Human Colon Tumor Cell Research Articles

P53 Antisense Oligonucleotide Inhibits Growth of Human Colon Tumor and Normal Cell Lines

We examined the relationship between the expression of mutant p53 proteins and tumor cell growth using a p53 antisense oligonucleotide (5′‐CCCTGCTCCCCCCTGGCTCC‐3′). The oligonucleotide inhibited the growth of three human colon tumor cell lines (DLD‐1, SW620 and WiDr), which produce only mutant p53 proteins with different mutation sites. Treatment of DLD‐1 cells with the p53 antisense oligonucleotide caused a decrease in the level of p53 mutant protein. Synthesis of DNA in DLD‐1 and SW620 cells was inhibited more potently than that of RNA or protein after antisense treatment. Furthermore, these cells were accumulated in the S phase when DNA synthesis was inhibited. Meanwhile, the antisense oligonucleotide also inhibited the growth of three human normal cell lines (WI‐38, TIG‐1 and Intestine 407). While treatment of WI‐38 and TIG‐1 cells with the antisense oligonucleotide inhibited synthesis of DNA more potently than that of RNA or protein, these normal cells were accumulated in the G0/G1 phase. These results suggest that p53 proteins, either with or without mutation, play a pivotal role in the growth of tumor and normal cells, but that mutant and wild‐type p53 proteins may function differently in cell growth.

Diallyl Disulfide Suppresses the Growth of Human Colon Tumor Cell Xenografts in Athymic Nude Mice

The present studies examined the antiproliferative effects of diallyl disulfide (DADS) on the growth of human colon tumor cell line, HCT-15, xenografts in 6-wk-old female NCr nu/nu mice with an initial body weight of 20–22 g. Intraperitoneal injection of 1 mg DADS thrice weekly reduced tumor volume by 69% (P < 0.05) without apparent ill consequences such as altered growth of the host. Providing this quantity of DADS intragastrically also inhibited growth of the HCT-15 tumor. At equivalent DADS dosages, intraperitoneal treatment was proportionately more effective (P < 0.05) in reducing tumor growth than gastric intubation. Tumor inhibition caused by DADS (0.5 mg thrice weekly) was similar to that occurring with 5-fluorouracil (5-FU) treatment (0.5 mg thrice weekly). Combining DADS and 5-FU was no more effective in inhibiting tumor growth than using either compound alone. However, concurrent DADS treatment significantly (P < 0.05) inhibited the depression in leukocyte counts and spleen weight and prevented the elevated plasma urea caused by 5-FU treatment. These data suggest that DADS, a constituent of garlic oil, reduces the toxicity of 5-FU and is an effective antitumorigenic agent against xenografts resulting from an established human colon tumor cell line.

Effects of Chronic Ethacrynic Acid Exposure on Glutathione Conjugation and MRP Expression in Human Colon Tumor Cells

Chronic exposure to ethacrynic acid of a subcloned HT29 human colon cancer cell line produces a 3- to 4-fold increase in the level of resistance to this agent. The resistant cells (HT6-8) have an enhanced capacity to metabolize the parent drug and efflux it from the cell. This is reflected in a 5-fold enhanced decompositioning rate constant for ethacrynic acid in HT6-8 (3.47 × 10−3min−1) versus wild type cells (1.58 × 10−2min−1). We observed that the glutathione conjugate of ethacrynic acid is an effective competitive inhibitor for binding to the multidrug resistance-associated protein by [35S]azidophenacyl-glutathione, a photoaffinity analog of glutathione. In addition, the HT6-8 cells overexpressed multidrug resistance-associated transcript 2- to 3-fold. These results suggest that resistance to ethacrynic acid results from a concerted, coordinate increase in defense mechanisms which detoxify the drug and remove its conjugate via plasma membrane efflux.

Polycarpine dihydrochloride: A cytotoxic dimeric disulfide alkaloid from the indian ocean ascidian Polycarpa clavata

Polycarpine dihydrochloride ( 1),a new cytotoxic dimeric disulfide alkaloid, and four related compounds ( 2–5) have been isolated from extracts of the ascidian Polycarpa clavata (Hartman, 1919) collected in Western Australia. The structure of the new alkaloid was determined on the basis of comprehensive spectral studies and by interconversion to its free base and several degradation products. On silica chromatography, 1 was converted to the corresponding unstable free base ( 2) which decomposed, via cleavage of the disulfide bridge, into monomeric derivatives. Polycarpine dihydrochloride is cytotoxic against the human colon tumor cell line HCT-116 at 0.9 μg/ml.

Levamisole effects on major histocompatibility complex and adhesion molecule expression and on myeloid cell adhesion to human colon tumor cell lines.

The drug levamisole has been successfully used in combination with fluorouracil to increase the disease-free interval and survival of patients who have undergone surgical resection of Dukes' stage C colon cancer. Levamisole is thought to affect the host immune response. Several recent studies have examined its effect on the expression of major histocompatibility complex (MHC) class I molecules, but the results have been inconsistent. An equally important requirement for a host cellular immune response is the adhesion of leukocytes to tumor cells. The latter may be required for cell-mediated antitumor cytotoxic responses. We evaluated the ability of levamisole to affect the expression of MHC class I molecules and cell-adhesion molecules and determined whether levamisole could affect leukocyte adhesion to tumor cells that had been treated with the drug. A panel of four human colon tumor cell lines (HT-29, SW-620, HCT-15, and LoVo), A-375 human melanoma cells, and human umbilical vein endothelial cells (HUVEC) were cultured in the presence of levamisole and examined by solid-phase enzyme immunoassay to determine the level of expression of MHC class I, intercellular adhesion molecule 1 (ICAM-1), vascular cell-adhesion molecule-1 (VCAM-1), leukocyte integrin VLA-4, and lymphocyte-functional antigen (LFA-1) molecules. Adhesion of HL-60 and THP-1 myeloid cells to tumor cells was also evaluated. Tumor necrosis factor (TNF) at 10 ng/mL was used as a positive control for increasing adhesion molecule expression and cell-cell adhesion. The statistical significance of differences in cell surface molecule expression and functional adhesion between treated and control cells were tested by use of analysis of variance and the two-tailed Dunnett's test. Treatment with levamisole (0.1 and 1 micrograms/mL) caused the levels of MHC class I expression to increase approximately threefold above control levels on HCT-15 and LoVo colon tumor cells (P < .05 in each case) compared with untreated cells, caused minimal increases on HT-29 cells (to 1.5 times control levels), but caused no significant increases on SW-620 colon tumor or A-375 melanoma cells. The HCT-15 and LoVo colon tumor cells had very low basal MHC expression Levamisole (1 micrograms/mL) increased VCAM-1 expression on HT-29 and SW-620 colon tumor cells to 4.3 and 2.4 times (P < .05 in each case) control levels, respectively, doubled ICAM-1 expression on HT-29 cells (P < .05), and increased LFA-1 expression on HT-29, LoVo, and A-375 cells to 2.1, 3.2, and 1.8 (P < .05 in each case) times control levels, respectively. TNF (10 ng/mL) was used as a positive control and yielded increased expression of MHC class I molecules on the HT-29, LoVo, SW-620, and HCT-15 cells (2.5, 7.8, 1.9, and 4.8 times control levels, respectively; P < .05 in each case). TNF increased VCAM-1 expression to 4.2 times the vehicle-treated control levels (P < .05) on HT-29 cells and increased ICAM-1 expression on HT-29, LoVo, and SW-620 cells (8.4, 1.8, and 1.9 times vehicle control levels, respectively; P < .05 in each case). THP-1 and HL-60 cells demonstrated increased adhesion to levamisole-treated HT-29 colon tumor cells. HL-60 cells also exhibited increased levamisole-mediated adherence to LoVo and HCT-15 cells. Adherence by THP-1 was significantly improved after levamisole treatment of the HUVEC, SW-620, and A-375 cells (P < .05 in each case). Levamisole can directly affect the expression and function of molecules that are engaged in cell-cell recognition and signaling on the surfaces of some tumor cell lines. However, no consistent pattern between cell-adhesion molecule expression, cell-cell adhesion, or levamisole concentration could be discerned.

Diallyl disulfide induces apoptosis of human colon tumor cells.

The present studies compared the effects of various oil-soluble compounds containing allyl and disulfide groups on the proliferation of cultured human colon tumor cells (HCT-15). Diallyl disulfide (DADS) was more effective in inhibiting the growth of HCT-15 cells than isomolar concentrations of S-allyl cysteine, dipropyl disulfide (DPDS), allyl chloride, allyl glycidyl ether and allyl alcohol. These studies clearly demonstrate the importance of both the diallyl and the disulfide groups in DADS. Treatment of HCT-15 cells with 100 microM DADS increased the intracellular calcium levels by 40%, while DPDS caused only a 12% increase in intracellular calcium. Exposure to 100 microM DADS or more, but not DPDS, caused the cells to undergo apoptosis as determined by morphological changes and DNA fragmentation. A positive correlation (r=0.944) was found between DADS-induced DNA fragmentation and its ability to increase intracellular free calcium levels. The widespread effectiveness of DADS was evident by its ability to inhibit the growth of human colon (HCT-15), skin (SK MEL-2) and lung (A549) tumor cell lines.

Clonal heterogeneity of the sensitivity of human colon carcinoma cell lines to TGE beta isoforms.

Spontaneously arising, TGF beta 1-resistant colonies were isolated directly from the soft agarose plates of MOSER human colon carcinoma cells grown in the presence of TGF beta 1 but in the absence of serum. The colonies were cloned by limiting dilution and screened in a monolayer proliferation assay for sensitivity to TGF beta 1 and TGF beta 2 isoforms. Cell clones selectively sensitive or resistant to these isoforms in the growth inhibition assay displayed similar differential sensitivities to TGF beta isoforms for production of the extracellular matrix proteins laminin and fibronectin, as well as for the expression of the colon cell differentiation marker carcinoembryonic antigen. Differential receptor binding profiles for TGF beta 1 and TGF beta 2 were observed among the clones. The isolation of cell clones selectively resistant or sensitive to TGF beta isoforms as well as the identification of differential receptor binding profiles among the clones indicate the heterogeneity of TGF beta responsiveness that exists naturally in human colon tumor cells and stress the importance of defining mechanisms underlying differential responsiveness to TGF beta isoforms.

Metabolic alterations of zinc and prostaglandins in both human and animal colonic tumor cells.

To understand the relationship between zinc and prostaglandin (PG) metabolisms in inducing colon cancer incidence in human and animals. Human colonic tumor and normal cells were obtained from Departments of Surgery and Pathology at the Kaiser Permanente Medical Center, Los Angeles, CA and US VA Medical Center, North Hills, CA. Rat colonic tumor and normal cells were isolated from the rats that received two injections of 50 mg/kg of Azoxymethan (AOM) in 2 weeks and then kept 30 weeks in the animal facility. Then, the effects of zinc on the PGE2 synthesis and PGE2 on zinc metabolism in tumor and normal cells were determined. PGE2 concentrations in both human and AOM-induced rat colonic tumor cells increased compared to those in adjacent normal colonocytes, whereas PGF2 alpha concentrations did not change. Gene expression of inducible form of prostaglandin synthase (PGS-2) is stimulated in rat colonocytes by epidermal growth factor and by tetradecanoyl 13-phorbol acetate (a tumor promoter and mitogen) only in the presence of zinc. PGE2 binding activity of rat enterocytes was maximum at 15 microM of zinc (normal plasma zinc concentration), but PGE2 synthesis activity increased for the first 15 minutes when extracellular zinc concentrations were either higher or lower than the normal extracellular zinc concentration. However, variations in extracellular zinc concentrations did not change the rate of PGF2 alpha synthesis in the normal rat enterocytes. PGE2 significantly increased zinc uptake rates of colonic tumor cells but PGF2 alpha showed only moderate effect. These results suggest that zinc is required for PGS-2 gene expression, that maintaining an optimal zinc nutriture is important for normal PG synthesis of intestinal cells, and that only PGE2 synthesis mechanisms rather than PGS-2 gene expression are altered in colonic tumor cells resulting in the abnormal zinc nutriture of these cells.

Quantification of 5-Fluorouracil Incorporation into RNA of Human and Murine Tumors as Measured with a Sensitive Gas Chromatography-Mass Spectrometry Assay

5-Fluorouracil (5FU) can exert its cytotoxic activity by either inhibition of thymidylate synthase or incorporation into RNA. The extent and importance of the latter in tumors of patients are not clear, due to the lack of sensitive and reproducible methods. RNA from 5FU-treated human WiDr colon tumor cells was isolated and [ 14C]5FU incorporation into RNA was measured by traditional scintillation counting while that of nonradiolabeled 5FU was measured with the present, new method. For the latter purpose, isolated RNA was incubated with RNase, alkaline phosphatase, and uridine phosphorylase, resulting in a complete degradation of RNA, nucleotides, and nucleoside to 5FU. 5FU was then measured with gas chromatography coupled to mass spectrometry. For both methods RNA incorporation was 0.4 pmol/h/μg RNA at 25 μM 5FU while a similar time (up to 4 h) and concentration dependence (25 to 50 μM) were found. Reproducibility of the assay was more than 95%. In a murine colon tumor 5FU incorporation into RNA reached a peak of 10 pmol/μg RNA at 2 h after administration of the maximum tolerated dose of 80 mg 5FU/kg, which was retained until at least 72 h at 2.5 pmol/μg. In tumors from patients treated with 500 mg 5FU/m 2 incorporation into RNA after 24 h amounted to 1.0-1.5 pmol/μg; RNA. In conclusion, a novel approach, combining different sensitive and reproducible techniques, was established to measure 5FU incorporation into RNA in clinical tumor specimens enabling determination of its clinical relevance.

Quantitative analysis of 3'-azido-3'-deoxythymidine incorporation into DNA in human colon tumor cells.

We have previously reported that 3'-azido-3'-deoxythymidine (AZT) can possess significant antineoplastic activity in vitro and in vivo when combined with agents which inhibit de novo thymidylate synthesis. Under these conditions cytotoxicity is closely associated with the degree to which AZT is incorporated into DNA. We now report a fluorescence postlabeling technique by which AZT incorporation into DNA can be quantitated without employing radiolabeled AZT. Cultured human colon tumor (HCT-8) cells were exposed to various concentrations of AZT alone and in combination with 5-fluorouracil (FUra). Control cells received the same amount of medium. DNA was isolated from harvested cell pellets (2 x 10(7)). Enzymatic digestion of DNA to the mononucleotide level followed by HPLC analysis of the digest showed that the DNA preparation was free of RNA contamination. The DNA digest was conjugated with dansyl chloride in situ via the phosphoramidate derivative with ethylenediamine. HPLC analysis of the postlabeled nucleotides using fluorescence detection detected 105, 245, and 479 fmol of 5'-monophosphate of AZT (AZTMP) per microg of DNA from cells exposed to 20, 50, and 100 microM AZT, respectively. FUra (3 microM) doubled the AZT incorporation per microg of DNA in cells exposed to 50 and 100 microM AZT. These findings generally support our previously reported data which quantitated (3H)AZT incorporation into cellular DNA and are discussed in light of the potential clinical utility of this technique in assessing the relationship between AZT incorporation into DNA and therapeutic action.

Secretion rates and levels of vascular endothelial growth factor in clone A or HCT-8 human colon tumour cells as a function of oxygen concentration.

Molecular and in situ hybridization studies have shown, in a number of cell types, that under hypoxic conditions, vascular endothelial growth factor (VEGF) mRNA expression is up-regulated and VEGF protein is concomitantly increased. To establish a quantitative relationship between VEGF protein levels and oxygenation, we exposed exponentially growing clone A or HCT-8 human colon tumour cells in vitro (22 h at 37 degrees C) to oxygen concentrations from 21% (air mixture) to 0.01%. Protein levels in cells and medium were then assayed using an enzyme-linked immunoabsorbent assay (ELISA). Intracellular levels of VEGF in clone A or HCT-8 cells exposed to either air (21% O2) or the 0.01% O2 mixture respectively increased from about 73 to 1270, and 1.5 to 1180 pg/10(6) cells (about 17- and 80-fold increases). The shapes of the response curves (log of the intracellular VEGF concentrations v. log oxygen concentration) for both cell types were sigmoidal. However, intracellular VEGF levels in HCT-8 cells were always less than that of clone A cells until levels of about 0.3 to 0.1% O2 were reached. Levels of VEGF in the supernatant were also increased after the 22 h hypoxic exposures. Because cell proliferation and clonogenicity were also measured, it was possible to estimate the secretion rates of VEGF for both cell lines as a function of oxygen percentage. For clone A cells, the secretion rate (pg/10(6) cells/h) in 21% O2 was 62.5. This rate increased to 428.8 pg/10(6) cells/h at 0.01% O2, a 7-fold increase. For HCT-8 cells, levels in the medium at 21% O2 were too low to be measured by ELISA. However, between 10% and 0.01% O2, secretion rates increased from 5.0 to 376.0 pg/10(6) cells/h, a 75-fold increase. Therefore, at very low O2 levels, VEGF secretion rates were similar in the two cell lines. We propose that the different VEGF responses of clone A and HCT-8 colon tumour cells to hypoxic stress in vitro are related to the in vivo observation that the respective hypoxic percentages of solid neoplasms originating from these cell lines are markedly different (i.e. about 3 versus 80%) at equivalent volumes of 750 mm3.

P-glycoprotein expression by human colonic tumor cells influences the growth of tumor cells in vitro.

The stability of P-glycoprotein expression by high and low expressing cells obtained by flow sorting from two cell lines established from colonic tumors was assessed. Low expressing cells rapidly recovered expression to a level that was comparable to that determined for uncloned cells. High expressing cells maintained a high level of expression relative to the parental uncloned lines, although there was continuous reversion to a level of expression determined for the parental line with time. The population growth rates for high expressing cells was greater than that of parental and low expressing cells when assessed immediately following plating of sorted cells. The data suggest that high expression of P-glycoprotein confers a growth advantage which may increase repopulation and dissemination of tumor cells following drug therapy.

Levels of selected growth factors in viable and necrotic regions of xenografted HCT‐8 human colon tumours

Xenografted tumours were produced in nude mice by injection of HCT-8 human colon tumour cells. At average volumes of about 750 mm3, animals were injected with fast green vital dye, and 20 min later, tumours were excised and dissected into viable (stained) and necrotic portions (unstained). Viable and necrotic regions were then examined for cell yields, colony forming efficiencies, and levels of basic fibroblast growth factor (FGF-2), transforming growth factors-beta 1 and -alpha (TGF-beta 1, TGF-alpha), platelet derived growth factor (PDGF), and vascular endothelial growth factor (VEGF) using enzyme-linked immunoassay (ELISA) procedures. Levels in the viable and necrotic regions were compared to levels in unseparated tumours. The average extent of necrosis in HCT-8 tumours of this size was 64%. The data for cell yields, colony forming efficiencies FGF-2, VEGF, TGF-beta 1 and TGF-alpha indicated that values determined in the unseparated tumours could be understood on the basis of the weighted average between viable and necrotic tissue, with the higher values occurring in the viable tissue. Low levels of FGF-2 and VEGF were found in the necrotic portions of the tumour while no measurable levels of TGF-beta 1 and TGF-alpha could be determined. PDGF levels were, however, equivalent in both the viable and necrotic regions indicating that necrotic tissue could be an important reservoir for this growth factor.

Sensitization of human colon tumour cell lines to carmustine by depletion of O6-alkylguanine-DNA alkyltransferase.

In nine human colon tumour cell lines the relationship between O6-alkylguanine-DNA alkyltransferase (O6-AGT) activity and carmustine resistance was investigated. Three lines with O6-AGT activity below 25 fmol/mg protein had carmustine ED50 values ranging from 5.0 microM to 11.9 microM; six lines displaying an O6-AGT activity above 240 fmol/mg protein had ED50 values ranging from 28.9 microM to 69.5 microM. In lines with low O6-AGT activity, depletion of the repair protein by O6-benzylguanine resulted in a marginal increase of carmustine cytotoxicity (sensitization factors less than 2). In the majority of cell lines with high O6-AGT activity, pretreatment with O6-benzylguanine resulted in a pronounced sensitization to carmustine. In one line, an optimal time schedule for sensitization of colon tumour cells by O6-benzylguanine was assessed; continuous exposure to O6-benzylguanine > or = 16 h after carmustine exposure) was superior to short-term exposure limited to a period before carmustine treatment.

The isolation and structures of unusual 1, 4-polyketides from the dinoflagellate, Amphidinium sp.

Unusual 1,4-polyketides with cytotoxic activity against human colon tumor cells were isolated from the dinoflagellate, Amphidinium sp. and their significance with respect to the mode of dinoflagellate polyketide biosynthesis was discussed.

Clonogenic Survival Studies of Human Colon Tumor Cell Lines In Vitro: Combined Hyperthermia, 5-Fluorouracil/Leucovorin, Carboplatin and Tumor Necrosis Factor

The responses of DLD-1 and HCT-15 human colon adenocarcinoma cells to hyperthermia, 5-fluorouracil (5-FU)/leucovorin, carboplatin and tumor necrosis factor-alpha, singly and in multiple combinations, were evaluated in clonogenic assays. The combination of hyperthermia with the lower dose combination resulted in a survival fraction of about 0.005 to 0.001 for both cell types, whereas estimated additive interactions alone would have resulted in a survival fraction of about 0.5 (DLD-1) or 0.05 (HCT-15). A survival fraction of 0.00001 or greater was observed when the higher dose levels were combined with hyperthermia, whereas additive interactions alone would have achieved a decrease of only 0.001 or 0.0001 in the surviving fraction. The combination of the three other modalities at either dose level under conditions of hyperthermia or normothermia achieved statistically significant apparently supra-additive losses of clonogenicity in HCT-15 cells; similar results were obtained with the lower dose level in DLD-1 cells. Our results suggest that human colon tumor cells are markedly sensitive to this combination of modalities when used at clinically achievable dose levels.

8-Substituted O6-benzylguanine, substituted 6(4)-(benzyloxy)pyrimidine, and related derivatives as inactivators of human O6-alkylguanine-DNA alkyltransferase.

Several 8-substituted O6-benzylguanines, 2- and/or 8-substituted 6-(benzyloxy)purines, substituted 6(4)-(benzyloxy)pyrimidines, and a 6-(benzyloxy)-s-triazine were tested for their ability to inactivate the human DNA repair protein, O6-alkylguanine-DNA alkyltransferase (AGT, alkyltransferase). Two types of compounds were identified as being significantly more effective than O6-benzylguanine (the prototype low molecular weight inactivator) at inactivating AGT in human HT29 colon tumor cell extracts. These were 8-substituted O6-benzylguanines bearing electron-withdrawing groups at the 8-position (e.g. 8-aza-O6-benzylguanine and O6-benzyl-8-bromoguanine) and 5-substituted 2,4-diamino-6-(benzyloxy)pyrimidines bearing electron-withdrawing groups at the 5-position (e.g. 2,4-diamino-6-(benzyloxy)-5-nitroso- and 2,4-diamino-6-(benzyloxy)-5-nitropyrimidine). The latter derivatives were also more effective than O6-benzylguanine at inactivating AGT in intact HT29 colon tumor cells. Provided these types of purines and pyrimidines do not exhibit undesirable toxicity, they may be superior to O6-benzylguanine as chemotherapeutic adjuvants for enhancing the effectiveness of antitumor drugs for which the mechanism of action involves modification of the O6-position of DNA guanine residues.

The Tumor-Selective Somatostatin Analog, TT2-32 Induces a Biphasic Activation of Phosphotyrosine Phosphatase Activity in Human Colon Tumor Cell Line, SW620

Somatostatin has been demonstrated to activate phosphotyrosine phosphatases (PTPases) in pancreatic cells. In this work we studied the effect of a tumor-selective somatostatin structural derivative, TT2-32, on the PTPase activity in the SW620 human colon tumor cell line. TT2-32 caused a strong inhibition of cell proliferation. In response to TT2-32 we found a rapid and sustained increase (5-30 min) in PTPase activity showing two maxima at 0.1 and 30 microM concentrations, respectively. During short-term incubation tyrosine kinase activity was much less affected by TT2-32. TT2-32-induced activation of PTPases may be an important early step in the signaling cascade in the inhibition of cell proliferation in colon carcinomas.

Carbohydrate structures of recombmant soluble lamp-1 and leukosialin containing sialyl Le x terminus

Recombinant soluble lamp-1 and soluble leukosialin can be produced from CHO cells which express sialyl Le x structures after stable transfection of fucosyltransferase-III. It was shown previously that those soluble lamp-1 and leukosialin are potent inhibitors for E-selectin-mediated adhesion of human colonic tumor cells (Sawada, R.; Tsuboi, S.; Fukuda, M. J. Biol. Chem., 1994, 269, 1425). In the present study, we have determined the amount of the sialyl Le x structure present in recombinant, soluble lamp-1 and soluble leukosialin. CHO cells were metabolically labeled with [ 3HJ-galactose and recombinant soluble lamp-1 and leukosialin were purified from the spent medium. Glycopeptides containing N-glycans derived from lamp-1 were fractionated by sequential lectin affinity chromatography. Similarly, O-glycans released from leukosialin were fractionated by Bio-Gel P-4 gel filtration. The terminal structures of carbohydrate chains were determined by sequential digestion with specific glycosidases. The results clearly indicate that soluble lamp-1 contains much more sialyl Le x structure than soluble leukosialin. Considering that soluble leukosialin and lamp-1 are almost equally effective as inhibitors for E-selectin-mediated adhesion, the results strongly suggest that densely clustered O-glycans are better presenters for E-selectin ligands than N-glycans.

3′-azido-3′-deoxythymidine cytotoxicity and metabolism in the human colon tumor cell line HCT-8

We have reported that 3′-azido-3′-deoxythymidine (AZT) possesses significant cytotoxicity in human tumor models when combined with agents that inhibit de novo thymidylate (dTMP) synthesis, such as 5-fluorouracil (FUra) and methotrexate (MTX). To aid in the further development of these and related cancer chemotherapeutic regimens, this study was undertaken to identify the biochemical processes relevant to the induction of AZT cytotoxicity in the model human colon tumor cell line HCT-8. The ic 50 of AZT in this cell line after a 5-day exposure was 55 μM. In cells incubated for 5 days with various concentrations of [ 3H]AZT alone, both [ 3H]AZT nucleotide pools and [ 3H]AZT incorporation into DNA increased as the concentration of AZT in the medium increased. In addition, a 5-day exposure to AZT, at medium concentrations ⩽ 100 μM, resulted in a reduction in dTMP synthase (EC 2.1.1.45; methylene tetrahydrofolate:deoxyuridine-5′-monophosphate C methyltransferase) and dThd kinase (EC 2.7.1.27; ATP: thymidine phosphotransferase) activities, compared with cells incubated without drug. The ic 50 of AZT was unchanged when the medium concentration of dThd was increased from 0.1 to 50 μM. Increasing the concentration of dThd to 50 μM also did not affect intracellular pools of [ 3H]AZTDP and [ 3H]AZTTP or the degree to which [ 3H]AZT was incorporated into cellular DNA, but did reduce intracellular [ 3H]AZTMP by ∼ 75%. The degree to which 3′-amino-3′-deoxythymidine (AMT) was generated from AZT and incorporated into DNA also was not affected by varying the medium concentration of dThd. However, the amount of [ 3H]-AMT detected in DNA, ⩽ 3 pmol/10 6 cells at medium concentrations of [ 3H]AZT ⩽ 100 μM, was below that associated with significant cytotoxicity in these cells. These data support the notion that, in this model, AZT cytotoxicity is determined by the relative size of AZTTP pools and its utilization in DNA synthesis. Studies to verify this relationship assessed the effect of alterations in the concentration of dTTP and [ 3H]AZTTP on [ 3H]AZT incorporation into newly synthesized DNA in vitro, using DNA polymerases isolated from HCT-8 cells. The results of these studies confirmed that alterations in the concentration of either dTTP or AZTTP to reduce the dTTP/AZTTP ratio resulted in an increase in AZT incorporation into DNA. These findings are discussed in light of their biochemical implications and relevance to ongoing clinical trials.