Highest Number Of Infections Research Articles

English

The prevalence of infectious diseases is increasing in developing countries, and this may threaten the biological safety of donated blood. The present study aimed to investigate the seroprevalence of syphilis among male blood donors in Thi-qar province, Iraq during the period of 2007 to 2011. The study was carried out at the central blood bank of Al-Nasiriyah city, Iraq for a period of five years and screened all male blood donors for syphilis using enzyme-linked immunosorbent assay (ELISA) technique. Results were confirmed by using alternative commercial kits in the Central Health Laboratory in Baghdad. Chi-square (c2) test was used to evaluate the study result.  From 2007 to 2011, a total of 52,723 male blood samples were analyzed. The overall prevalence rate of syphilis infection was (0.36%) with 192 donors showed positive sera for the five years study period with a high number of infections in 2011 year with 111 donor (57.81%). The age of donors ranged between 18 and 71 years old. The age group of 50 to 59 years showed the highest number of infections with 110 donors (57.29%), while the lowest numbers of infections were recorded in 18 to 28 age group with 9 donors (4.69%). Labourers were the most group infected with syphilis with 131 donors (68.22%), followed by policemen and civil servants with 38 (19.80%) and 23 (11.98%), respectively. According to health sections, Nasiriyah section recorded the highest infections with 146 donor (76.04%), followed by Al-Shatra, Suk-Alshuuk and Al-Refaee health sections with 24 (12.50%), 14 (7.30%) and 8 (4.16%), respectively. The present study finding may suggest that syphilis infections continue to be low in Iraq, but need more follow up programs to improve safety of blood transfusion process.   Key words: Blood donors, enzyme linked immunosorbent assay, seroprevalence, syphilis, labourers.

Mannose-binding lectin gene variants and infections in patients receiving autologous stem cell transplantation.

BackgroundSerious infections are common in patients undergoing autologous stem cell transplantation (ASCT) mainly because of the effects of immunosuppression. The innate immune system plays an important role in the defense against different infections. Mannose binding lectin (MBL) is a central molecule of the innate immune system. There are several promoter polymorphisms and structural variants of the MBL2 gene that encodes for this protein. These variants produce low levels of MBL and have been associated with an increased risk for infections.MethodsProspective cohort study. The incidence, severity of infections and mortality in 72 consecutive patients with hematologic diseases who underwent ASCT between February 2006 and June 2008 in a tertiary referral center were analyzed according to their MBL2 genotype. INNO-LiPA MBL2 was used for MBL2 gene amplification and genotyping. Relative risks (RR) (IC95%) as measure of association were calculated. Multivariate analysis was performed using logistic regression.ResultsA statistically significant higher number of fungal infections was found in patients with MBL2 variants causing low MBL levels (21.1%versus1.9%, p=0.016). In this MBL2 variant group infection was more frequently the cause of mortality than in the MBL2 wild-type group (p=0.05). Although not statistically significant, there was a higher incidence of major infections in the MBL2 variant group as well as a higher number of infections caused by gram-positive bacteria.ConclusionsLow-producer MBL2 genotypes were associated with an increased number of fungal infections in ASCT patients, which would suggest that MBL has a protective role against such infections. ASCT patients with MBL2 variant genotypes are more likely to die as a result of an infection.

Predictive Factors of Infection in the First Year after Kidney Transplantation

BackgroundInfectious disease, a complication favored by immunosuppression, is the main cause of 1st-year mortality in solid organ transplantation. In renal transplant recipients (RTRs), urinary tract infection (UTI) is the most common, and the microorganisms that are isolated depend on chronology. MethodsWe present an observational study comprising 129 RTRs from January 2010 to December 2011 who were followed during the 1st year after transplantation. We analyzed occurrence of infections, predisposing factors, timing, severity, site of infection, and microorganisms. ResultsThe patients had a total of 424 infectious episodes during the 1st year (3.29 episodes/patient/year). The predominant focus was the urinary tract, with at least 1 episode in 69.8% of patients. Bacteremia was recorded in 25.6% of patients and surgical wound infection in 20.9%. Cytomegalovirus infection or disease was diagnosed in 46.5%. Severe infections occurred in 30.2%. The predominant pathogen was E. coli. There was a significant correlation between hospital stay and the number of infections (P = .000; r = 0.407) and between body mass index and hospital stay (P = .001; r = 0.282). Severe infections were more frequent in diabetics, patients with a double-J stent, and those treated with basiliximab. Patients with cytomegalovirus replication had a higher number of infections (4.1 ± 1.2 vs 2.5 ± 5; P = .000) and significantly higher annual serum creatinine (1.65 ± 5.7 vs 1.31 ± 1.3 mg/dL; P = .003). ConclusionsThe prevalence of infections in the 1st year after kidney transplantation is very high, occurring mainly in the early period, in the urinary tract, and due to E. coli. Cytomegalovirus replication is associated with a higher number of infections and higher serum creatinine at 1 year. Body mass index is a predictor of early infection and of bacteremia in the post-transplantation period. Basiliximab induction and having a double-J stent were predictors of severe infections.

Pupal cocoons affect sanitary brood care and limit fungal infections in ant colonies.

BackgroundThe brood of ants and other social insects is highly susceptible to pathogens, particularly those that penetrate the soft larval and pupal cuticle. We here test whether the presence of a pupal cocoon, which occurs in some ant species but not in others, affects the sanitary brood care and fungal infection patterns after exposure to the entomopathogenic fungus Metarhizium brunneum. We use a) a comparative approach analysing four species with either naked or cocooned pupae and b) a within-species analysis of a single ant species, in which both pupal types co-exist in the same colony.ResultsWe found that the presence of a cocoon did not compromise fungal pathogen detection by the ants and that species with cocooned pupae increased brood grooming after pathogen exposure. All tested ant species further removed brood from their nests, which was predominantly expressed towards larvae and naked pupae treated with the live fungal pathogen. In contrast, cocooned pupae exposed to live fungus were not removed at higher rates than cocooned pupae exposed to dead fungus or a sham control. Consistent with this, exposure to the live fungus caused high numbers of infections and fungal outgrowth in larvae and naked pupae, but not in cocooned pupae. Moreover, the ants consistently removed the brood prior to fungal outgrowth, ensuring a clean brood chamber.ConclusionOur study suggests that the pupal cocoon has a protective effect against fungal infection, causing an adaptive change in sanitary behaviours by the ants. It further demonstrates that brood removal–originally described for honeybees as “hygienic behaviour”–is a widespread sanitary behaviour in ants, which likely has important implications on disease dynamics in social insect colonies.

Childhood atopic dermatitis and warts are associated with increased risk of infection: A US population-based study

Previous studies suggested that atopic dermatitis (AD) is associated with aberrant immune responses, which might predispose toward both cutaneous and extracutaneous infections. The goal of this study was to determine whether childhood AD is associated with increased risk of warts, extracutaneous infections, and other atopic diseases and how these disorders cosegregate. The 2007 National Health Interview Survey from a nationally representative sample of 9417 children age 0 to 17 years was used. Children with AD and other atopic disease had higher odds of warts. In contrast, children with AD with or without other atopic disease had higher odds of extracutaneous infections, including strep throat, other sore throat, head or chest cold, influenza/pneumonia, sinus infections, recurrent ear infections, chickenpox, and urinary tract infections (P < .0001). Children with AD and other atopic disease had a higher number of infections than those with either disorder by itself (P < .0001). Warts were also associated with increased odds of all extracutaneous infections (P < .0001), except recurrent ear infections. Children with warts and AD had a higher number of infections than those with either disorder alone (P < .0001). Finally, children with AD and warts had higher odds of ever receiving a diagnosis of asthma, current asthma, asthma exacerbation in the past year, hay fever, and food allergy. Children with AD with warts had even higher odds of asthma, hay fever, and food allergies than those with AD and no warts. The associations between childhood AD, atopic disease, warts, and extracutaneous infections suggest that barrier disruption, immune disruption, or both contribute to susceptibility to warts and extracutaneous infections in children.

Novel phylogenetic algorithm to monitor human tropism in Egyptian H5N1-HPAIV reveals evolution toward efficient human-to-human transmission.

Years of endemic infections with highly pathogenic avian influenza (HPAI) A subtype H5N1 virus in poultry and high numbers of infections in humans provide ample opportunity in Egypt for H5N1-HPAIV to develop pandemic potential. In an effort to better understand the viral determinants that facilitate human infections of the Egyptian H5N1-HPAIVvirus, we developed a new phylogenetic algorithm based on a new distance measure derived from the informational spectrum method (ISM). This new approach, which describes functional aspects of the evolution of the hemagglutinin subunit 1 (HA1), revealed a growing group G2 of H5N1-HPAIV in Egypt after 2009 that acquired new informational spectrum (IS) properties suggestive of an increased human tropism and pandemic potential. While in 2006 all viruses in Egypt belonged to the G1 group, by 2011 these viruses were virtually replaced by G2 viruses. All of the G2 viruses displayed four characteristic mutations (D43N, S120(D,N), (S,L)129Δ and I151T), three of which were previously reported to increase binding to the human receptor. Already in 2006–2008 G2 viruses were significantly (p<0.02) more often found in humans than expected from their overall prevalence and this further increased in 2009–2011 (p<0.007). Our approach also identified viruses that acquired additional mutations that we predict to further enhance their human tropism. The extensive evolution of Egyptian H5N1-HPAIV towards a preferential human tropism underlines an urgent need to closely monitor these viruses with respect to molecular determinants of virulence.

Candidaemia in polish hospitals – a multicentre survey

Significant changes in the frequency of candidaemia and the distribution of causative species have been noted worldwide in the last two decades. In this study, we present the results of the first multicentre survey of fungaemia in Polish hospitals. A total of 302 candidaemia episodes in 294 patients were identified in 20 hospitals during a 2-year period. The highest number of infections was found in intensive care (30.8%) and surgical (29.5%) units, followed by haematological (15.9%), 'others' (19.2%) and neonatological (4.6%) units. Candida albicans was isolated from 50.96% of episodes; its prevalence was higher in intensive care unit and neonatology (61.22% and 73.33%, respectively), and significantly lower in haematology (22%; P<0.001). The frequency of C. krusei and C. tropicalis was significantly higher (24% and 18%) in haematology (P<0.02); whereas, the distribution of C. glabrata (14.1%) and C. parapsilosis (13.1%) did not possess statistically significant differences between compared departments. Obtained data indicates that species distribution of Candida blood isolates in Polish hospitals reflects worldwide trends, particularly a decrease in the prevalence of infections due to C. albicans.

Diffusion Centrality in Interconnected Networks

The identification of influential or vulnerable nodes in a network is garnering considerable attention nowadays owing to the recent increase in the connectedness of society. Further, knowledge of the properties of interconnected networks is fundamental because of its viable application to the understanding of modular structures that often appear in real-world networks. In this paper, we focus on analysis of centrality, which is defined as the relative importance of a node in a network, and its effect on the probabilistic diffusion dynamics in interconnected networks. We propose a numerical framework in which the importance of the type of the centrality changes along with the diffusion regimes. It is well known that a critical point exists that, when crossed by the infection rate, results in epidemics [1,2]. During the subcritical regime where the infection rate is below the critical point and no epidemics occur, the nodes with the highest number of infections (vulnerable nodes) can be indicated by the alpha centrality, which can be approximated by the degree centrality when the infection rate is almost zero, and the eigenvector centrality when the infection rate approaches the critical point. This theory is examined in numerous simulations using several types of interconnected network. The simulation results fit the estimation of our numerical framework in a small toy network during the subcritical regime. However, interconnection between some networks and the complexity of a network reduce the accuracy of our approximation of the numerical framework, as predicted by our numerical frameworks. Our simulation results also imply that during the critical regime when the infection rate is around the critical point, the type of centrality that can indicate the vulnerable nodes differ according to the topology of the network. In addition, during the supercritical regime, in which the infection rate is sufficiently large, the importance of centrality cannot be discriminated because the number of infections on each node becomes almost the same.

Mistletoes Play Different Roles in a Modular Host–Parasite Network

ABSTRACTAntagonistic interactions between host plants and mistletoes often form complex networks of interacting species. Adequate characterization of network organization requires a combination of qualitative and quantitative data. Therefore, we assessed the distribution of interactions between mistletoes and hosts in the Brazilian Pantanal and characterized the network structure in relation to nestedness and modularity. Interactions were highly asymmetric, with mistletoes presenting low host specificity (i.e., weak dependence) and with hosts being highly susceptible to mistletoe‐specific infections. We found a non‐nested and modular pattern of interactions, wherein each mistletoe species interacted with a particular set of host species. Psittacanthus spp. infected more species and individuals and also caused a high number of infections per individual, whereas the other mistletoes showed a more specialized pattern of infection. For this reason, Psittacanthus spp. were regarded as module hubs while the other mistletoe species showed a peripheral role. We hypothesize that this pattern is primarily the result of different seed dispersal systems. Although all mistletoe species in our study are bird dispersed, the frugivorous assemblage of Psittacanthus spp. is composed of a larger suite of birds, whereas Phoradendron are mainly dispersed by Euphonia species. The larger assemblage of bird species dispersing Psittacanthus seeds may also increase the number of hosts colonized and, consequently, its dominance in the study area. Nevertheless, other restrictions on the interactions among species, such as the differential capacity of mistletoe infections, defense strategies of hosts and habitat types, can also generate or enhance the observed pattern.Abstract in Portuguese is available at http://www.blackwell‐synergy.com/loi/btp.

Urban-Rural estimation of hepatitis c virus infection sero-prevalence in North Central Nigeria

The epidemiology of hepatitis C virus (HCV) infection has been partially described for at risk groups in urban communities in Nigeria. On the other hand, literature on the possible spread of the virus in rural Nigeria remains extremely scanty. The objective of this study was to estimate the prevalence of HCV in a rural and urban community in Nigeria. Four hundred and twenty four (n = 424) plasma samples belonging to 238 rural inhabitants and 186 urban dwellers in North Central Nigeria were tested for anti-HCV markers using a third generation quantitative enzyme-linked immunosorbent assay (ELISA) that uses recombinant proteins and synthetic peptides derived from core and non-structural regions. 29(12.2%, CI = 0.17-0.86) of the rural samples and 5(2.7%, CI = 0.01-0.06) of urban samples were positive for HCV infection. The highest number of infections was in the 21-40 years age category. Our preliminary findings indicates that the number of HCV infection in rural was higher (p = 0.03) when compared with urban settings in Nigeria. Our results suggest a higher prevalence of HCV infection in rural than urban Nigeria in the region studied and possibly in Nigeria as a whole. HCV transmission is active in rural Nigeria and large scale studies to understand the dynamics of the infection are required so as to plan targeted preventive measures.

Japanese encephalitis: risk for endemic populations and for travellers

The importance of Japanese encephalitis (JE) in endemic populations and in travellers requires a balanced assessment. This disease represents an important public health problem in some endemic areas, which contrasts with the minimal risk for travellers to endemic areas. This is reflected by high numbers of infections mainly among children in endemic countries and by few case reports among tourists and even expatriates. The total number of case reports between 1978 and 2008 amounts to a risk of one to two cases per year. Nevertheless, some travelling groups may be at higher risk when visiting or working in high risk areas. A new vaccine against Japanese encephalitis will soon be registered in Switzerland. This paper contributes to the scarce data available for decision making whether or not to recommend the vaccination to tourists and expatriates.

Toll‐like receptor 4 D299G polymorphism and the incidence of infections in cirrhotic patients

Toll-like receptor (TLR) 4 genetic polymorphisms, mainly D299G, have been associated with increased predisposition to infection in several populations. To retrospectively analyse the relationship between the presence of the TLR4 D299G polymorphism and the incidence of bacterial infections in cirrhotic patients. We included 111 consecutive cirrhotic patients hospitalized with ascites and we determined the presence of the TLR4 D299G polymorphism by PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) and its relationship with the incidence of previous bacterial infections. Ten out of 111 (9%) cirrhotic patients presented with the TLR4 D299G polymorphism. The mean follow-up from first decompensation of cirrhosis until current admission was longer in D299G polymorphism patients than in wild-type patients (53.8 +/- 40.7 vs. 35.4 +/- 48.3 months, P = 0.03). D299G polymorphism patients showed a trend towards a higher incidence of history of previous infections (80% vs. 56.4%, P = 0.19), as well as a higher number of infections (2.8 +/- 2.3 vs. 1.0 +/- 1.3, P = 0.01) and bacteriaemias (0.4 +/- 1.0 vs. 0.04 +/- 0.2, P = 0.02) per patient than wild-type patients. Toll-like receptor 4 D299G polymorphism could influence not only the predisposition to bacterial infections but also the evolution of the disease in cirrhotic patients. Further prospective studies in larger series of patients are warranted.

Astrovirus associated acute gastroenteritis in western India: Predominance of dual serotype strains

A five-year (2004–2008) study was conducted on patients with acute gastroenteritis from different cities of Maharashtra, western India to detect and characterize astrovirus infections. A total of 1340 fecal specimens were collected from sporadic cases that included 1240 children (≤8 years) and 100 adults (18–70 years) from Pune, Aurangabad and Nagpur cities. All specimens were subjected to astrovirus specific RT-PCR followed by sequencing and phylogenetic analysis. The overall positivity to astrovirus was found to be 3.1% with highest number of infections in winter months. A high prevalence of astrovirus was observed in children ≤1 year of age. Phylogenetic analysis of the partial ORF1a (serine protease) and ORF2 (capsid gene) regions showed the circulation of three probable recombinant types with different ORF1a/ORF2 specificities (HAstV-8/HAstV-1, HAstV-7/HAstV-2, HAstV-4/HAstV-5) along with HAstV-8 of a single specificity in the study population. HAstV-8/HAstV-1, specificity predominated (67.7%) in the region followed by HAstV-7/HAstV-2 (9.7%), HAstV-4/HAstV-5 (6.5%) and HAstV-8 (16%) types. This is the first report that highlights the genetic diversity of astrovirus strains circulating in Maharashtra state, western India.

Krankenhaushygiene – Influenza

Influenza is a severe, febrile disease of the airways that occurs epidemically in the winter months. It is caused by influenza viruses. In cycles of about 30 years, these seasonal epidemics progress to pandemics with high numbers of infections and deaths worldwide. In order to prevent just this situation, so-called pandemic plans have been developed worldwide. Besides vaccination, general hygienic precautions and antiviral therapies are the most important measures in the management of influenza. We can only wait and see whether or not the newly appeared H1N1 variant of the influenza virus A (Mexican flu, swine flu) will actually turn out to be a new worldwide pandemic.

Clinical and Laboratory Characteristics of 75 Patients With Specific Polysaccharide Antibody Deficiency Syndrome

Cheng YK, Decker PA, O’Byrne MM, Weiler CR. Ann Allergy Asthma Immunol. 2006;97:306–311 PURPOSE OF THE STUDY. To study the clinical and laboratory characteristics of patients with specific polysaccharide antibody deficiency syndrome. STUDY POPULATION. This was a retrospective review of records obtained over 8 years of patients from the Mayo Clinic (Rochester, MN) who were found to have recurrent infection defined as ≥4 infections per year and an immunoglobulin G (IgG) level of &amp;gt;500 mg/mL. METHODS. Serious infections were defined as pneumococcal sepsis, meningitis, pneumonia, or deep-seated abscess. Specific polysaccharide antibody deficiency syndrome (SPADS) is empirically defined as &amp;lt;9 of 12 serotype responses to vaccination with Pneumovax (titers checked preimmunization and 2–4 weeks postimmunization ×2), and no other documented, established primary or secondary immunodeficiency syndrome. An adequate response to pneumococcal serotypes contained in the vaccine was defined as reaching the protective level defined by the laboratory assay. Loss of immune response 6 months after vaccination was also assessed in patients with recurrent infection. In such patients, vaccination was repeated and serologies were remeasured. RESULTS. Seventy-five patients met the inclusion criteria. The median age at presentation was 42 years (range: 0–76 years), and the median age at diagnosis was 48 years (range: 4–81 years). The median interval between onset of symptoms and diagnosis of SPADS was 4 years. Sixty-nine percent of the patients were female, and 83% were white. The most common documented infections (in order of occurrence) were sinus infection, pneumonia, bronchitis, and ear infections; only 7% of the patients had documented sepsis, meningitis, or deep-tissue abscesses. Eight percent had autoimmune disorder or rheumatic disease. Sixteen percent of the patients had 0 of 12 responses to Pneumovax; 72% had 1 to 6 of 12 responses; and 12% had 7 to 8 of 12 responses. Patients under 18 years of age tended to have less response. The median IgG2 level (150 mg/dL) for patients with 0 responses to Pneumovax tended to be lower compared with patients with &amp;gt;1 response (193 mg/dL; P = .06). When measured, the majority (31 of 35) of the patients had protective levels of antibody to tetanus and diphtheria (18 of 19). In vitro lymphocyte-stimulation test results were normal in the vast majority of patients when measured. Thirty patients were treated with a standard intravenous Ig (IVIg) therapy, 400 mg/kg per month for an undetermined time period. Patients with a higher number of infections (P = .003) and fewer responses to Pneumovax (P = .01) were more likely to receive IVIg. Of the patients receiving IVIg, the number of infections after treatment was significantly lower (median: 1 vs 8; P &amp;lt; .001). CONCLUSIONS. SPADS is a disorder of humoral immunity that is seen in patients with recurrent infections. Response to unconjugated pneumococcal vaccine is abnormal despite normal total IgG levels. Other immune abnormalities are not typically seen. Patients with more frequent infections have less responses to Pneumovax and may clinically respond to IVIg therapy. REVIEWER COMMENTS. This study was chosen for review because of the potential frequency of this problem in patients with recurrent infection. This descriptive, retrospective study had a very mixed population, and some of the patients included would not meet a rigorous definition of SPADS (some with autoimmune disease, poor response to protein antigens). The definition of an abnormal response to pneumococcal vaccination was not well established. The practice parameter for the diagnosis and management of primary immunodeficiency defines response to pneumococcal polysaccharide vaccine as postimmunization antibody concentration of &amp;gt;1.3 μg/mL or fourfold rise over baseline. Children younger than 2 years should not be given a diagnosis of SPADS, because they have a physiologic impairment of antibody production to unconjugated polysaccharide antigens. Prospective studies for a more specific definition and response to treatment are needed for patients with specific antibody deficiency and normal IgG levels.

Osteoarticular infections in HIV-infected patients: 23 cases among 1,515 HIV-infected patients

Background The reported incidence of osteoarticular infections in HIV-infected patients has varied in the literature.Patients and methods We determined the incidence and characteristics of osteoarticular infections reported in a database of 1,515 HIV-infected patients between 1983 and 2003.Results 23 HIV-infected patients were identified with an osteoarticular infection, 11 of whom had a spondylodiscitis. 16 were intravenous drug abusers; this was identified as a risk factor for developing an osteoarticular infection. The most common agent was Staphylococcus aureus. 6 patients required surgical intervention and in a worst-case scenario more than one-fifth had recurrence of their infection.Conclusion Development of an osteoarticular infection is a rare complication in this group of HIV-infected patients, but a remarkably high number of infections of the spine were seen.

One-year results of basiliximab induction and tacrolimus associated with sequential steroid and MMF treatment in pediatric kidney transplant recipient

We report the 1-year results with a triple immunosuppressive regimen in pediatric recipients of a first kidney transplant, in order to evaluate its safety and efficacy in the prevention of acute rejection and in the reduction of steroid side effects. The immunosuppression is as follows: (i) basiliximab (20 mg if body weight >30 kg; 10 mg if < 30 kg) is given pretransplant and at day 4; (ii) tacrolimus (Tac) is administered in order to obtain blood trough levels of 10-20 and 5-10 ng/ml during and after the first 2 months post-transplant, respectively; (iii) steroids are tapered during the first 6 months and then replaced by mycophenolate mofetil (depending on previous rejection episodes, infection status and the result of a routine biopsy) at a dosage of 4-600 mg/m(2) body surface area. Fifty-three children (median age 13 years, range 2-20) have entered this protocol. One-year patient and kidney survival are 100% and 94% respectively. During the first year a total of nine rejections in seven patients (13% of the cohort study) occurred, all but one responsive to steroids. Renal function was satisfactory throughout the first year (mean CrCl was 63.8 +/- 18 and 60.9 +/- 15.5 ml/min/1.73 m(2) at 6 and 12 months respectively). Subclinical signs of rejection were absent in more than 80% of biopsies (grade I Banff) at 6 months (n = 47); at the 12th month biopsy (n = 42) score I was stable in 20 patients (16 after stopping steroids) and had worsened in eight biopsies (six after stopping steroids). Major complications were insulin-dependent diabetes in three (5.6%) children with the need of insulin for a mean of 3 months; transient hyperglycemia (11 patients), treated with a dietary regimen, symptomatic viral infections (in 11 patients: two parvovirus B19, three cytomegalovirus and two Epstein-Barr virus systemic infections, three interstitial pneumonia, two BK nephritis). Tac doses more than 0.3-0.4 mg/kg/day are at significantly higher risk of viral infection. In conclusion, this immunosuppressive regimen is associated with a low percentage of clinical (13%) and subclinical rejections, but with a relatively high number of infections, prevented by a reduction in Tac doses (<0.3 mg/kg/day) during the first 2 months after transplantation. The assessment of steroid withdrawal needs a longer follow-up.

Association of complementary and alternative medicines with HIV clinical disease among a cohort of women living with HIV/AIDS.

To assess the association between the use of complementary and alternative medicine (CAM) and HIV clinical disease indicators, CD4+ T-cell counts, viral load, number of HIV-related infections, Centers for Disease Control and Prevention categories, and Karnofsky scores. Data were collected from 391 HIV-positive women aged 18 to 50 years in Alabama and Georgia. A survey examining CAM use and other sociodemographic variables was used. Multiple logistic regression analyses were used to identify predictors of CAM use. Approximately 60% of study participants used 1 or more type of CAM. Predictors of CAM use included higher educational level (odds ratio [OR] = 2.4; P = 0.0008), absence of health insurance (OR = 0.49; P = 0.0055), longer disease duration (OR = 2.21; P = 0.0006), and higher number of infections (OR = 0.58; P = 0.017). Vitamins were the most commonly used CAM ( approximately 36%). Sociodemographic variables associated with vitamin use included higher educational level (OR = 2.34; P = 0.0055), longer disease duration (OR = 1.87; P = 0.026), and higher use among white women than among African-American women (OR = 0.41; P = 0.017). The use of CAM is prevalent among HIV-positive women, and vitamins are the most commonly used CAM among our study population. Several sociodemographic and clinical factors predicted CAM use. These findings have implications for improvement of care for HIV-positive women.

First Report of Peach latent mosaic viroid and Hop stunt viroid Infecting Peach Trees in the Czech Republic.

Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd) are known to naturally infect stone fruits, but their contemporary presence in peach trees has been reported only recently (3). During a field validation of detection methods developed for sanitary screening of propagation material, PLMVd and HSVd, alone or in mixed infections, were detected in peach trees grown in the trial orchard of the Czech University of Agriculture in Prague. Leaf samples were collected in September 2002 from symptomless trees of peach cultivars imported from the United States (cvs. Sunhaven, Redhaven, Fairhaven, Cresthaven, Dixired, Halehaven, and NJC 103), Slovakia (cv. Luna), and a tree of Chinese wild peach, Prunus davidiana, and analyzed by reverse transcription-polymerase chain reaction (RT-PCR). PLMVd cDNA was amplified as previously reported (2) or by using two sets of primer pairs designed to amplify partial cDNAs, one reverse primer R: GTTTCTACGG CGGTACCTGA, complementary to the nucleotide positions 204 to 223 and forward primers F1: CGTATCTCAACGCCTCATCA, homologous to the positions 109 to 128, and F2: CTGCAGTTCCCGCTAGAAAG, homologous to the positions 15 to 34 of PLMVd reference sequence (2). The two pairs using the R sequence produced the expected size PCR products of 115 and 209 bp, respectively. RT-PCR for HSVd detection was performed as reported (1). The same total RNA preparations were also analyzed by molecular hybridization with nonisotopic riboprobes specific for each viroid. With minor exceptions, both methods gave similar results. Of 66 tested trees, 5 were infected with PLMVd, 46 were infected with PLMVd and HSVd, and 15 were free of both viroids. Viroid free plants included cvs. Luna, Cresthaven, Dixired, and Halehaven and the species P. davidiana. The high number of infections by both viroids was unexpected because mixed infections are generally rare (3). Most likely, mixed infections occurred during field manipulations and propagation of infected materials. To our knowledge, this is the first report of PLMVd in the Czech Republic. Although further investigations are needed to ascertain the spread of stone fruit viroids in the Czech Republic, our results also report an unusually high incidence of mixed infections of peach trees in this country. These results stress the need for a certification program to help control the spread of stone fruit viroids in the Czech Republic.

AIDS-associated cryptococcal meningitis in Rwanda (1983-1992): epidemiologic and diagnostic features.

to document the trend of AIDS-associated Cryptococcus neoformans meningitis (CM) in Kigali, Rwanda, during 1983-1992, and to highlight some diagnostic and epidemiological features of the disease. during the study period, 3476 cerebrospinal fluid (CSF) specimens from 2824 adults (1578 men, 1246 women) were analysed in the Laboratory of Microbiology at the Centre Hospitalier de Kigali, Rwanda, Central Africa, using direct examination, culture and detection of the cryptococcal antigen (CrAg) in the CSF. CM was diagnosed among 549 (19%) patients (347 men, 202 women) and was by far the leading cause of meningitis before Neisseria meningitidis (n=115), Streptococcus pneumoniae (n=68), Mycobacterium tuberculosis (n=26). E. coli, Klebsiella pneumoniae, non-typhoid Salmonella (n=l5) and streptococci (n=4). The number of CM increased from one case in 1983 to 130 new cases in 1992. All 293 tested CM patients had HIV-1 antibodies. The male/female ratio declined from 3.31 during 1983-1987 to 1.58 during 1988-1992. CM showed a seasonal fluctuation, the highest number of infections being observed during the long rainy season. The sensitivity and specificity of the latex test for diagnosing CM was 98% and 99%, respectively. Cryptococcus neoformans var. gattii was cultured from eight (1.6%) of the 499 culture positive patients. CM is an important opportunistic infection among AIDS patients in Central Africa. It remains a problematic diagnosis in areas with limited diagnostic facilities.