the relationship between GBA mutations and emergence of cognitive impairment and neuropsychiatric symptoms in these diseases. Here, we review the literature in this area, with a particular focus, including meta-analysis, on the key neuropsychiatric symptoms of cognitive impairment, psychosis, and depression in Parkinson's disease. Our meta-analysis demonstrated that GBA mutations are associated with a 2.4-fold increased risk of cognitive impairment. In addition, our novel meta-analyses of psychosis and depression showed a 1.8- and 2.2-fold increased risk respectively associated with GBA mutations, although due to possible bias and heterogeneity the depression findings should be interpreted with caution. While the precise mechanisms which increase susceptibility to neurodegeneration in GBA carriers are not known, evidence of greater cortical Lewy body pathology, reduced patterns of cortical activation, and hippocampal pathology in animal models are all consistent with a direct effect of GBA mutations on these symptoms. Extension of this work in DLB and individuals without neurodegeneration will be important in further characterizing how GBA mutations increase risk for PD and DLB and influence disease course.

Coffee and autoimmunity: More than a mere hot beverage!

Coffee is one of the world's most consumed beverage. In the last decades, coffee consumption has attracted a huge body of research due to its impact on health. Recent scientific evidences showed that coffee intake could be associated with decreased mortality from cardiovascular and neurological diseases, diabetes type II, as well as from endometrial and liver cancer, among others. In this review, on the basis of available data in the literature, we aimed to investigate the association between coffee intake and its influence on the immune system and the insurgence of the most relevant autoimmune diseases. While some studies reported conflicting results, general trends have been identified. Coffee consumption seems to increase the risk of developing rheumatoid arthritis (RA) and type 1 diabetes mellitus (T1DM). By contrast, coffee consumption may exert a protective role against multiple sclerosis, primary sclerosing cholangitis, and ulcerative colitis. Concerning other autoimmune diseases such as systemic lupus erythematosus, psoriasis, primary biliary cholangitis and Crohn's disease, no significant association was found. In other studies, coffee consumption was shown to influence disease course and management options. Coffee intake led to a decrease in insulin sensitivity in T1DM, in methotrexate efficacy in RA, and in levothyroxine absorption in Hashimoto's disease. Further, coffee consumption was associated with cross reactivity with gliadin antibodies in celiac patients. Data on certain autoimmune diseases like systemic sclerosis, Sjögren's syndrome, and Behçet's disease, among others, are lacking in the existent literature. As such, further research is warranted.

Trace Element Levels, Cytokine Profile and Immune Activation Status in Plasma among Repeat Blood Donors with Asymptomatic HIV-1, HBV and HCV Infection

Imbalance of essential trace elements viz. Zinc, Selenium, Iron, Copper and Magnesium has been reported to influence disease course in HIV-1, HBV and HCV infections by altering immune status. A study was taken up to examine plasma levels of Th1 (IFN-γ and IL-2) and Th2 (IL-4 and IL-10) categories of cytokines and immune activation markers (TNF-α, TNFR I and TNFR II) in an asymptomatic group of HIV-1, HBV and HCV infected blood donors in relation to trace elements. Plasma levels of Zn, Se and Mg were depressed in all the three groups of blood donors (P γ were depressed in all the three groups of blood donors (P γ, and in HBV infection while positive correlations were found between Mg and TNFR I and TNFR II and Se with TNFR II. HCV infection showed a positive correlation between Se and IFN-γ (P < 0.001), Mg and IL-4 (P = 0.02), Fe and IL-10 (P < 0.01). The present study reveals possible relationship between trace element level alterations and alterations in cytokine and immune activation levels in HIV-1, HBV and HCV infection.

Quasispecies composition and diversity do not reveal any predictors for chronic classical swine fever virus infection.

Classical swine fever (CSF) can run acute, chronic, and prenatal courses in both domestic pigs and wild boar. Although chronic infections are rare events, their epidemiological impact is very high due to the long-term shedding of virus. So far, little is known about the factors that influence disease course and outcome from either the host or virus's perspective. To elucidate the viral determinants, we analyzed the role of the viral populations for the development of chronic CSF virus (CSFV) infections. Three different animal trials that had led to both chronic and acute infections were chosen for a detailed analysis by deep sequencing. The three inocula represented sub-genogroups 2.1 and 2.3, and two viruses were wild-type CSFV, one derived from an infectious cDNA clone. These viruses and samples derived from acutely and chronically infected animals were subjected to next-generation sequencing. Subsequently, the derived full-length genomes were compared at both the consensus and the quasispecies level. At consensus level, no differences were observed between the parental viruses and the viruses obtained from chronically infected animals. Despite a considerable level of variability at the quasispecies level, no indications were found for any predictive pattern with regard to the chronicity of the CSFV infections. While there might be no direct marker for chronicity, moderate virulence of some CSFV strains in itself seems to be a crucial prerequisite for the establishment of long-term infections which does not need further genetic adaption. Thus, general host and virus factors need further investigation.

Multiple sclerosis: Latitude and vitamin D influence disease course in multiple sclerosis.

Multiple sclerosis: Latitude and vitamin D influence disease course in multiple sclerosis.

Progranulin genetic polymorphisms influence progression of disability and relapse recovery in multiple sclerosis

Background: Progranulin (GRN) is a multifunctional protein involved in inflammation and repair, and also a neurotrophic factor critical for neuronal survival. Progranulin is strongly expressed in multiple sclerosis (MS) brains by macrophages and microglia. Methods: In this study we evaluated GRN genetic variability in 400 MS patients, in correlation with clinical variables such as disease severity and relapse recovery. We also evaluated serum progranulin levels in the different groups of GRN variants carriers. Results: We found that incomplete recovery after a relapse is correlated with an increased frequency of the rs9897526 A allele (odds ratio (OR) 4.367, p = 0.005). A more severe disease course (Multiple Sclerosis Severity Score > 5) is correlated with an increased frequency of the rs9897526 A allele (OR 1.886, p = 0.002) and of the rs5848 T allele (OR 1.580, p = 0.019). Carriers of the variants associated with a more severe disease course (rs9897526 A, rs5848 T) have significantly lower levels of circulating progranulin (80.5 ± 9.1 ng/mL vs. 165.7 ng/mL, p = 0.01). Conclusion: GRN genetic polymorphisms likely influence disease course and relapse recovery in MS.

Periodontal disease in pediatric rheumatic diseases

Gingivitis and periodontitis are immunoinflammatory periodontal diseases characterized by chronic localized infections usually associated with insidious inflammation This narrative review discusses periodontal diseases and mechanisms influencing the immune response and autoimmunity in pediatric rheumatic diseases (PRD), particularly juvenile idiopathic arthritis (JIA), childhood-onset systemic lupus erythematosus (C-SLE) and juvenile dermatomyositis (JDM). Gingivitis was more frequently observed in these diseases compared to health controls, whereas periodontitis was a rare finding. In JIA patients, gingivitis and periodontitis were related to mechanical factors, chronic arthritis with functional disability, dysregulation of the immunoinflammatory response, diet and drugs, mainly corticosteroids and cyclosporine. In C-SLE, gingivitis was associated with longer disease period, high doses of corticosteroids, B-cell hyperactivation and immunoglobulin G elevation. There are scarce data on periodontal diseases in JDM population, and a unique gingival pattern, characterized by gingival erythema, capillary dilation and bush-loop formation, was observed in active patients. In conclusion, gingivitis was the most common periodontal disease in PRD. The observed association with disease activity reinforces the need for future studies to determine if resolution of this complication will influence disease course or severity.

Doença periodontal em doenças reumáticas pediátricas

Gingivitis and periodontitis are immunoinflammatory periodontal diseases characterized by chronic localized infections usually associated with insidious inflammation This narrative review discusses periodontal diseases and mechanisms influencing the immune response and autoimmunity in pediatric rheumatic diseases (PRD), particularly juvenile idiopathic arthritis (JIA), childhood‐onset systemic lupus erythematosus (C‐SLE) and juvenile dermatomyositis (JDM). Gingivitis was more frequently observed in these diseases compared to health controls, whereas periodontitis was a rare finding. In JIA patients, gingivitis and periodontitis were related to mechanical factors, chronic arthritis with functional disability, dysregulation of the immunoinflammatory response, diet and drugs, mainly corticosteroids and cyclosporine. In C‐SLE, gingivitis was associated with longer disease period, high doses of corticosteroids, B‐cell hyperactivation and immunoglobulin G elevation. There are scarce data on periodontal diseases in JDM population, and a unique gingival pattern, characterized by gingival erythema, capillary dilation and bush‐loop formation, was observed in active patients. In conclusion, gingivitis was the most common periodontal disease in PRD. The observed association with disease activity reinforces the need for future studies to determine if resolution of this complication will influence disease course or severity.

SAT0066 Interrelationship between Rheumatoid Arthritis, Poverty and Education

BackgroundCompared to the general population patients with rheumatoid arthritis (RA) are endangered by poverty due to treatment-related expenses. Moreover they suffer from reduced functional capability and disability and are threatened...